| Title: | Efficient manipulation of biological strings |
|---|---|
| Description: | Memory efficient string containers, string matching algorithms, and other utilities, for fast manipulation of large biological sequences or sets of sequences. |
| Authors: | Hervé Pagès [aut, cre], Patrick Aboyoun [aut], Robert Gentleman [aut], Saikat DebRoy [aut], Vince Carey [ctb], Nicolas Delhomme [ctb], Felix Ernst [ctb], Wolfgang Huber [ctb] ('matchprobes' vignette), Beryl Kanali [ctb] (Converted 'MultipleAlignments' vignette from Sweave to RMarkdown), Haleema Khan [ctb] (Converted 'matchprobes' vignette from Sweave to RMarkdown), Aidan Lakshman [ctb], Kieran O'Neill [ctb], Valerie Obenchain [ctb], Marcel Ramos [ctb], Albert Vill [ctb], Jen Wokaty [ctb] (Converted 'matchprobes' vignette from Sweave to RMarkdown), Erik Wright [ctb] |
| Maintainer: | Hervé Pagès <[email protected]> |
| License: | Artistic-2.0 |
| Version: | 2.80.1 |
| Built: | 2026-05-29 06:41:30 UTC |
| Source: | https://github.com/bioc/Biostrings |
An AAString object allows efficient storage and manipulation of a long amino acid sequence.
AAString(x="", start=1, nchar=NA) ## Predefined constants: AA_ALPHABET # full Amino Acid alphabet AA_STANDARD # first 20 letters only AA_PROTEINOGENIC # first 22 letters onlyAAString(x="", start=1, nchar=NA) ## Predefined constants: AA_ALPHABET # full Amino Acid alphabet AA_STANDARD # first 20 letters only AA_PROTEINOGENIC # first 22 letters only
x |
A single string. |
start, nchar
|
Where to start reading from in |
The AAString class is a direct XString subclass (with no additional slot). Therefore all functions and methods described in the XString man page also work with an AAString object (inheritance).
Unlike the BString container that allows storage of any single string (based on a single-byte character set) the AAString container can only store a string based on the Amino Acid alphabet (see below).
This alphabet contains all letters from the
Single-Letter Amino Acid Code (see ?AMINO_ACID_CODE)
plus "*" (the stop letter), "-" (the gap
letter), "+" (the hard masking letter), and "."
(the not a letter or not available letter).
It is stored in the AA_ALPHABET predefined constant (character
vector).
The alphabet() function returns AA_ALPHABET when
applied to an AAString object.
In the code snippet below,
x can be a single string (character vector of length 1)
or a BString object.
AAString(x="", start=1, nchar=NA):Tries to convert x into an AAString object by reading
nchar letters starting at position start in x.
In the code snippet below, x is an AAString object.
alphabet(x):If x is an AAString object, then return the Amino Acid
alphabet (see above).
See the corresponding man pages when x is a
BString, DNAString or RNAString object.
The letters in an AAString object are colored when displayed by the
show() method. Set global option Biostrings.coloring
to FALSE to turn off this coloring.
H. Pagès
AMINO_ACID_CODE,
letter,
XString-class,
alphabetFrequency
AA_ALPHABET a <- AAString("MARKSLEMSIR*") length(a) alphabet(a)AA_ALPHABET a <- AAString("MARKSLEMSIR*") length(a) alphabet(a)
Named character vector mapping single-letter amino acid representations to 3-letter amino acid representations.
## See all the 3-letter codes AMINO_ACID_CODE ## Convert an AAString object to a vector of 3-letter amino acid codes aa <- AAString("LANDEECQW") AMINO_ACID_CODE[strsplit(as.character(aa), NULL)[[1]]]## See all the 3-letter codes AMINO_ACID_CODE ## Convert an AAString object to a vector of 3-letter amino acid codes aa <- AAString("LANDEECQW") AMINO_ACID_CODE[strsplit(as.character(aa), NULL)[[1]]]
Replace letters in a sequence or set of sequences.
## S4 method for signature 'ANY,ANY,XString' chartr(old, new, x) replaceAmbiguities(x, new="N")## S4 method for signature 'ANY,ANY,XString' chartr(old, new, x) replaceAmbiguities(x, new="N")
old |
A character string specifying the characters to be replaced. |
new |
A character string specifying the replacements. It must be a single
letter for |
x |
The sequence or set of sequences to translate.
If |
See ?chartr for the details.
Note that, unlike the standard chartr R function,
the methods for XString, XStringSet, XStringViews
and MaskedXString objects do NOT support character ranges in the
specifications.
replaceAmbiguities() is a simple wrapper around chartr()
that replaces all IUPAC ambiguities with N for objects containing DNA
or RNA sequence data.
An object of the same class and length as the original object.
chartr in the base package.
The replaceAt function for extracting or replacing
arbitrary subsequences from/in a sequence or set of sequences.
The replaceLetterAt function for a DNA-specific
single-letter replacement functions useful for SNP injections.
IUPAC_CODE_MAP for the mapping between IUPAC
nucleotide ambiguity codes and their meaning.
alphabetFrequency (and uniqueLetters)
for tabulating letters in (and extracting the unique letters from)
a sequence or set of sequences.
The XString, XStringSet, XStringViews, and MaskedXString classes.
## --------------------------------------------------------------------- ## A BASIC chartr() EXAMPLE ## --------------------------------------------------------------------- x <- BString("MiXeD cAsE 123") chartr("iXs", "why", x) ## --------------------------------------------------------------------- ## TRANSFORMING DNA WITH BISULFITE (AND SEARCHING IT...) ## --------------------------------------------------------------------- library(BSgenome.Celegans.UCSC.ce2) chrII <- Celegans[["chrII"]] alphabetFrequency(chrII) pattern <- DNAString("TGGGTGTATTTA") ## Transforming and searching the + strand plus_strand <- chartr("C", "T", chrII) alphabetFrequency(plus_strand) matchPattern(pattern, plus_strand) matchPattern(pattern, chrII) ## Transforming and searching the - strand minus_strand <- chartr("G", "A", chrII) alphabetFrequency(minus_strand) matchPattern(reverseComplement(pattern), minus_strand) matchPattern(reverseComplement(pattern), chrII) ## --------------------------------------------------------------------- ## replaceAmbiguities() ## --------------------------------------------------------------------- dna <- DNAStringSet(c("TTTKYTT-GR", "", "NAASACVT")) dna replaceAmbiguities(dna)## --------------------------------------------------------------------- ## A BASIC chartr() EXAMPLE ## --------------------------------------------------------------------- x <- BString("MiXeD cAsE 123") chartr("iXs", "why", x) ## --------------------------------------------------------------------- ## TRANSFORMING DNA WITH BISULFITE (AND SEARCHING IT...) ## --------------------------------------------------------------------- library(BSgenome.Celegans.UCSC.ce2) chrII <- Celegans[["chrII"]] alphabetFrequency(chrII) pattern <- DNAString("TGGGTGTATTTA") ## Transforming and searching the + strand plus_strand <- chartr("C", "T", chrII) alphabetFrequency(plus_strand) matchPattern(pattern, plus_strand) matchPattern(pattern, chrII) ## Transforming and searching the - strand minus_strand <- chartr("G", "A", chrII) alphabetFrequency(minus_strand) matchPattern(reverseComplement(pattern), minus_strand) matchPattern(reverseComplement(pattern), chrII) ## --------------------------------------------------------------------- ## replaceAmbiguities() ## --------------------------------------------------------------------- dna <- DNAStringSet(c("TTTKYTT-GR", "", "NAASACVT")) dna replaceAmbiguities(dna)
XString objects support custom coloring for display. Users can also set custom color palettes for XString objects using the update_X_palette functions.
update_DNA_palette(colors=NULL) update_RNA_palette(colors=NULL) update_AA_palette(colors=NULL) update_B_palette(colors=NULL)update_DNA_palette(colors=NULL) update_RNA_palette(colors=NULL) update_AA_palette(colors=NULL) update_B_palette(colors=NULL)
colors |
A named list of colors to update, with entries |
XString objects support the following default coloring for display.
DNAString: A, C, G, and T are colored red, green, blue, and orange (respectively), N is colored light grey, other ambiguity codes are colored dark grey, and "-+." have no coloring.
RNAString: All bases are colored identically to DNAString. U is colored yellow.
AAString: Amino acids are colored according to JalView's Zappo color scheme, representing physicochemical properties. X is colored light grey, other ambiguity codes are colored dark grey, and "*-+." are not colored.
BStrings are not colored.
Users can change the default color scheme of Biostrings with the update_X_palette family functions. Each function expects a list with named entries corresponding to the values to update. Each entry can specify 'fg' and 'bg' values, corresponding to the foreground and background colors (respectively). If 'fg' is not specified, it defaults to rgb(1,1,1) (white). If 'bg' is not specified, it defaults to transparent.
These functions will only update the values passed, leaving the rest of the colors as-is. For example, calling update_AA_palette(list(A=list(fg="green"))) would update the coloring for A while leaving all other colors as the default schema.
To reset all colors to the default palette, call the function with no arguments (NULL).
To remove a coloring for a specific value, provide a named entry with value NULL. For example, update_AA_palette(list(A=NULL)) will remove the coloring for A.
update_DNA_palette and update_RNA_palette are identical internally, so either function can be used to update colorings for T,U.
See the Examples section for more examples of custom colorings.
For update_X_palette, Invisibly returns the new color mapping, consisting of a named character vector. Calling cat on the return value will print out all letters with their respective coloring.
Aidan Lakshman <[email protected]>
## display default colors DNAString(paste(DNA_ALPHABET, collapse='')) RNAString(paste(RNA_ALPHABET, collapse='')) AAString(paste(AA_ALPHABET, collapse='')) BString(paste(LETTERS, collapse='')) ## create new palettes DNA_palette <- list( A=list(fg="blue",bg="black"), T=list(fg="red",bg='black'), G=list(fg='green',bg='black'), C=list(fg='yellow',bg='black') ) update_DNA_palette(DNA_palette) DNAString(paste(DNA_ALPHABET, collapse='')) ## reset to default palette update_DNA_palette() DNAString(paste(DNA_ALPHABET, collapse='')) ## colors can also be specified with `rgb()` AA_palette <- list( A=list(fg="white", bg="purple"), B=list(fg=rgb(1,1,1), bg='orange') ) update_AA_palette(AA_palette) AAString(paste(AA_ALPHABET, collapse='')) ## remove all coloring for QEG update_AA_palette(list(Q=NULL, E=NULL, G=NULL)) AAString(paste(AA_ALPHABET, collapse='')) ## reset to default update_AA_palette() AAString(paste(AA_ALPHABET, collapse='')) ## We can also add colors to BStrings, ## which are normally not colored ## if 'fg' is not specified, defaults to rgb(1,1,1) ## if 'bg' is not specified, background is transparent B_palette <- list( A=list(bg='green'), B=list(bg="red"), C=list(bg='blue'), D=list(fg="orange"), E=list(fg="yellow") ) update_B_palette(B_palette) BString(paste(LETTERS, collapse='')) ## can also directly view the changes with cat cat(update_B_palette(B_palette), '\n') ## reset to default update_B_palette() BString(paste(LETTERS, collapse=''))## display default colors DNAString(paste(DNA_ALPHABET, collapse='')) RNAString(paste(RNA_ALPHABET, collapse='')) AAString(paste(AA_ALPHABET, collapse='')) BString(paste(LETTERS, collapse='')) ## create new palettes DNA_palette <- list( A=list(fg="blue",bg="black"), T=list(fg="red",bg='black'), G=list(fg='green',bg='black'), C=list(fg='yellow',bg='black') ) update_DNA_palette(DNA_palette) DNAString(paste(DNA_ALPHABET, collapse='')) ## reset to default palette update_DNA_palette() DNAString(paste(DNA_ALPHABET, collapse='')) ## colors can also be specified with `rgb()` AA_palette <- list( A=list(fg="white", bg="purple"), B=list(fg=rgb(1,1,1), bg='orange') ) update_AA_palette(AA_palette) AAString(paste(AA_ALPHABET, collapse='')) ## remove all coloring for QEG update_AA_palette(list(Q=NULL, E=NULL, G=NULL)) AAString(paste(AA_ALPHABET, collapse='')) ## reset to default update_AA_palette() AAString(paste(AA_ALPHABET, collapse='')) ## We can also add colors to BStrings, ## which are normally not colored ## if 'fg' is not specified, defaults to rgb(1,1,1) ## if 'bg' is not specified, background is transparent B_palette <- list( A=list(bg='green'), B=list(bg="red"), C=list(bg='blue'), D=list(fg="orange"), E=list(fg="yellow") ) update_B_palette(B_palette) BString(paste(LETTERS, collapse='')) ## can also directly view the changes with cat cat(update_B_palette(B_palette), '\n') ## reset to default update_B_palette() BString(paste(LETTERS, collapse=''))
This is a variant of show, offering a more detailed
display of object content.
detail(x, ...)detail(x, ...)
x |
An object. The default simply invokes |
... |
Additional arguments. The default definition makes no use of these arguments. |
None; the function is invoked for its side effect (detailed display of object content).
Martin Morgan
origMAlign <- readDNAMultipleAlignment(filepath = system.file("extdata", "msx2_mRNA.aln", package="Biostrings"), format="clustal") detail(origMAlign)origMAlign <- readDNAMultipleAlignment(filepath = system.file("extdata", "msx2_mRNA.aln", package="Biostrings"), format="clustal") detail(origMAlign)
Performs Person's chi-squared test, G-test, or William's corrected G-test to determine dependence between two nucleotide positions.
dinucleotideFrequencyTest(x, i, j, test = c("chisq", "G", "adjG"), simulate.p.value = FALSE, B = 2000)dinucleotideFrequencyTest(x, i, j, test = c("chisq", "G", "adjG"), simulate.p.value = FALSE, B = 2000)
x |
A DNAStringSet or RNAStringSet object. |
i, j
|
Single integer values for positions to test for dependence. |
test |
One of |
simulate.p.value |
a logical indicating whether to compute p-values by Monte Carlo simulation. |
B |
an integer specifying the number of replicates used in the Monte Carlo test. |
The null and alternative hypotheses for this function are:
positions i and j are independent
otherwise
Let O and E be the observed and expected probabilities for base pair
combinations at positions i and j respectively. Then the
test statistics are calculated as:
test="chisq": stat = sum(abs(O - E)^2/E)
test="G": stat = 2 * sum(O * log(O/E))
test="adjG": stat = 2 * sum(O * log(O/E))/q, where q = 1 + ((df - 1)^2 - 1)/(6*length(x)*(df - 2))
Under the null hypothesis, these test statistics are approximately distributed chi-squared(df = ((distinct bases at i) - 1) * ((distinct bases at j) - 1)).
An htest object. See help(chisq.test) for more details.
P. Aboyoun
Ellrott, K., Yang, C., Sladek, F.M., Jiang, T. (2002) "Identifying transcription factor binding sites through Markov chain optimations", Bioinformatics, 18 (Suppl. 2), S100-S109.
Sokal, R.R., Rohlf, F.J. (2003) "Biometry: The Principle and Practice of Statistics in Biological Research", W.H. Freeman and Company, New York.
Tomovic, A., Oakeley, E. (2007) "Position dependencies in transcription factor binding sites", Bioinformatics, 23, 933-941.
Williams, D.A. (1976) "Improved Likelihood ratio tests for complete contingency tables", Biometrika, 63, 33-37.
nucleotideFrequencyAt,
XStringSet-class,
chisq.test
data(HNF4alpha) dinucleotideFrequencyTest(HNF4alpha, 1, 2) dinucleotideFrequencyTest(HNF4alpha, 1, 2, test = "G") dinucleotideFrequencyTest(HNF4alpha, 1, 2, test = "adjG")data(HNF4alpha) dinucleotideFrequencyTest(HNF4alpha, 1, 2) dinucleotideFrequencyTest(HNF4alpha, 1, 2, test = "G") dinucleotideFrequencyTest(HNF4alpha, 1, 2, test = "adjG")
A DNAString object allows efficient storage and manipulation of a long DNA sequence.
The DNAString class is a direct XString subclass (with no additional slot). Therefore all functions and methods described in the XString man page also work with a DNAString object (inheritance).
Unlike the BString container that allows storage of any single string (based on a single-byte character set) the DNAString container can only store a string based on the DNA alphabet (see below). In addition, the letters stored in a DNAString object are encoded in a way that optimizes fast search algorithms.
This alphabet contains all letters from the
IUPAC Extended Genetic Alphabet (see ?IUPAC_CODE_MAP)
plus "-" (the gap letter), "+" (the hard
masking letter), and "." (the not a letter or not
available letter).
It is stored in the DNA_ALPHABET predefined constant (character
vector).
The alphabet() function returns DNA_ALPHABET when
applied to a DNAString object.
In the code snippet below,
x can be a single string (character vector of length 1),
a BString object or an RNAString object.
DNAString(x="", start=1, nchar=NA):Tries to convert x into a DNAString object by reading
nchar letters starting at position start in x.
In the code snippet below, x is a DNAString object.
alphabet(x, baseOnly=FALSE):If x is a DNAString object, then return the DNA
alphabet (see above).
See the corresponding man pages when x is a
BString, RNAString or AAString object.
The letters in a DNAString object are colored when displayed by the
show() method. Set global option Biostrings.coloring
to FALSE to turn off this coloring.
H. Pagès
The DNAStringSet class to represent a collection of DNAString objects.
DNA_BASES DNA_ALPHABET dna <- DNAString("TTGAAAA-CTC-N") dna # 'options(Biostrings.coloring=FALSE)' to turn off coloring length(dna) alphabet(dna) # DNA_ALPHABET alphabet(dna, baseOnly=TRUE) # DNA_BASESDNA_BASES DNA_ALPHABET dna <- DNAString("TTGAAAA-CTC-N") dna # 'options(Biostrings.coloring=FALSE)' to turn off coloring length(dna) alphabet(dna) # DNA_ALPHABET alphabet(dna, baseOnly=TRUE) # DNA_BASES
The findPalindromes function can be used to find palindromic
regions in a sequence.
palindromeArmLength, palindromeLeftArm, and
palindromeRightArm are utility functions for operating on
palindromic sequences. They should typically be used on the output
of findPalindromes.
findPalindromes(subject, min.armlength=4, max.looplength=1, min.looplength=0, max.mismatch=0, allow.wobble=FALSE) palindromeArmLength(x, max.mismatch=0, allow.wobble=FALSE) palindromeLeftArm(x, max.mismatch=0, allow.wobble=FALSE) palindromeRightArm(x, max.mismatch=0, allow.wobble=FALSE)findPalindromes(subject, min.armlength=4, max.looplength=1, min.looplength=0, max.mismatch=0, allow.wobble=FALSE) palindromeArmLength(x, max.mismatch=0, allow.wobble=FALSE) palindromeLeftArm(x, max.mismatch=0, allow.wobble=FALSE) palindromeRightArm(x, max.mismatch=0, allow.wobble=FALSE)
subject |
An XString object containing the subject string, or an XStringViews object. |
min.armlength |
An integer giving the minimum length of the arms of the palindromes to search for. |
max.looplength |
An integer giving the maximum length of "the loop" (i.e the sequence
separating the 2 arms) of the palindromes to search for.
Note that by default ( |
min.looplength |
An integer giving the minimum length of "the loop" of the palindromes to search for. |
max.mismatch |
The maximum number of mismatching letters allowed between the 2 arms of the palindromes to search for. |
allow.wobble |
Logical indicating whether wobble base pairs (G/U or G/T base pairings) should be treated as mismatches (the default) or matches. |
x |
An XString object containing a 2-arm palindrome, or an XStringViews object containing a set of 2-arm palindromes. |
The findPalindromes function finds palindromic substrings in a subject
string. The palindromes that can be searched for are either strict
palindromes or 2-arm palindromes (the former being a particular case of
the latter) i.e. palindromes where the 2 arms are separated by an arbitrary
sequence called "the loop".
If the subject string is a nucleotide sequence (i.e. DNA or RNA), the 2 arms must contain sequences that are reverse complement from each other. Otherwise, they must contain sequences that are the same.
findPalindromes returns an XStringViews object containing all
palindromes found in subject (one view per palindromic substring
found).
palindromeArmLength returns the arm length (integer) of the 2-arm
palindrome x. It will raise an error if x has no arms. Note
that any sequence could be considered a 2-arm palindrome if we were OK with
arms of length 0 but we are not: x must have arms of length greater
or equal to 1 in order to be considered a 2-arm palindrome.
When applied to an XStringViews object x,
palindromeArmLength behaves in a vectorized fashion by returning
an integer vector of the same length as x.
palindromeLeftArm returns an object of the same class as the original
object x and containing the left arm of x.
palindromeRightArm does the same as palindromeLeftArm but on
the right arm of x.
Like palindromeArmLength, both palindromeLeftArm and
palindromeRightArm will raise an error if x has no arms.
Also, when applied to an XStringViews object x, both behave
in a vectorized fashion by returning an XStringViews object of the
same length as x.
H. Pagès, with contributions from Erik Wright and Thomas McCarthy
maskMotif,
matchPattern,
matchLRPatterns,
matchProbePair,
XStringViews-class,
DNAString-class
x0 <- BString("abbbaabbcbbaccacabbbccbcaabbabacca") pals0a <- findPalindromes(x0, min.armlength=3, max.looplength=5) pals0a palindromeArmLength(pals0a) palindromeLeftArm(pals0a) palindromeRightArm(pals0a) pals0b <- findPalindromes(x0, min.armlength=9, max.looplength=5, max.mismatch=3) pals0b palindromeArmLength(pals0b, max.mismatch=3) palindromeLeftArm(pals0b, max.mismatch=3) palindromeRightArm(pals0b, max.mismatch=3) ## Whitespaces matter: x1 <- BString("Delia saw I was aileD") palindromeArmLength(x1) palindromeLeftArm(x1) palindromeRightArm(x1) x2 <- BString("was it a car or a cat I saw") palindromeArmLength(x2) palindromeLeftArm(x2) palindromeRightArm(x2) ## On a DNA or RNA sequence: x3 <- DNAString("CCGAAAACCATGATGGTTGCCAG") findPalindromes(x3) findPalindromes(RNAString(x3)) ## Note that palindromes can be nested: x4 <- DNAString("ACGTTNAACGTCCAAAATTTTCCACGTTNAACGT") findPalindromes(x4, max.looplength=19) ## Treat wobble base pairings as matches: x5 <- RNAString("AUGUCUNNNNAGGCGU") findPalindromes(x5, max.looplength=4, min.looplength=4) findPalindromes(x5, max.looplength=4, min.looplength=4, max.mismatch=2) findPalindromes(x5, max.looplength=4, min.looplength=4, allow.wobble=TRUE) ## A real use case: library(BSgenome.Dmelanogaster.UCSC.dm3) chrX <- Dmelanogaster$chrX chrX_pals0 <- findPalindromes(chrX, min.armlength=40, max.looplength=80) chrX_pals0 palindromeArmLength(chrX_pals0) # 251 70 262 ## Allowing up to 2 mismatches between the 2 arms: chrX_pals2 <- findPalindromes(chrX, min.armlength=40, max.looplength=80, max.mismatch=2) chrX_pals2 palindromeArmLength(chrX_pals2, max.mismatch=2) # 254 77 44 48 40 264x0 <- BString("abbbaabbcbbaccacabbbccbcaabbabacca") pals0a <- findPalindromes(x0, min.armlength=3, max.looplength=5) pals0a palindromeArmLength(pals0a) palindromeLeftArm(pals0a) palindromeRightArm(pals0a) pals0b <- findPalindromes(x0, min.armlength=9, max.looplength=5, max.mismatch=3) pals0b palindromeArmLength(pals0b, max.mismatch=3) palindromeLeftArm(pals0b, max.mismatch=3) palindromeRightArm(pals0b, max.mismatch=3) ## Whitespaces matter: x1 <- BString("Delia saw I was aileD") palindromeArmLength(x1) palindromeLeftArm(x1) palindromeRightArm(x1) x2 <- BString("was it a car or a cat I saw") palindromeArmLength(x2) palindromeLeftArm(x2) palindromeRightArm(x2) ## On a DNA or RNA sequence: x3 <- DNAString("CCGAAAACCATGATGGTTGCCAG") findPalindromes(x3) findPalindromes(RNAString(x3)) ## Note that palindromes can be nested: x4 <- DNAString("ACGTTNAACGTCCAAAATTTTCCACGTTNAACGT") findPalindromes(x4, max.looplength=19) ## Treat wobble base pairings as matches: x5 <- RNAString("AUGUCUNNNNAGGCGU") findPalindromes(x5, max.looplength=4, min.looplength=4) findPalindromes(x5, max.looplength=4, min.looplength=4, max.mismatch=2) findPalindromes(x5, max.looplength=4, min.looplength=4, allow.wobble=TRUE) ## A real use case: library(BSgenome.Dmelanogaster.UCSC.dm3) chrX <- Dmelanogaster$chrX chrX_pals0 <- findPalindromes(chrX, min.armlength=40, max.looplength=80) chrX_pals0 palindromeArmLength(chrX_pals0) # 251 70 262 ## Allowing up to 2 mismatches between the 2 arms: chrX_pals2 <- findPalindromes(chrX, min.armlength=40, max.looplength=80, max.mismatch=2) chrX_pals2 palindromeArmLength(chrX_pals2, max.mismatch=2) # 254 77 44 48 40 264
Two predefined objects (GENETIC_CODE and RNA_GENETIC_CODE)
that represent The Standard Genetic Code.
Other genetic codes are stored in predefined table GENETIC_CODE_TABLE
from which they can conveniently be extracted with getGeneticCode.
## The Standard Genetic Code: GENETIC_CODE RNA_GENETIC_CODE ## All the known genetic codes: GENETIC_CODE_TABLE getGeneticCode(id_or_name2="1", full.search=FALSE, as.data.frame=FALSE)## The Standard Genetic Code: GENETIC_CODE RNA_GENETIC_CODE ## All the known genetic codes: GENETIC_CODE_TABLE getGeneticCode(id_or_name2="1", full.search=FALSE, as.data.frame=FALSE)
id_or_name2 |
A single string that uniquely identifies the genetic code to extract.
Should be one of the values in the |
full.search |
By default, only the |
as.data.frame |
Should the genetic code be returned as a data frame instead of a named character vector? |
Formally, a genetic code is a mapping between the 64 tri-nucleotide sequences (called codons) and amino acids.
The Standard Genetic Code (a.k.a. The Canonical Genetic Code, or simply The Genetic Code) is the particular mapping that encodes the vast majority of genes in nature.
GENETIC_CODE and RNA_GENETIC_CODE are predefined named
character vectors that represent this mapping.
All the known genetic codes are summarized in GENETIC_CODE_TABLE,
which is a predefined data frame with one row per known genetic code.
Use getGeneticCode to extract one genetic code at a time from
this object.
GENETIC_CODE and RNA_GENETIC_CODE are both named character
vectors of length 64 (the number of all possible tri-nucleotide sequences)
where each element is a single letter representing either an amino acid
or the stop codon "*" (aka termination codon).
The names of the GENETIC_CODE vector are the DNA codons i.e. the
tri-nucleotide sequences (directed 5' to 3') that are assumed to belong
to the "coding DNA strand" (aka "sense DNA strand" or "non-template DNA
strand") of the gene.
The names of the RNA_GENETIC_CODE are the RNA codons i.e. the
tri-nucleotide sequences (directed 5' to 3') that are assumed to belong
to the mRNA of the gene.
Note that the values in the GENETIC_CODE and RNA_GENETIC_CODE
vectors are the same, only their names are different. The names of the
latter are those of the former where all occurrences of T (thymine) have
been replaced by U (uracil).
Finally, both vectors have an alt_init_codons attribute on them,
that lists the alternative initiation codons. Note that codons that
always translate to M (Methionine) (e.g. ATG in GENETIC_CODE
or AUG in RNA_GENETIC_CODE) are omitted from the
alt_init_codons attribute.
GENETIC_CODE_TABLE is a data frame that contains all the known
genetic codes listed at ftp://ftp.ncbi.nih.gov/entrez/misc/data/gc.prt.
The data frame has one row per known genetic code and the 5 following
columns:
name: The long and very descriptive name of the genetic code.
name2: The short name of the genetic code (not all genetic
codes have one).
id: The id of the genetic code.
AAs: A 64-character string representing the genetic code
itself in a compact form (i.e. one letter per codon, the codons
are assumed to be ordered like in GENETIC_CODE).
Starts: A 64-character string indicating the Initiation
Codons.
By default (i.e. when as.data.frame is set to FALSE),
getGeneticCode returns a named character vector of length 64
similar to GENETIC_CODE i.e. it contains 1-letter strings from
the Amino Acid alphabet (see ?AA_ALPHABET) and its names
are identical to names(GENETIC_CODE). In addition it has an attribute
on it, the alt_init_codons attribute, that lists the alternative
initiation codons. Note that codons that always translate to M
(Methionine) (e.g. ATG) are omitted from the alt_init_codons
attribute.
When as.data.frame is set to TRUE, getGeneticCode returns a
data frame with 64 rows (one per codon), rownames (3-letter strings
representing the codons), and the 2 following columns:
AA: A 1-letter string from the Amino Acid alphabet (see
?AA_ALPHABET) representing the amino acid mapped to
the codon ("*" is used to mark the stop codon).
Start: A 1-letter string indicating an alternative mapping
for the codon i.e. what amino acid the codon is mapped to when it's
the first tranlated codon.
The rownames of the data frame are identical to names(GENETIC_CODE).
H. Pagès
All the known genetic codes are described here:
http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi
The "official names" of the various codes ("Standard", "SGC0", "Vertebrate Mitochondrial", "SGC1", etc..) and their ids (1, 2, etc...) were taken from the print-form ASN.1 version of the above document (version 4.0 at the time of this writing):
ftp://ftp.ncbi.nih.gov/entrez/misc/data/gc.prt
The translate and trinucleotideFrequency
functions.
## --------------------------------------------------------------------- ## THE STANDARD GENETIC CODE ## --------------------------------------------------------------------- GENETIC_CODE ## Codon ATG is *always* translated to M (Methionine) GENETIC_CODE[["ATG"]] ## Codons TTG and CTG are "normally" translated to L except when they are ## the first translated codon (a.k.a. start codon or initiation codon), ## in which case they are translated to M: attr(GENETIC_CODE, "alt_init_codons") GENETIC_CODE[["TTG"]] GENETIC_CODE[["CTG"]] sort(table(GENETIC_CODE)) # the same amino acid can be encoded by 1 # to 6 different codons RNA_GENETIC_CODE all(GENETIC_CODE == RNA_GENETIC_CODE) # TRUE ## --------------------------------------------------------------------- ## ALL THE KNOWN GENETIC CODES ## --------------------------------------------------------------------- GENETIC_CODE_TABLE[1:3 , ] getGeneticCode("SGC0") # The Standard Genetic Code, again stopifnot(identical(getGeneticCode("SGC0"), GENETIC_CODE)) getGeneticCode("SGC1") # Vertebrate Mitochondrial getGeneticCode("ascidian", full.search=TRUE) # Ascidian Mitochondrial ## --------------------------------------------------------------------- ## EXAMINE THE DIFFERENCES BETWEEN THE STANDARD CODE AND A NON-STANDARD ## ONE ## --------------------------------------------------------------------- idx <- which(GENETIC_CODE != getGeneticCode("SGC1")) rbind(Standard=GENETIC_CODE[idx], SGC1=getGeneticCode("SGC1")[idx])## --------------------------------------------------------------------- ## THE STANDARD GENETIC CODE ## --------------------------------------------------------------------- GENETIC_CODE ## Codon ATG is *always* translated to M (Methionine) GENETIC_CODE[["ATG"]] ## Codons TTG and CTG are "normally" translated to L except when they are ## the first translated codon (a.k.a. start codon or initiation codon), ## in which case they are translated to M: attr(GENETIC_CODE, "alt_init_codons") GENETIC_CODE[["TTG"]] GENETIC_CODE[["CTG"]] sort(table(GENETIC_CODE)) # the same amino acid can be encoded by 1 # to 6 different codons RNA_GENETIC_CODE all(GENETIC_CODE == RNA_GENETIC_CODE) # TRUE ## --------------------------------------------------------------------- ## ALL THE KNOWN GENETIC CODES ## --------------------------------------------------------------------- GENETIC_CODE_TABLE[1:3 , ] getGeneticCode("SGC0") # The Standard Genetic Code, again stopifnot(identical(getGeneticCode("SGC0"), GENETIC_CODE)) getGeneticCode("SGC1") # Vertebrate Mitochondrial getGeneticCode("ascidian", full.search=TRUE) # Ascidian Mitochondrial ## --------------------------------------------------------------------- ## EXAMINE THE DIFFERENCES BETWEEN THE STANDARD CODE AND A NON-STANDARD ## ONE ## --------------------------------------------------------------------- idx <- which(GENETIC_CODE != getGeneticCode("SGC1")) rbind(Standard=GENETIC_CODE[idx], SGC1=getGeneticCode("SGC1")[idx])
A generic function for extracting a set of sequences (or subsequences) from a sequence container like a BSgenome object or other.
getSeq(x, ...)getSeq(x, ...)
x |
A BSgenome object or any other supported object.
Do |
... |
Any additional arguments needed by the specialized methods. |
An XString object or an XStringSet object or a character vector containing the extracted sequence(s).
See man pages of individual methods for the details e.g. with
?`getSeq,BSgenome-method` to access the man page
of the method for BSgenome objects (make sure the
BSgenome package is loaded first).
getSeq,BSgenome-method, XString-class, XStringSet-class
## Note that you need to load the package(s) defining the specialized ## methods to have showMethods() display them and to be able to access ## their man pages: library(BSgenome) showMethods("getSeq")## Note that you need to load the package(s) defining the specialized ## methods to have showMethods() display them and to be able to access ## their man pages: library(BSgenome) showMethods("getSeq")
This is a replacement for the standard gregexpr function that does exact matching only. Standard gregexpr() misses matches when they are overlapping. The gregexpr2 function finds all matches but it only works in "fixed" mode i.e. for exact matching (regular expressions are not supported).
gregexpr2(pattern, text)gregexpr2(pattern, text)
pattern |
character string to be matched in the given character vector |
text |
a character vector where matches are sought |
A list of the same length as text each element of
which is an integer vector as in gregexpr,
except that the starting positions of all (even overlapping)
matches are given.
Note that, unlike gregexpr, gregexpr2 doesn't attach a "match.length"
attribute to each element of the returned list because, since it only works
in "fixed" mode, then all the matches have the length of the pattern.
Another difference with gregexpr is that with gregexpr2,
the pattern argument must be a single (non-NA, non-empty) string.
H. Pagès
gregexpr("aa", c("XaaaYaa", "a"), fixed=TRUE) gregexpr2("aa", c("XaaaYaa", "a"))gregexpr("aa", c("XaaaYaa", "a"), fixed=TRUE) gregexpr2("aa", c("XaaaYaa", "a"))
Seventy one known HNF4alpha binding sequences
A DNAStringSet containing 71 known binding sequences for HNF4alpha.
P. Aboyoun
Ellrott, K., Yang, C., Sladek, F.M., Jiang, T. (2002) "Identifying transcription factor binding sites through Markov chain optimations", Bioinformatics, 18 (Suppl. 2), S100-S109.
data(HNF4alpha) HNF4alphadata(HNF4alpha) HNF4alpha
injectHardMask allows the user to "fill" the masked regions
of a sequence with an arbitrary letter (typically the "+"
letter).
injectHardMask(x, letter="+")injectHardMask(x, letter="+")
x |
A MaskedXString or XStringViews object. |
letter |
A single letter. |
The name of the injectHardMask function was chosen because of the
primary use that it is intended for: converting a pile of active "soft
masks" into a "hard mask".
Here the pile of active "soft masks" refers to the active masks that have
been put on top of a sequence. In Biostrings, the original sequence and the
masks defined on top of it are bundled together in one of the dedicated
containers for this: the MaskedBString, MaskedDNAString,
MaskedRNAString and MaskedAAString containers (this is the
MaskedXString family of containers).
The original sequence is always stored unmodified in a MaskedXString
object so no information is lost. This allows the user to activate/deactivate
masks without having to worry about losing the letters that are in the
regions that are masked/unmasked. Also this allows better memory
management since the original sequence never needs to be copied, even when
the set of active/inactive masks changes.
However, there are situations where the user might want to really
get rid of the letters that are in some particular regions by replacing
them with a junk letter (e.g. "+") that is guaranteed to not interfer
with the analysis that s/he is currently doing.
For example, it's very likely that a set of motifs or short reads will not
contain the "+" letter (this could easily be checked) so they will
never hit the regions filled with "+".
In a way, it's like the regions filled with "+" were masked but we
call this kind of masking "hard masking".
Some important differences between "soft" and "hard" masking:
injectHardMask creates a (modified) copy of the original
sequence. Using "soft masking" does not.
A function that is "mask aware" like alphabetFrequency or
matchPattern will really skip the masked regions
when "soft masking" is used i.e. they will not walk thru the
regions that are under active masks. This might lead to some
speed improvements when a high percentage of the original sequence
is masked.
With "hard masking", the entire sequence is walked thru.
Matches cannot span over masked regions with "soft masking". With "hard masking" they can.
An XString object of the same length as the orignal object x
if x is a MaskedXString object, or of the same length
as subject(x) if it's an XStringViews object.
H. Pagès
maskMotif,
MaskedXString-class,
replaceLetterAt,
chartr,
XString,
XStringViews-class
## --------------------------------------------------------------------- ## A. WITH AN XStringViews OBJECT ## --------------------------------------------------------------------- v2 <- Views("abCDefgHIJK", start=c(8, 3), end=c(14, 4)) injectHardMask(v2) injectHardMask(v2, letter="=") ## --------------------------------------------------------------------- ## B. WITH A MaskedXString OBJECT ## --------------------------------------------------------------------- mask0 <- Mask(mask.width=29, start=c(3, 10, 25), width=c(6, 8, 5)) x <- DNAString("ACACAACTAGATAGNACTNNGAGAGACGC") masks(x) <- mask0 x subject <- injectHardMask(x) ## Matches can span over masked regions with "hard masking": matchPattern("ACggggggA", subject, max.mismatch=6) ## but not with "soft masking": matchPattern("ACggggggA", x, max.mismatch=6)## --------------------------------------------------------------------- ## A. WITH AN XStringViews OBJECT ## --------------------------------------------------------------------- v2 <- Views("abCDefgHIJK", start=c(8, 3), end=c(14, 4)) injectHardMask(v2) injectHardMask(v2, letter="=") ## --------------------------------------------------------------------- ## B. WITH A MaskedXString OBJECT ## --------------------------------------------------------------------- mask0 <- Mask(mask.width=29, start=c(3, 10, 25), width=c(6, 8, 5)) x <- DNAString("ACACAACTAGATAGNACTNNGAGAGACGC") masks(x) <- mask0 x subject <- injectHardMask(x) ## Matches can span over masked regions with "hard masking": matchPattern("ACggggggA", subject, max.mismatch=6) ## but not with "soft masking": matchPattern("ACggggggA", x, max.mismatch=6)
The IUPAC_CODE_MAP named character vector contains the mapping from
the IUPAC nucleotide ambiguity codes to their meaning.
The mergeIUPACLetters function provides the reverse mapping.
IUPAC_CODE_MAP mergeIUPACLetters(x)IUPAC_CODE_MAP mergeIUPACLetters(x)
x |
A vector of non-empty character strings made of IUPAC letters. |
IUPAC nucleotide ambiguity codes are used for representing sequences of nucleotides where the exact nucleotides that occur at some given positions are not known with certainty.
IUPAC_CODE_MAP is a named character vector where the names are
the IUPAC nucleotide ambiguity codes and the values are their corresponding
meanings. The meaning of each code is described by a string that enumarates
the base letters ("A", "C", "G" or "T")
associated with the code.
The value returned by mergeIUPACLetters is an unnamed character
vector of the same length as its argument x where each element
is an IUPAC nucleotide ambiguity code.
H. Pagès
http://www.chick.manchester.ac.uk/SiteSeer/IUPAC\_codes.html
IUPAC-IUB SYMBOLS FOR NUCLEOTIDE NOMENCLATURE: Cornish-Bowden (1985) Nucl. Acids Res. 13: 3021-3030.
IUPAC_CODE_MAP some_iupac_codes <- c("R", "M", "G", "N", "V") IUPAC_CODE_MAP[some_iupac_codes] mergeIUPACLetters(IUPAC_CODE_MAP[some_iupac_codes]) mergeIUPACLetters(c("Ca", "Acc", "aA", "MAAmC", "gM", "AB", "bS", "mk"))IUPAC_CODE_MAP some_iupac_codes <- c("R", "M", "G", "N", "V") IUPAC_CODE_MAP[some_iupac_codes] mergeIUPACLetters(IUPAC_CODE_MAP[some_iupac_codes]) mergeIUPACLetters(c("Ca", "Acc", "aA", "MAAmC", "gM", "AB", "bS", "mk"))
Functions for searching the Longest Common Prefix/Suffix of two strings.
WARNING: These functions are experimental and might not work properly! Full documentation will come later.
Thanks for your comprehension!
lcprefix(s1, s2) lcsuffix(s1, s2)lcprefix(s1, s2) lcsuffix(s1, s2)
s1 |
1st string, a character string or an XString object. |
s2 |
2nd string, a character string or an XString object. |
matchPattern, XStringViews-class, XString-class
Extract a substring from a string by picking up individual letters by their position.
letter(x, i)letter(x, i)
x |
A character vector, or an XString, XStringViews or MaskedXString object. |
i |
An integer vector with no NAs. |
Unlike with the substr or substring functions,
i must contain valid positions.
A character vector of length 1 when x is an XString
or MaskedXString object (the masks are ignored for the latter).
A character vector of the same length as x when x
is a character vector or an XStringViews object.
Note that, because i must contain valid positions,
all non-NA elements in the result are guaranteed to have exactly
length(i) characters.
subseq,
XString-class,
XStringViews-class,
MaskedXString-class
x <- c("abcd", "ABC") i <- c(3, 1, 1, 2, 1) ## With a character vector: letter(x[1], 3:1) letter(x, 3) letter(x, i) #letter(x, 4) # Error! ## With a BString object: letter(BString(x[1]), i) # returns a character vector BString(x[1])[i] # returns a BString object ## With an XStringViews object: x2 <- as(BStringSet(x), "Views") letter(x2, i)x <- c("abcd", "ABC") i <- c(3, 1, 1, 2, 1) ## With a character vector: letter(x[1], 3:1) letter(x, 3) letter(x, i) #letter(x, 4) # Error! ## With a BString object: letter(BString(x[1]), i) # returns a character vector BString(x[1])[i] # returns a BString object ## With an XStringViews object: x2 <- as(BStringSet(x), "Views") letter(x2, i)
Given a biological sequence (or a set of biological sequences),
the alphabetFrequency function computes the frequency of
each letter of the relevant alphabet.
letterFrequency is similar, but more compact if one is only
interested in certain letters.
It can also tabulate letters "in common".
letterFrequencyInSlidingView is a more specialized version
of letterFrequency for (non-masked) XString objects.
It tallys the requested letter frequencies for a fixed-width view,
or window, that is conceptually slid along the entire input sequence.
The consensusMatrix function computes the consensus matrix
of a set of sequences, and the consensusString function creates
the consensus sequence from the consensus matrix based upon specified
criteria.
In this man page we call "DNA input" (or "RNA input") an XString, XStringSet, XStringViews or MaskedXString object of base type DNA (or RNA).
alphabetFrequency(x, as.prob=FALSE, ...) hasOnlyBaseLetters(x) uniqueLetters(x) letterFrequency(x, letters, OR="|", as.prob=FALSE, ...) letterFrequencyInSlidingView(x, view.width, letters, OR="|", as.prob=FALSE) consensusMatrix(x, as.prob=FALSE, shift=0L, width=NULL, ...) ## S4 method for signature 'matrix' consensusString(x, ambiguityMap="?", threshold=0.5) ## S4 method for signature 'DNAStringSet' consensusString(x, ambiguityMap=IUPAC_CODE_MAP, threshold=0.25, shift=0L, width=NULL) ## S4 method for signature 'RNAStringSet' consensusString(x, ambiguityMap= structure(as.character(RNAStringSet(DNAStringSet(IUPAC_CODE_MAP))), names= as.character(RNAStringSet(DNAStringSet(names(IUPAC_CODE_MAP))))), threshold=0.25, shift=0L, width=NULL)alphabetFrequency(x, as.prob=FALSE, ...) hasOnlyBaseLetters(x) uniqueLetters(x) letterFrequency(x, letters, OR="|", as.prob=FALSE, ...) letterFrequencyInSlidingView(x, view.width, letters, OR="|", as.prob=FALSE) consensusMatrix(x, as.prob=FALSE, shift=0L, width=NULL, ...) ## S4 method for signature 'matrix' consensusString(x, ambiguityMap="?", threshold=0.5) ## S4 method for signature 'DNAStringSet' consensusString(x, ambiguityMap=IUPAC_CODE_MAP, threshold=0.25, shift=0L, width=NULL) ## S4 method for signature 'RNAStringSet' consensusString(x, ambiguityMap= structure(as.character(RNAStringSet(DNAStringSet(IUPAC_CODE_MAP))), names= as.character(RNAStringSet(DNAStringSet(names(IUPAC_CODE_MAP))))), threshold=0.25, shift=0L, width=NULL)
x |
An XString, XStringSet, XStringViews
or MaskedXString object for DNA or RNA input for An XString object for A character vector, or an XStringSet or XStringViews
object for A consensus matrix (as returned by |
as.prob |
If |
view.width |
For |
letters |
For |
OR |
For |
ambiguityMap |
Either a single character to use when agreement is not reached or
a named character vector where the names are the ambiguity characters
and the values are the combinations of letters that comprise the
ambiguity (e.g. |
threshold |
The minimum probability threshold for an agreement to be declared.
When |
... |
Further arguments to be passed to or from other methods. For the XStringViews and XStringSet methods,
the Except for |
shift |
An integer vector (recycled to the length of |
width |
The number of columns of the returned matrix for the The length of the returned sequence for the |
alphabetFrequency, letterFrequency, and
letterFrequencyInSlidingView are
generic functions defined in the Biostrings package.
letterFrequency is similar to alphabetFrequency but
specific to the letters of interest, hence more compact, especially
with OR non-zero.
letterFrequencyInSlidingView yields the same result, on the
sequence x, that letterFrequency would, if applied to the
hypothetical (and possibly huge) XStringViews object
consisting of all the intervals of length view.width on x.
Taking advantage of the knowledge that successive "views" are nearly
identical, for letter counting purposes, it is both lighter and faster.
For letterFrequencyInSlidingView, a masked (MaskedXString)
object x is only supported through a cast to an (ordinary)
XString such as unmasked (which includes its masked
regions).
When consensusString is executed with a named character
ambiguityMap argument, it weights each input string equally and
assigns an equal probability to each of the base letters represented by
an ambiguity letter. So for DNA and a threshold of 0.25,
a "G" and an "R" would result in an "R" since
1/2 "G" + 1/2 "R" = 3/4 "G" + 1/4 "A" => "R";
two "G"'s and one "R" would result in a "G" since
2/3 "G" + 1/3 "R" = 5/6 "G" + 1/6 "A" => "G"; and
one "A" and one "N" would result in an "N" since
1/2 "A" + 1/2 "N" = 5/8 "A" + 1/8 "C" + 1/8 "G" + 1/8 "T" => "N".
alphabetFrequency returns an integer vector when x is an
XString or MaskedXString object. When x is an
XStringSet or XStringViews object, then it returns
an integer matrix with length(x) rows where the
i-th row contains the frequencies for x[[i]].
If x is a DNA, RNA, or AA input, then the returned vector is named
with the letters in the alphabet. If the baseOnly argument is
TRUE, then the returned vector has only 5 elements for DNA/RNA input
(4 elements corresponding to the 4 nucleotides + the 'other' element) and
21 elements for AA input (20 elements corresponding to the 20 base amino acids
+ the 'other' element).
letterFrequency returns, similarly, an integer vector or matrix,
but restricted and/or collated according to letters and OR.
letterFrequencyInSlidingView returns, for an XString
object x of length (nchar) L, an integer matrix
with L-view.width+1 rows, the i-th of which holding the
letter frequencies of substring(x, i, i+view.width-1).
hasOnlyBaseLetters returns TRUE or FALSE indicating
whether or not x contains only base letters (i.e. As, Cs, Gs and Ts
for DNA input, As, Cs, Gs and Us for RNA input, or any of the 20 standard
amino acids for AA input).
uniqueLetters returns a vector of 1-letter or empty strings. The empty
string is used to represent the nul character if x happens to contain
any. Note that this can only happen if the base class of x
is BString.
An integer matrix with letters as row names for consensusMatrix.
A standard character string for consensusString.
H. Pagès and P. Aboyoun; H. Jaffee for letterFrequency and letterFrequencyInSlidingView
alphabet,
coverage,
oligonucleotideFrequency,
countPDict,
XString-class,
XStringSet-class,
XStringViews-class,
MaskedXString-class,
strsplit
## --------------------------------------------------------------------- ## alphabetFrequency() ## --------------------------------------------------------------------- data(yeastSEQCHR1) yeast1 <- DNAString(yeastSEQCHR1) alphabetFrequency(yeast1) alphabetFrequency(yeast1, baseOnly=TRUE) hasOnlyBaseLetters(yeast1) uniqueLetters(yeast1) ## With input made of multiple sequences: library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) alphabetFrequency(probes[1:50], baseOnly=TRUE) alphabetFrequency(probes, baseOnly=TRUE, collapse=TRUE) ## --------------------------------------------------------------------- ## letterFrequency() ## --------------------------------------------------------------------- letterFrequency(probes[[1]], letters="ACGT", OR=0) base_letters <- alphabet(probes, baseOnly=TRUE) base_letters letterFrequency(probes[[1]], letters=base_letters, OR=0) base_letter_freqs <- letterFrequency(probes, letters=base_letters, OR=0) head(base_letter_freqs) GC_content <- letterFrequency(probes, letters="CG") head(GC_content) letterFrequency(probes, letters="CG", collapse=TRUE) ## --------------------------------------------------------------------- ## letterFrequencyInSlidingView() ## --------------------------------------------------------------------- data(yeastSEQCHR1) x <- DNAString(yeastSEQCHR1) view.width <- 48 letters <- c("A", "CG") two_columns <- letterFrequencyInSlidingView(x, view.width, letters) head(two_columns) tail(two_columns) three_columns <- letterFrequencyInSlidingView(x, view.width, letters, OR=0) head(three_columns) tail(three_columns) stopifnot(identical(two_columns[ , "C|G"], three_columns[ , "C"] + three_columns[ , "G"])) ## Note that, alternatively, 'three_columns' can also be obtained by ## creating the views on 'x' (as a Views object) and by calling ## alphabetFrequency() on it. But, of course, that is be *much* less ## efficient (both, in terms of memory and speed) than using ## letterFrequencyInSlidingView(): v <- Views(x, start=seq_len(length(x) - view.width + 1), width=view.width) v three_columns2 <- alphabetFrequency(v, baseOnly=TRUE)[ , c("A", "C", "G")] stopifnot(identical(three_columns2, three_columns)) ## Set the width of the view to length(x) to get the global frequencies: letterFrequencyInSlidingView(x, letters="ACGTN", view.width=length(x), OR=0) ## --------------------------------------------------------------------- ## consensus*() ## --------------------------------------------------------------------- ## Read in ORF data: file <- system.file("extdata", "someORF.fa", package="Biostrings") orf <- readDNAStringSet(file) ## To illustrate, the following example assumes the ORF data ## to be aligned for the first 10 positions (patently false): orf10 <- DNAStringSet(orf, end=10) consensusMatrix(orf10, baseOnly=TRUE) ## The following example assumes the first 10 positions to be aligned ## after some incremental shifting to the right (patently false): consensusMatrix(orf10, baseOnly=TRUE, shift=0:6) consensusMatrix(orf10, baseOnly=TRUE, shift=0:6, width=10) ## For the character matrix containing the "exploded" representation ## of the strings, do: as.matrix(orf10, use.names=FALSE) ## consensusMatrix() can be used to just compute the alphabet frequency ## for each position in the input sequences: consensusMatrix(probes, baseOnly=TRUE) ## After sorting, the first 5 probes might look similar (at least on ## their first bases): consensusString(sort(probes)[1:5]) consensusString(sort(probes)[1:5], ambiguityMap = "N", threshold = 0.5) ## Consensus involving ambiguity letters in the input strings consensusString(DNAStringSet(c("NNNN","ACTG"))) consensusString(DNAStringSet(c("AANN","ACTG"))) consensusString(DNAStringSet(c("ACAG","ACAR"))) consensusString(DNAStringSet(c("ACAG","ACAR", "ACAG"))) ## --------------------------------------------------------------------- ## C. RELATIONSHIP BETWEEN consensusMatrix() AND coverage() ## --------------------------------------------------------------------- ## Applying colSums() on a consensus matrix gives the coverage that ## would be obtained by piling up (after shifting) the input sequences ## on top of an (imaginary) reference sequence: cm <- consensusMatrix(orf10, shift=0:6, width=10) colSums(cm) ## Note that this coverage can also be obtained with: as.integer(coverage(IRanges(rep(1, length(orf)), width(orf)), shift=0:6, width=10))## --------------------------------------------------------------------- ## alphabetFrequency() ## --------------------------------------------------------------------- data(yeastSEQCHR1) yeast1 <- DNAString(yeastSEQCHR1) alphabetFrequency(yeast1) alphabetFrequency(yeast1, baseOnly=TRUE) hasOnlyBaseLetters(yeast1) uniqueLetters(yeast1) ## With input made of multiple sequences: library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) alphabetFrequency(probes[1:50], baseOnly=TRUE) alphabetFrequency(probes, baseOnly=TRUE, collapse=TRUE) ## --------------------------------------------------------------------- ## letterFrequency() ## --------------------------------------------------------------------- letterFrequency(probes[[1]], letters="ACGT", OR=0) base_letters <- alphabet(probes, baseOnly=TRUE) base_letters letterFrequency(probes[[1]], letters=base_letters, OR=0) base_letter_freqs <- letterFrequency(probes, letters=base_letters, OR=0) head(base_letter_freqs) GC_content <- letterFrequency(probes, letters="CG") head(GC_content) letterFrequency(probes, letters="CG", collapse=TRUE) ## --------------------------------------------------------------------- ## letterFrequencyInSlidingView() ## --------------------------------------------------------------------- data(yeastSEQCHR1) x <- DNAString(yeastSEQCHR1) view.width <- 48 letters <- c("A", "CG") two_columns <- letterFrequencyInSlidingView(x, view.width, letters) head(two_columns) tail(two_columns) three_columns <- letterFrequencyInSlidingView(x, view.width, letters, OR=0) head(three_columns) tail(three_columns) stopifnot(identical(two_columns[ , "C|G"], three_columns[ , "C"] + three_columns[ , "G"])) ## Note that, alternatively, 'three_columns' can also be obtained by ## creating the views on 'x' (as a Views object) and by calling ## alphabetFrequency() on it. But, of course, that is be *much* less ## efficient (both, in terms of memory and speed) than using ## letterFrequencyInSlidingView(): v <- Views(x, start=seq_len(length(x) - view.width + 1), width=view.width) v three_columns2 <- alphabetFrequency(v, baseOnly=TRUE)[ , c("A", "C", "G")] stopifnot(identical(three_columns2, three_columns)) ## Set the width of the view to length(x) to get the global frequencies: letterFrequencyInSlidingView(x, letters="ACGTN", view.width=length(x), OR=0) ## --------------------------------------------------------------------- ## consensus*() ## --------------------------------------------------------------------- ## Read in ORF data: file <- system.file("extdata", "someORF.fa", package="Biostrings") orf <- readDNAStringSet(file) ## To illustrate, the following example assumes the ORF data ## to be aligned for the first 10 positions (patently false): orf10 <- DNAStringSet(orf, end=10) consensusMatrix(orf10, baseOnly=TRUE) ## The following example assumes the first 10 positions to be aligned ## after some incremental shifting to the right (patently false): consensusMatrix(orf10, baseOnly=TRUE, shift=0:6) consensusMatrix(orf10, baseOnly=TRUE, shift=0:6, width=10) ## For the character matrix containing the "exploded" representation ## of the strings, do: as.matrix(orf10, use.names=FALSE) ## consensusMatrix() can be used to just compute the alphabet frequency ## for each position in the input sequences: consensusMatrix(probes, baseOnly=TRUE) ## After sorting, the first 5 probes might look similar (at least on ## their first bases): consensusString(sort(probes)[1:5]) consensusString(sort(probes)[1:5], ambiguityMap = "N", threshold = 0.5) ## Consensus involving ambiguity letters in the input strings consensusString(DNAStringSet(c("NNNN","ACTG"))) consensusString(DNAStringSet(c("AANN","ACTG"))) consensusString(DNAStringSet(c("ACAG","ACAR"))) consensusString(DNAStringSet(c("ACAG","ACAR", "ACAG"))) ## --------------------------------------------------------------------- ## C. RELATIONSHIP BETWEEN consensusMatrix() AND coverage() ## --------------------------------------------------------------------- ## Applying colSums() on a consensus matrix gives the coverage that ## would be obtained by piling up (after shifting) the input sequences ## on top of an (imaginary) reference sequence: cm <- consensusMatrix(orf10, shift=0:6, width=10) colSums(cm) ## Note that this coverage can also be obtained with: as.integer(coverage(IRanges(rep(1, length(orf)), width(orf)), shift=0:6, width=10))
This function accepts a character vector and computes the length of the
longest substring containing only letter for each element of x.
longestConsecutive(seq, letter)longestConsecutive(seq, letter)
seq |
Character vector. |
letter |
Character vector of length 1, containing one single character. |
The elements of x can be in upper case, lower case
or mixed. NAs are handled.
An integer vector of the same length as x.
W. Huber
v <- c("AAACTGTGFG", "GGGAATT", "CCAAAAAAAAAATT") longestConsecutive(v, "A")v <- c("AAACTGTGFG", "GGGAATT", "CCAAAAAAAAAATT") longestConsecutive(v, "A")
In this man page we define precisely and illustrate what a "match" of a pattern P in a subject S is in the context of the Biostrings package. This definition of a "match" is central to most pattern matching functions available in this package: unless specified otherwise, most of them will adhere to the definition provided here.
hasLetterAt checks whether a sequence or set of sequences has the
specified letters at the specified positions.
neditAt, isMatchingAt and which.isMatchingAt are
low-level matching functions that only look for matches at the specified
positions in the subject.
hasLetterAt(x, letter, at, fixed=TRUE) ## neditAt() and related utils: neditAt(pattern, subject, at=1, with.indels=FALSE, fixed=TRUE) neditStartingAt(pattern, subject, starting.at=1, with.indels=FALSE, fixed=TRUE) neditEndingAt(pattern, subject, ending.at=1, with.indels=FALSE, fixed=TRUE) ## isMatchingAt() and related utils: isMatchingAt(pattern, subject, at=1, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE) isMatchingStartingAt(pattern, subject, starting.at=1, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE) isMatchingEndingAt(pattern, subject, ending.at=1, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE) ## which.isMatchingAt() and related utils: which.isMatchingAt(pattern, subject, at=1, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, follow.index=FALSE, auto.reduce.pattern=FALSE) which.isMatchingStartingAt(pattern, subject, starting.at=1, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, follow.index=FALSE, auto.reduce.pattern=FALSE) which.isMatchingEndingAt(pattern, subject, ending.at=1, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, follow.index=FALSE, auto.reduce.pattern=FALSE)hasLetterAt(x, letter, at, fixed=TRUE) ## neditAt() and related utils: neditAt(pattern, subject, at=1, with.indels=FALSE, fixed=TRUE) neditStartingAt(pattern, subject, starting.at=1, with.indels=FALSE, fixed=TRUE) neditEndingAt(pattern, subject, ending.at=1, with.indels=FALSE, fixed=TRUE) ## isMatchingAt() and related utils: isMatchingAt(pattern, subject, at=1, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE) isMatchingStartingAt(pattern, subject, starting.at=1, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE) isMatchingEndingAt(pattern, subject, ending.at=1, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE) ## which.isMatchingAt() and related utils: which.isMatchingAt(pattern, subject, at=1, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, follow.index=FALSE, auto.reduce.pattern=FALSE) which.isMatchingStartingAt(pattern, subject, starting.at=1, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, follow.index=FALSE, auto.reduce.pattern=FALSE) which.isMatchingEndingAt(pattern, subject, ending.at=1, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, follow.index=FALSE, auto.reduce.pattern=FALSE)
x |
A character vector, or an XString or XStringSet object. |
letter |
A character string or an XString object containing the letters to check. |
at, starting.at, ending.at
|
An integer vector specifying the starting (for For the |
pattern |
The pattern string (but see |
subject |
A character vector, or an XString or XStringSet object containing the subject sequence(s). |
max.mismatch, min.mismatch
|
Integer vectors of length >= 1 recycled to the length of the
|
with.indels |
See details below. |
fixed |
Only with a DNAString or RNAString-based subject can a
If
|
follow.index |
Whether the single integer returned by |
auto.reduce.pattern |
Whether |
A "match" of pattern P in subject S is a substring S' of S that is considered similar enough to P according to some distance (or metric) specified by the user. 2 distances are supported by most pattern matching functions in the Biostrings package. The first (and simplest) one is the "number of mismatching letters". It is defined only when the 2 strings to compare have the same length, so when this distance is used, only matches that have the same number of letters as P are considered. The second one is the "edit distance" (aka Levenshtein distance): it's the minimum number of operations needed to transform P into S', where an operation is an insertion, deletion, or substitution of a single letter. When this metric is used, matches can have a different number of letters than P.
The neditAt function implements these 2 distances.
If with.indels is FALSE (the default), then the first distance
is used i.e. neditAt returns the "number of mismatching letters"
between the pattern P and the substring S' of S starting at the
positions specified in at (note that neditAt is vectorized
so a long vector of integers can be passed thru the at argument).
If with.indels is TRUE, then the "edit distance" is
used: for each position specified in at, P is compared to
all the substrings S' of S starting at this position and the smallest
distance is returned. Note that this distance is guaranteed to be reached
for a substring of length < 2*length(P) so, of course, in practice,
P only needs to be compared to a small number of substrings for every
starting position.
hasLetterAt: A logical matrix with one row per element in x
and one column per letter/position to check. When a specified position
is invalid with respect to an element in x then the corresponding
matrix element is set to NA.
neditAt: If subject is an XString object, then
return an integer vector of the same length as at.
If subject is an XStringSet object, then return the
integer matrix with length(at) rows and length(subject)
columns defined by:
sapply(unname(subject),
function(x) neditAt(pattern, x, ...))
neditStartingAt is identical to neditAt except
that the at argument is now called starting.at.
neditEndingAt is similar to neditAt except that
the at argument is now called ending.at and must contain
the ending positions of the pattern relatively to the subject.
isMatchingAt: If subject is an XString object,
then return the logical vector defined by:
min.mismatch <= neditAt(...) <= max.mismatch
If subject is an XStringSet object, then return the
logical matrix with length(at) rows and length(subject)
columns defined by:
sapply(unname(subject),
function(x) isMatchingAt(pattern, x, ...))
isMatchingStartingAt is identical to isMatchingAt except
that the at argument is now called starting.at.
isMatchingEndingAt is similar to isMatchingAt except that
the at argument is now called ending.at and must contain
the ending positions of the pattern relatively to the subject.
which.isMatchingAt: The default behavior (follow.index=FALSE)
is as follow. If subject is an XString object,
then return the single integer defined by:
which(isMatchingAt(...))[1]
If subject is an XStringSet object, then return
the integer vector defined by:
sapply(unname(subject),
function(x) which.isMatchingAt(pattern, x, ...))
If follow.index=TRUE, then the returned value is defined by:
at[which.isMatchingAt(..., follow.index=FALSE)]
which.isMatchingStartingAt is identical to which.isMatchingAt
except that the at argument is now called starting.at.
which.isMatchingEndingAt is similar to which.isMatchingAt
except that the at argument is now called ending.at and must
contain the ending positions of the pattern relatively to the subject.
nucleotideFrequencyAt,
matchPattern,
matchPDict,
matchLRPatterns,
trimLRPatterns,
IUPAC_CODE_MAP,
XString-class,
align-utils in the pwalign package
## --------------------------------------------------------------------- ## hasLetterAt() ## --------------------------------------------------------------------- x <- DNAStringSet(c("AAACGT", "AACGT", "ACGT", "TAGGA")) hasLetterAt(x, "AAAAAA", 1:6) ## hasLetterAt() can be used to answer questions like: "which elements ## in 'x' have an A at position 2 and a G at position 4?" q1 <- hasLetterAt(x, "AG", c(2, 4)) which(rowSums(q1) == 2) ## or "how many probes in the drosophila2 chip have T, G, T, A at ## position 2, 4, 13 and 20, respectively?" library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) q2 <- hasLetterAt(probes, "TGTA", c(2, 4, 13, 20)) sum(rowSums(q2) == 4) ## or "what's the probability to have an A at position 25 if there is ## one at position 13?" q3 <- hasLetterAt(probes, "AACGT", c(13, 25, 25, 25, 25)) sum(q3[ , 1] & q3[ , 2]) / sum(q3[ , 1]) ## Probabilities to have other bases at position 25 if there is an A ## at position 13: sum(q3[ , 1] & q3[ , 3]) / sum(q3[ , 1]) # C sum(q3[ , 1] & q3[ , 4]) / sum(q3[ , 1]) # G sum(q3[ , 1] & q3[ , 5]) / sum(q3[ , 1]) # T ## See ?nucleotideFrequencyAt for another way to get those results. ## --------------------------------------------------------------------- ## neditAt() / isMatchingAt() / which.isMatchingAt() ## --------------------------------------------------------------------- subject <- DNAString("GTATA") ## Pattern "AT" matches subject "GTATA" at position 3 (exact match) neditAt("AT", subject, at=3) isMatchingAt("AT", subject, at=3) ## ... but not at position 1 neditAt("AT", subject) isMatchingAt("AT", subject) ## ... unless we allow 1 mismatching letter (inexact match) isMatchingAt("AT", subject, max.mismatch=1) ## Here we look at 6 different starting positions and find 3 matches if ## we allow 1 mismatching letter isMatchingAt("AT", subject, at=0:5, max.mismatch=1) ## No match neditAt("NT", subject, at=1:4) isMatchingAt("NT", subject, at=1:4) ## 2 matches if N is interpreted as an ambiguity (fixed=FALSE) neditAt("NT", subject, at=1:4, fixed=FALSE) isMatchingAt("NT", subject, at=1:4, fixed=FALSE) ## max.mismatch != 0 and fixed=FALSE can be used together neditAt("NCA", subject, at=0:5, fixed=FALSE) isMatchingAt("NCA", subject, at=0:5, max.mismatch=1, fixed=FALSE) some_starts <- c(10:-10, NA, 6) subject <- DNAString("ACGTGCA") is_matching <- isMatchingAt("CAT", subject, at=some_starts, max.mismatch=1) some_starts[is_matching] which.isMatchingAt("CAT", subject, at=some_starts, max.mismatch=1) which.isMatchingAt("CAT", subject, at=some_starts, max.mismatch=1, follow.index=TRUE) ## --------------------------------------------------------------------- ## WITH INDELS ## --------------------------------------------------------------------- subject <- BString("ABCDEFxxxCDEFxxxABBCDE") neditAt("ABCDEF", subject, at=9) neditAt("ABCDEF", subject, at=9, with.indels=TRUE) isMatchingAt("ABCDEF", subject, at=9, max.mismatch=1, with.indels=TRUE) isMatchingAt("ABCDEF", subject, at=9, max.mismatch=2, with.indels=TRUE) neditAt("ABCDEF", subject, at=17) neditAt("ABCDEF", subject, at=17, with.indels=TRUE) neditEndingAt("ABCDEF", subject, ending.at=22) neditEndingAt("ABCDEF", subject, ending.at=22, with.indels=TRUE)## --------------------------------------------------------------------- ## hasLetterAt() ## --------------------------------------------------------------------- x <- DNAStringSet(c("AAACGT", "AACGT", "ACGT", "TAGGA")) hasLetterAt(x, "AAAAAA", 1:6) ## hasLetterAt() can be used to answer questions like: "which elements ## in 'x' have an A at position 2 and a G at position 4?" q1 <- hasLetterAt(x, "AG", c(2, 4)) which(rowSums(q1) == 2) ## or "how many probes in the drosophila2 chip have T, G, T, A at ## position 2, 4, 13 and 20, respectively?" library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) q2 <- hasLetterAt(probes, "TGTA", c(2, 4, 13, 20)) sum(rowSums(q2) == 4) ## or "what's the probability to have an A at position 25 if there is ## one at position 13?" q3 <- hasLetterAt(probes, "AACGT", c(13, 25, 25, 25, 25)) sum(q3[ , 1] & q3[ , 2]) / sum(q3[ , 1]) ## Probabilities to have other bases at position 25 if there is an A ## at position 13: sum(q3[ , 1] & q3[ , 3]) / sum(q3[ , 1]) # C sum(q3[ , 1] & q3[ , 4]) / sum(q3[ , 1]) # G sum(q3[ , 1] & q3[ , 5]) / sum(q3[ , 1]) # T ## See ?nucleotideFrequencyAt for another way to get those results. ## --------------------------------------------------------------------- ## neditAt() / isMatchingAt() / which.isMatchingAt() ## --------------------------------------------------------------------- subject <- DNAString("GTATA") ## Pattern "AT" matches subject "GTATA" at position 3 (exact match) neditAt("AT", subject, at=3) isMatchingAt("AT", subject, at=3) ## ... but not at position 1 neditAt("AT", subject) isMatchingAt("AT", subject) ## ... unless we allow 1 mismatching letter (inexact match) isMatchingAt("AT", subject, max.mismatch=1) ## Here we look at 6 different starting positions and find 3 matches if ## we allow 1 mismatching letter isMatchingAt("AT", subject, at=0:5, max.mismatch=1) ## No match neditAt("NT", subject, at=1:4) isMatchingAt("NT", subject, at=1:4) ## 2 matches if N is interpreted as an ambiguity (fixed=FALSE) neditAt("NT", subject, at=1:4, fixed=FALSE) isMatchingAt("NT", subject, at=1:4, fixed=FALSE) ## max.mismatch != 0 and fixed=FALSE can be used together neditAt("NCA", subject, at=0:5, fixed=FALSE) isMatchingAt("NCA", subject, at=0:5, max.mismatch=1, fixed=FALSE) some_starts <- c(10:-10, NA, 6) subject <- DNAString("ACGTGCA") is_matching <- isMatchingAt("CAT", subject, at=some_starts, max.mismatch=1) some_starts[is_matching] which.isMatchingAt("CAT", subject, at=some_starts, max.mismatch=1) which.isMatchingAt("CAT", subject, at=some_starts, max.mismatch=1, follow.index=TRUE) ## --------------------------------------------------------------------- ## WITH INDELS ## --------------------------------------------------------------------- subject <- BString("ABCDEFxxxCDEFxxxABBCDE") neditAt("ABCDEF", subject, at=9) neditAt("ABCDEF", subject, at=9, with.indels=TRUE) isMatchingAt("ABCDEF", subject, at=9, max.mismatch=1, with.indels=TRUE) isMatchingAt("ABCDEF", subject, at=9, max.mismatch=2, with.indels=TRUE) neditAt("ABCDEF", subject, at=17) neditAt("ABCDEF", subject, at=17, with.indels=TRUE) neditEndingAt("ABCDEF", subject, ending.at=22) neditEndingAt("ABCDEF", subject, ending.at=22, with.indels=TRUE)
The MaskedBString, MaskedDNAString, MaskedRNAString and MaskedAAString classes are containers for storing masked sequences.
All those containers derive directly (and with no additional slots) from the MaskedXString virtual class.
In Biostrings, a pile of masks can be put on top of a sequence. A pile of masks is represented by a MaskCollection object and the sequence by an XString object. A MaskedXString object is the result of bundling them together in a single object.
Note that, no matter what masks are put on top of it, the original sequence is always stored unmodified in a MaskedXString object. This allows the user to activate/deactivate masks without having to worry about losing the information stored in the masked/unmasked regions. Also this allows efficient memory management since the original sequence never needs to be copied (modifying it would require to make a copy of it first - sequences cannot and should never be modified in place in Biostrings), even when the set of active/inactive masks changes.
In the code snippets below, x is a MaskedXString object.
For masks(x) and masks(x) <- y, it can also be
an XString object and y must be NULL or
a MaskCollection object.
unmasked(x):Turns x into an XString object by dropping the masks.
masks(x):Turns x into a
MaskCollection object by
dropping the sequence.
masks(x) <- y:If x is an XString object and y is NULL,
then this doesn't do anything.
If x is an XString object and y is a
MaskCollection object, then
this turns x into a MaskedXString object by putting the
masks in y on top of it.
If x is a MaskedXString object and y is NULL,
then this is equivalent to x <- unmasked(x).
If x is a MaskedXString object and y is a
MaskCollection object, then
this replaces the masks currently on top of x by the masks
in y.
alphabet(x):Equivalent to alphabet(unmasked(x)).
See ?alphabet for more information.
length(x):Equivalent to length(unmasked(x)).
See
?`length,XString-method`
for more information.
In the code snippets below, x is a MaskedXString object.
maskedwidth(x):Get the number of masked letters in x. A letter is considered
masked iff it's masked by at least one active mask.
maskedratio(x):Equivalent to maskedwidth(x) / length(x).
nchar(x):Equivalent to length(x) - maskedwidth(x).
In the code snippets below, x is a MaskedXString object.
as(x, "Views"):Turns x into a Views object where the
views are the unmasked regions of the original sequence
("unmasked" means not masked by at least one active mask).
In the code snippets below, x is a MaskedXString object.
collapse(x):Collapses the set of masks in x into a single mask made of
all active masks.
gaps(x):Reverses all the masks i.e. each mask is replaced by a mask where previously unmasked regions are now masked and previously masked regions are now unmasked.
H. Pagès
## --------------------------------------------------------------------- ## A. MASKING BY POSITION ## --------------------------------------------------------------------- mask0 <- Mask(mask.width=29, start=c(3, 10, 25), width=c(6, 8, 5)) x <- DNAString("ACACAACTAGATAGNACTNNGAGAGACGC") length(x) # same as width(mask0) nchar(x) # same as length(x) masks(x) <- mask0 x length(x) # has not changed nchar(x) # has changed gaps(x) ## Prepare a MaskCollection object of 3 masks ('mymasks') by running the ## examples in the man page for these objects: example(MaskCollection, package="IRanges") ## Put it on 'x': masks(x) <- mymasks x alphabetFrequency(x) ## Deactivate all masks: active(masks(x)) <- FALSE x ## Activate mask "C": active(masks(x))["C"] <- TRUE x ## Turn MaskedXString object into a Views object: as(x, "Views") ## Drop the masks: masks(x) <- NULL x alphabetFrequency(x) ## --------------------------------------------------------------------- ## B. MASKING BY CONTENT ## --------------------------------------------------------------------- ## See ?maskMotif for masking by content## --------------------------------------------------------------------- ## A. MASKING BY POSITION ## --------------------------------------------------------------------- mask0 <- Mask(mask.width=29, start=c(3, 10, 25), width=c(6, 8, 5)) x <- DNAString("ACACAACTAGATAGNACTNNGAGAGACGC") length(x) # same as width(mask0) nchar(x) # same as length(x) masks(x) <- mask0 x length(x) # has not changed nchar(x) # has changed gaps(x) ## Prepare a MaskCollection object of 3 masks ('mymasks') by running the ## examples in the man page for these objects: example(MaskCollection, package="IRanges") ## Put it on 'x': masks(x) <- mymasks x alphabetFrequency(x) ## Deactivate all masks: active(masks(x)) <- FALSE x ## Activate mask "C": active(masks(x))["C"] <- TRUE x ## Turn MaskedXString object into a Views object: as(x, "Views") ## Drop the masks: masks(x) <- NULL x alphabetFrequency(x) ## --------------------------------------------------------------------- ## B. MASKING BY CONTENT ## --------------------------------------------------------------------- ## See ?maskMotif for masking by content
Functions for masking a sequence by content (or by position).
maskMotif(x, motif, min.block.width=1, ...) mask(x, start=NA, end=NA, pattern)maskMotif(x, motif, min.block.width=1, ...) mask(x, start=NA, end=NA, pattern)
x |
The sequence to mask. |
motif |
The motif to mask in the sequence. |
min.block.width |
The minimum width of the blocks to mask. |
... |
Additional arguments for |
start |
An integer vector containing the starting positions of the regions to mask. |
end |
An integer vector containing the ending positions of the regions to mask. |
pattern |
The motif to mask in the sequence. |
A MaskedXString object for maskMotif
and an XStringViews object for mask.
H. Pagès
read.Mask,
matchPattern,
XString-class,
MaskedXString-class,
XStringViews-class,
MaskCollection-class
## --------------------------------------------------------------------- ## EXAMPLE 1 ## --------------------------------------------------------------------- maskMotif(BString("AbcbbcbEEE"), "bcb") maskMotif(BString("AbcbcbEEE"), "bcb") ## maskMotif() can be used in an incremental way to mask more than 1 ## motif. Note that maskMotif() does not try to mask again what's ## already masked (i.e. the new mask will never overlaps with the ## previous masks) so the order in which the motifs are masked actually ## matters as it will affect the total set of masked positions. x0 <- BString("AbcbEEEEEbcbbEEEcbbcbc") x1 <- maskMotif(x0, "E") x1 x2 <- maskMotif(x1, "bcb") x2 x3 <- maskMotif(x2, "b") x3 ## Note that inverting the order in which "b" and "bcb" are masked would ## lead to a different final set of masked positions. ## Also note that the order doesn't matter if the motifs to mask don't ## overlap (we assume that the motifs are unique) i.e. if the prefix of ## each motif is not the suffix of any other motif. This is of course ## the case when all the motifs have only 1 letter. ## --------------------------------------------------------------------- ## EXAMPLE 2 ## --------------------------------------------------------------------- x <- DNAString("ACACAACTAGATAGNACTNNGAGAGACGC") ## Mask the N-blocks x1 <- maskMotif(x, "N") x1 as(x1, "Views") gaps(x1) as(gaps(x1), "Views") ## Mask the AC-blocks x2 <- maskMotif(x1, "AC") x2 gaps(x2) ## Mask the GA-blocks x3 <- maskMotif(x2, "GA", min.block.width=5) x3 # masks 2 and 3 overlap gaps(x3) ## --------------------------------------------------------------------- ## EXAMPLE 3 ## --------------------------------------------------------------------- library(BSgenome.Dmelanogaster.UCSC.dm3) chrU <- Dmelanogaster$chrU chrU alphabetFrequency(chrU) chrU <- maskMotif(chrU, "N") chrU alphabetFrequency(chrU) as(chrU, "Views") as(gaps(chrU), "Views") mask2 <- Mask(mask.width=length(chrU), start=c(50000, 350000, 543900), width=25000) names(mask2) <- "some ugly regions" masks(chrU) <- append(masks(chrU), mask2) chrU as(chrU, "Views") as(gaps(chrU), "Views") ## --------------------------------------------------------------------- ## EXAMPLE 4 ## --------------------------------------------------------------------- ## Note that unlike maskMotif(), mask() returns an XStringViews object! ## masking "by position" mask("AxyxyxBC", 2, 6) ## masking "by content" mask("AxyxyxBC", "xyx") noN_chrU <- mask(chrU, "N") noN_chrU alphabetFrequency(noN_chrU, collapse=TRUE)## --------------------------------------------------------------------- ## EXAMPLE 1 ## --------------------------------------------------------------------- maskMotif(BString("AbcbbcbEEE"), "bcb") maskMotif(BString("AbcbcbEEE"), "bcb") ## maskMotif() can be used in an incremental way to mask more than 1 ## motif. Note that maskMotif() does not try to mask again what's ## already masked (i.e. the new mask will never overlaps with the ## previous masks) so the order in which the motifs are masked actually ## matters as it will affect the total set of masked positions. x0 <- BString("AbcbEEEEEbcbbEEEcbbcbc") x1 <- maskMotif(x0, "E") x1 x2 <- maskMotif(x1, "bcb") x2 x3 <- maskMotif(x2, "b") x3 ## Note that inverting the order in which "b" and "bcb" are masked would ## lead to a different final set of masked positions. ## Also note that the order doesn't matter if the motifs to mask don't ## overlap (we assume that the motifs are unique) i.e. if the prefix of ## each motif is not the suffix of any other motif. This is of course ## the case when all the motifs have only 1 letter. ## --------------------------------------------------------------------- ## EXAMPLE 2 ## --------------------------------------------------------------------- x <- DNAString("ACACAACTAGATAGNACTNNGAGAGACGC") ## Mask the N-blocks x1 <- maskMotif(x, "N") x1 as(x1, "Views") gaps(x1) as(gaps(x1), "Views") ## Mask the AC-blocks x2 <- maskMotif(x1, "AC") x2 gaps(x2) ## Mask the GA-blocks x3 <- maskMotif(x2, "GA", min.block.width=5) x3 # masks 2 and 3 overlap gaps(x3) ## --------------------------------------------------------------------- ## EXAMPLE 3 ## --------------------------------------------------------------------- library(BSgenome.Dmelanogaster.UCSC.dm3) chrU <- Dmelanogaster$chrU chrU alphabetFrequency(chrU) chrU <- maskMotif(chrU, "N") chrU alphabetFrequency(chrU) as(chrU, "Views") as(gaps(chrU), "Views") mask2 <- Mask(mask.width=length(chrU), start=c(50000, 350000, 543900), width=25000) names(mask2) <- "some ugly regions" masks(chrU) <- append(masks(chrU), mask2) chrU as(chrU, "Views") as(gaps(chrU), "Views") ## --------------------------------------------------------------------- ## EXAMPLE 4 ## --------------------------------------------------------------------- ## Note that unlike maskMotif(), mask() returns an XStringViews object! ## masking "by position" mask("AxyxyxBC", 2, 6) ## masking "by content" mask("AxyxyxBC", "xyx") noN_chrU <- mask(chrU, "N") noN_chrU alphabetFrequency(noN_chrU, collapse=TRUE)
Miscellaneous utility functions operating on the matches returned by a
high-level matching function like matchPattern,
matchPDict, etc...
mismatch(pattern, x, fixed=TRUE) nmatch(pattern, x, fixed=TRUE) nmismatch(pattern, x, fixed=TRUE) ## S4 method for signature 'MIndex' coverage(x, shift=0L, width=NULL, weight=1L) ## S4 method for signature 'MaskedXString' coverage(x, shift=0L, width=NULL, weight=1L)mismatch(pattern, x, fixed=TRUE) nmatch(pattern, x, fixed=TRUE) nmismatch(pattern, x, fixed=TRUE) ## S4 method for signature 'MIndex' coverage(x, shift=0L, width=NULL, weight=1L) ## S4 method for signature 'MaskedXString' coverage(x, shift=0L, width=NULL, weight=1L)
pattern |
The pattern string. |
x |
An XStringViews object for An MIndex object for |
fixed |
See |
shift, width
|
See |
weight |
An integer vector specifying how much each element in |
The mismatch function gives the positions of the mismatching
letters of a given pattern relatively to its matches in a given subject.
The nmatch and nmismatch functions give the number of
matching and mismatching letters produced by the mismatch function.
The coverage function computes the "coverage" of a subject
by a given pattern or set of patterns.
mismatch: a list of integer vectors.
nmismatch: an integer vector containing the length of the vectors
produced by mismatch.
coverage: an Rle object indicating
the coverage of x.
See ?coverage for the details.
If x is an MIndex object, the coverage of a given position
in the underlying sequence (typically the subject used during the search
that returned x) is the number of matches (or hits) it belongs to.
lowlevel-matching,
matchPattern,
matchPDict,
XString-class,
XStringViews-class,
MIndex-class,
coverage,
align-utils in the pwalign package
## --------------------------------------------------------------------- ## mismatch() / nmismatch() ## --------------------------------------------------------------------- subject <- DNAString("ACGTGCA") m <- matchPattern("NCA", subject, max.mismatch=1, fixed=FALSE) mismatch("NCA", m) nmismatch("NCA", m) ## --------------------------------------------------------------------- ## coverage() ## --------------------------------------------------------------------- coverage(m) ## See ?matchPDict for examples of using coverage() on an MIndex object...## --------------------------------------------------------------------- ## mismatch() / nmismatch() ## --------------------------------------------------------------------- subject <- DNAString("ACGTGCA") m <- matchPattern("NCA", subject, max.mismatch=1, fixed=FALSE) mismatch("NCA", m) nmismatch("NCA", m) ## --------------------------------------------------------------------- ## coverage() ## --------------------------------------------------------------------- coverage(m) ## See ?matchPDict for examples of using coverage() on an MIndex object...
The matchLRPatterns function finds paired matches in a sequence
i.e. matches specified by a left pattern, a right pattern and a maximum
distance between the left pattern and the right pattern.
matchLRPatterns(Lpattern, Rpattern, max.gaplength, subject, max.Lmismatch=0, max.Rmismatch=0, with.Lindels=FALSE, with.Rindels=FALSE, Lfixed=TRUE, Rfixed=TRUE)matchLRPatterns(Lpattern, Rpattern, max.gaplength, subject, max.Lmismatch=0, max.Rmismatch=0, with.Lindels=FALSE, with.Rindels=FALSE, Lfixed=TRUE, Rfixed=TRUE)
Lpattern |
The left part of the pattern. |
Rpattern |
The right part of the pattern. |
max.gaplength |
The max length of the gap in the middle i.e the max distance between the left and right parts of the pattern. |
subject |
An XString, XStringViews or MaskedXString object containing the target sequence. |
max.Lmismatch |
The maximum number of mismatching letters allowed in the left part of the
pattern.
If non-zero, an inexact matching algorithm is used (see the
|
max.Rmismatch |
Same as |
with.Lindels |
If See the |
with.Rindels |
Same as |
Lfixed |
Only with a DNAString or RNAString subject can a
With
|
Rfixed |
Same as |
An XStringViews object containing all the matches, even when they are overlapping (see the examples below), and where the matches are ordered from left to right (i.e. by ascending starting position).
H. Pagès
matchPattern,
matchProbePair,
trimLRPatterns,
findPalindromes,
reverseComplement,
XString-class,
XStringViews-class,
MaskedXString-class
library(BSgenome.Dmelanogaster.UCSC.dm3) subject <- Dmelanogaster$chr3R Lpattern <- "AGCTCCGAG" Rpattern <- "TTGTTCACA" matchLRPatterns(Lpattern, Rpattern, 500, subject) # 1 match ## Note that matchLRPatterns() will return all matches, even when they are ## overlapping: subject <- DNAString("AAATTAACCCTT") matchLRPatterns("AA", "TT", 0, subject) # 1 match matchLRPatterns("AA", "TT", 1, subject) # 2 matches matchLRPatterns("AA", "TT", 3, subject) # 3 matches matchLRPatterns("AA", "TT", 7, subject) # 4 matcheslibrary(BSgenome.Dmelanogaster.UCSC.dm3) subject <- Dmelanogaster$chr3R Lpattern <- "AGCTCCGAG" Rpattern <- "TTGTTCACA" matchLRPatterns(Lpattern, Rpattern, 500, subject) # 1 match ## Note that matchLRPatterns() will return all matches, even when they are ## overlapping: subject <- DNAString("AAATTAACCCTT") matchLRPatterns("AA", "TT", 0, subject) # 1 match matchLRPatterns("AA", "TT", 1, subject) # 2 matches matchLRPatterns("AA", "TT", 3, subject) # 3 matches matchLRPatterns("AA", "TT", 7, subject) # 4 matches
A set of functions for finding all the occurrences (aka "matches" or "hits") of a given pattern (typically short) in a (typically long) reference sequence or set of reference sequences (aka the subject)
matchPattern(pattern, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto") countPattern(pattern, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto") vmatchPattern(pattern, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto", ...) vcountPattern(pattern, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto", ...)matchPattern(pattern, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto") countPattern(pattern, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto") vmatchPattern(pattern, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto", ...) vcountPattern(pattern, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto", ...)
pattern |
The pattern string. |
subject |
An XString, XStringViews or MaskedXString
object for An XStringSet or XStringViews object for
|
max.mismatch, min.mismatch
|
The maximum and minimum number of mismatching letters allowed (see
|
with.indels |
If
(a) nedit(P, S') <= max.mismatch
(b) for every substring S1 of S':
nedit(P, S1) > nedit(P, S')
(c) for every substring S2 of S that contains S':
nedit(P, S2) >= nedit(P, S')
One nice property of "best local matches" is that their first and last letters are guaranteed to match the letters in P that they align with. |
fixed |
If |
algorithm |
One of the following: |
... |
Additional arguments for methods. |
Available algorithms are: “naive exact”, “naive inexact”,
“Boyer-Moore-like”, “shift-or” and “indels”.
Not all of them can be used in all situations: restrictions
apply depending on the "search criteria" i.e. on the values of
the pattern, subject, max.mismatch,
min.mismatch, with.indels and fixed
arguments.
It is important to note that the algorithm argument
is not part of the search criteria. This is because the supported
algorithms are interchangeable, that is, if 2 different algorithms
are compatible with a given search criteria, then choosing one or
the other will not affect the result (but will most likely affect
the performance). So there is no "wrong choice" of algorithm (strictly
speaking).
Using algorithm="auto" (the default) is recommended because
then the best suited algorithm will automatically be selected among
the set of algorithms that are valid for the given search criteria.
An XStringViews object for matchPattern.
A single integer for countPattern.
An MIndex object for vmatchPattern.
An integer vector for vcountPattern, with each element in
the vector corresponding to the number of matches in the corresponding
element of subject.
Use matchPDict if you need to match a (big) set of patterns
against a reference sequence.
Use pairwiseAlignment from the pwalign
package if you need to solve a (Needleman-Wunsch) global alignment,
a (Smith-Waterman) local alignment, or an (ends-free) overlap alignment
problem.
pairwiseAlignment in the pwalign
package
XStringViews class
MIndex class
## --------------------------------------------------------------------- ## A. matchPattern()/countPattern() ## --------------------------------------------------------------------- ## A simple inexact matching example with a short subject: x <- DNAString("AAGCGCGATATG") m1 <- matchPattern("GCNNNAT", x) m1 m2 <- matchPattern("GCNNNAT", x, fixed=FALSE) m2 as.matrix(m2) ## With DNA sequence of yeast chromosome number 1: data(yeastSEQCHR1) yeast1 <- DNAString(yeastSEQCHR1) PpiI <- "GAACNNNNNCTC" # a restriction enzyme pattern match1.PpiI <- matchPattern(PpiI, yeast1, fixed=FALSE) match2.PpiI <- matchPattern(PpiI, yeast1, max.mismatch=1, fixed=FALSE) ## With a genome containing isolated Ns: library(BSgenome.Celegans.UCSC.ce2) chrII <- Celegans[["chrII"]] alphabetFrequency(chrII) matchPattern("N", chrII) matchPattern("TGGGTGTCTTT", chrII) # no match matchPattern("TGGGTGTCTTT", chrII, fixed=FALSE) # 1 match ## Using wildcards ("N") in the pattern on a genome containing N-blocks: library(BSgenome.Dmelanogaster.UCSC.dm3) chrX <- maskMotif(Dmelanogaster$chrX, "N") as(chrX, "Views") # 4 non masked regions matchPattern("TTTATGNTTGGTA", chrX, fixed=FALSE) ## Can also be achieved with no mask: masks(chrX) <- NULL matchPattern("TTTATGNTTGGTA", chrX, fixed="subject") ## --------------------------------------------------------------------- ## B. vmatchPattern()/vcountPattern() ## --------------------------------------------------------------------- ## Load Fly upstream sequences (i.e. the sequences 2000 bases upstream of ## annotated transcription starts): dm3_upstream_filepath <- system.file("extdata", "dm3_upstream2000.fa.gz", package="Biostrings") dm3_upstream <- readDNAStringSet(dm3_upstream_filepath) dm3_upstream Ebox <- DNAString("CANNTG") subject <- dm3_upstream mindex <- vmatchPattern(Ebox, subject, fixed="subject") nmatch_per_seq <- elementNROWS(mindex) # Get the number of matches per # subject element. sum(nmatch_per_seq) # Total number of matches. table(nmatch_per_seq) ## Let's have a closer look at one of the upstream sequences with most ## matches: i0 <- which.max(nmatch_per_seq) subject0 <- subject[[i0]] ir0 <- mindex[[i0]] # matches in 'subject0' as an IRanges object ir0 Views(subject0, ir0) # matches in 'subject0' as a Views object ## --------------------------------------------------------------------- ## C. WITH INDELS ## --------------------------------------------------------------------- library(BSgenome.Celegans.UCSC.ce2) subject <- Celegans$chrI pattern1 <- DNAString("ACGGACCTAATGTTATC") pattern2 <- DNAString("ACGGACCTVATGTTRTC") ## Allowing up to 2 mismatching letters doesn't give any match: m1a <- matchPattern(pattern1, subject, max.mismatch=2) ## But allowing up to 2 edit operations gives 3 matches: system.time(m1b <- matchPattern(pattern1, subject, max.mismatch=2, with.indels=TRUE)) m1b ## pwalign::pairwiseAlignment() returns the (first) best match only: if (interactive()) { library(pwalign) mat <- nucleotideSubstitutionMatrix(match=1, mismatch=0, baseOnly=TRUE) ## Note that this call to pairwiseAlignment() will need to ## allocate 733.5 Mb of memory (i.e. length(pattern) * length(subject) ## * 3 bytes). system.time(pwa <- pairwiseAlignment(pattern1, subject, type="local", substitutionMatrix=mat, gapOpening=0, gapExtension=1)) pwa } ## With IUPAC ambiguities in the pattern: m2a <- matchPattern(pattern2, subject, max.mismatch=2, fixed="subject") m2b <- matchPattern(pattern2, subject, max.mismatch=2, with.indels=TRUE, fixed="subject") ## All the matches in 'm1b' and 'm2a' should also appear in 'm2b': stopifnot(suppressWarnings(all(ranges(m1b) %in% ranges(m2b)))) stopifnot(suppressWarnings(all(ranges(m2a) %in% ranges(m2b)))) ## --------------------------------------------------------------------- ## D. WHEN 'with.indels=TRUE', ONLY "BEST LOCAL MATCHES" ARE REPORTED ## --------------------------------------------------------------------- ## With deletions in the subject: subject <- BString("ACDEFxxxCDEFxxxABCE") matchPattern("ABCDEF", subject, max.mismatch=2, with.indels=TRUE) matchPattern("ABCDEF", subject, max.mismatch=2) ## With insertions in the subject: subject <- BString("AiBCDiEFxxxABCDiiFxxxAiBCDEFxxxABCiDEF") matchPattern("ABCDEF", subject, max.mismatch=2, with.indels=TRUE) matchPattern("ABCDEF", subject, max.mismatch=2) ## With substitutions (note that the "best local matches" can introduce ## indels and therefore be shorter than 6): subject <- BString("AsCDEFxxxABDCEFxxxBACDEFxxxABCEDF") matchPattern("ABCDEF", subject, max.mismatch=2, with.indels=TRUE) matchPattern("ABCDEF", subject, max.mismatch=2)## --------------------------------------------------------------------- ## A. matchPattern()/countPattern() ## --------------------------------------------------------------------- ## A simple inexact matching example with a short subject: x <- DNAString("AAGCGCGATATG") m1 <- matchPattern("GCNNNAT", x) m1 m2 <- matchPattern("GCNNNAT", x, fixed=FALSE) m2 as.matrix(m2) ## With DNA sequence of yeast chromosome number 1: data(yeastSEQCHR1) yeast1 <- DNAString(yeastSEQCHR1) PpiI <- "GAACNNNNNCTC" # a restriction enzyme pattern match1.PpiI <- matchPattern(PpiI, yeast1, fixed=FALSE) match2.PpiI <- matchPattern(PpiI, yeast1, max.mismatch=1, fixed=FALSE) ## With a genome containing isolated Ns: library(BSgenome.Celegans.UCSC.ce2) chrII <- Celegans[["chrII"]] alphabetFrequency(chrII) matchPattern("N", chrII) matchPattern("TGGGTGTCTTT", chrII) # no match matchPattern("TGGGTGTCTTT", chrII, fixed=FALSE) # 1 match ## Using wildcards ("N") in the pattern on a genome containing N-blocks: library(BSgenome.Dmelanogaster.UCSC.dm3) chrX <- maskMotif(Dmelanogaster$chrX, "N") as(chrX, "Views") # 4 non masked regions matchPattern("TTTATGNTTGGTA", chrX, fixed=FALSE) ## Can also be achieved with no mask: masks(chrX) <- NULL matchPattern("TTTATGNTTGGTA", chrX, fixed="subject") ## --------------------------------------------------------------------- ## B. vmatchPattern()/vcountPattern() ## --------------------------------------------------------------------- ## Load Fly upstream sequences (i.e. the sequences 2000 bases upstream of ## annotated transcription starts): dm3_upstream_filepath <- system.file("extdata", "dm3_upstream2000.fa.gz", package="Biostrings") dm3_upstream <- readDNAStringSet(dm3_upstream_filepath) dm3_upstream Ebox <- DNAString("CANNTG") subject <- dm3_upstream mindex <- vmatchPattern(Ebox, subject, fixed="subject") nmatch_per_seq <- elementNROWS(mindex) # Get the number of matches per # subject element. sum(nmatch_per_seq) # Total number of matches. table(nmatch_per_seq) ## Let's have a closer look at one of the upstream sequences with most ## matches: i0 <- which.max(nmatch_per_seq) subject0 <- subject[[i0]] ir0 <- mindex[[i0]] # matches in 'subject0' as an IRanges object ir0 Views(subject0, ir0) # matches in 'subject0' as a Views object ## --------------------------------------------------------------------- ## C. WITH INDELS ## --------------------------------------------------------------------- library(BSgenome.Celegans.UCSC.ce2) subject <- Celegans$chrI pattern1 <- DNAString("ACGGACCTAATGTTATC") pattern2 <- DNAString("ACGGACCTVATGTTRTC") ## Allowing up to 2 mismatching letters doesn't give any match: m1a <- matchPattern(pattern1, subject, max.mismatch=2) ## But allowing up to 2 edit operations gives 3 matches: system.time(m1b <- matchPattern(pattern1, subject, max.mismatch=2, with.indels=TRUE)) m1b ## pwalign::pairwiseAlignment() returns the (first) best match only: if (interactive()) { library(pwalign) mat <- nucleotideSubstitutionMatrix(match=1, mismatch=0, baseOnly=TRUE) ## Note that this call to pairwiseAlignment() will need to ## allocate 733.5 Mb of memory (i.e. length(pattern) * length(subject) ## * 3 bytes). system.time(pwa <- pairwiseAlignment(pattern1, subject, type="local", substitutionMatrix=mat, gapOpening=0, gapExtension=1)) pwa } ## With IUPAC ambiguities in the pattern: m2a <- matchPattern(pattern2, subject, max.mismatch=2, fixed="subject") m2b <- matchPattern(pattern2, subject, max.mismatch=2, with.indels=TRUE, fixed="subject") ## All the matches in 'm1b' and 'm2a' should also appear in 'm2b': stopifnot(suppressWarnings(all(ranges(m1b) %in% ranges(m2b)))) stopifnot(suppressWarnings(all(ranges(m2a) %in% ranges(m2b)))) ## --------------------------------------------------------------------- ## D. WHEN 'with.indels=TRUE', ONLY "BEST LOCAL MATCHES" ARE REPORTED ## --------------------------------------------------------------------- ## With deletions in the subject: subject <- BString("ACDEFxxxCDEFxxxABCE") matchPattern("ABCDEF", subject, max.mismatch=2, with.indels=TRUE) matchPattern("ABCDEF", subject, max.mismatch=2) ## With insertions in the subject: subject <- BString("AiBCDiEFxxxABCDiiFxxxAiBCDEFxxxABCiDEF") matchPattern("ABCDEF", subject, max.mismatch=2, with.indels=TRUE) matchPattern("ABCDEF", subject, max.mismatch=2) ## With substitutions (note that the "best local matches" can introduce ## indels and therefore be shorter than 6): subject <- BString("AsCDEFxxxABDCEFxxxBACDEFxxxABCEDF") matchPattern("ABCDEF", subject, max.mismatch=2, with.indels=TRUE) matchPattern("ABCDEF", subject, max.mismatch=2)
A set of functions for finding all the occurrences (aka "matches" or "hits") of a set of patterns (aka the dictionary) in a reference sequence or set of reference sequences (aka the subject)
The following functions differ in what they return: matchPDict
returns the "where" information i.e. the positions in the subject of all the
occurrences of every pattern; countPDict returns the "how many
times" information i.e. the number of occurrences for each pattern;
and whichPDict returns the "who" information i.e. which patterns
in the input dictionary have at least one match.
vcountPDict and vwhichPDict are vectorized versions
of countPDict and whichPDict, respectively, that is,
they work on a set of reference sequences in a vectorized fashion.
This man page shows how to use these functions (aka the *PDict
functions) for exact matching of a constant width dictionary i.e.
a dictionary where all the patterns have the same length (same number
of nucleotides).
See ?`matchPDict-inexact` for how to use these functions
for inexact matching or when the original dictionary has a variable width.
matchPDict(pdict, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto", verbose=FALSE) countPDict(pdict, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto", verbose=FALSE) whichPDict(pdict, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto", verbose=FALSE) vcountPDict(pdict, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto", collapse=FALSE, weight=1L, verbose=FALSE, ...) vwhichPDict(pdict, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto", verbose=FALSE)matchPDict(pdict, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto", verbose=FALSE) countPDict(pdict, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto", verbose=FALSE) whichPDict(pdict, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto", verbose=FALSE) vcountPDict(pdict, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto", collapse=FALSE, weight=1L, verbose=FALSE, ...) vwhichPDict(pdict, subject, max.mismatch=0, min.mismatch=0, with.indels=FALSE, fixed=TRUE, algorithm="auto", verbose=FALSE)
pdict |
A PDict object containing the preprocessed dictionary. All these functions also work with a dictionary that has not been
preprocessed (in other words, the |
subject |
An XString or MaskedXString object containing the
subject sequence for An XStringSet object containing the subject sequences
for If |
max.mismatch, min.mismatch
|
The maximum and minimum number of mismatching letters allowed (see
|
with.indels |
Only supported by If |
fixed |
Whether IUPAC ambiguity codes should be interpreted literally or not
(see |
algorithm |
Ignored if |
verbose |
|
collapse, weight
|
If If |
... |
Additional arguments for methods. |
In this man page, we assume that you know how to preprocess a dictionary
of DNA patterns that can then be used with any of the *PDict
functions described here. Please see ?PDict if you don't.
When using the *PDict functions for exact matching of a constant
width dictionary, the standard way to preprocess the original dictionary
is by calling the PDict constructor on it with no extra
arguments. This returns the preprocessed dictionary in a PDict
object that can be used with any of the *PDict functions.
If M denotes the number of patterns in the pdict
argument (M <- length(pdict)), then matchPDict returns
an MIndex object of length M,
and countPDict an integer vector of length M.
whichPDict returns an integer vector made of the indices of the
patterns in the pdict argument that have at least one match.
If N denotes the number of sequences in the subject
argument (N <- length(subject)), then vcountPDict
returns an integer matrix with M rows and N columns,
unless the collapse argument is used. In that case, depending
on the type of weight, an integer or numeric vector is returned
(see above for the details).
vwhichPDict returns a list of N integer vectors.
H. Pagès
Aho, Alfred V.; Margaret J. Corasick (June 1975). "Efficient string matching: An aid to bibliographic search". Communications of the ACM 18 (6): 333-340.
PDict-class,
MIndex-class,
matchPDict-inexact,
isMatchingAt,
coverage,MIndex-method,
matchPattern,
alphabetFrequency,
DNAStringSet-class,
XStringViews-class,
MaskedDNAString-class
## --------------------------------------------------------------------- ## A. A SIMPLE EXAMPLE OF EXACT MATCHING ## --------------------------------------------------------------------- ## Creating the pattern dictionary: library(drosophila2probe) dict0 <- DNAStringSet(drosophila2probe) dict0 # The original dictionary. length(dict0) # Hundreds of thousands of patterns. pdict0 <- PDict(dict0) # Store the original dictionary in # a PDict object (preprocessing). ## Using the pattern dictionary on chromosome 3R: library(BSgenome.Dmelanogaster.UCSC.dm3) chr3R <- Dmelanogaster$chr3R # Load chromosome 3R chr3R mi0 <- matchPDict(pdict0, chr3R) # Search... ## Looking at the matches: start_index <- startIndex(mi0) # Get the start index. length(start_index) # Same as the original dictionary. start_index[[8220]] # Starts of the 8220th pattern. end_index <- endIndex(mi0) # Get the end index. end_index[[8220]] # Ends of the 8220th pattern. nmatch_per_pat <- elementNROWS(mi0) # Get the number of matches per pattern. nmatch_per_pat[[8220]] mi0[[8220]] # Get the matches for the 8220th pattern. start(mi0[[8220]]) # Equivalent to startIndex(mi0)[[8220]]. sum(nmatch_per_pat) # Total number of matches. table(nmatch_per_pat) i0 <- which(nmatch_per_pat == max(nmatch_per_pat)) pdict0[[i0]] # The pattern with most occurrences. mi0[[i0]] # Its matches as an IRanges object. Views(chr3R, mi0[[i0]]) # And as an XStringViews object. ## Get the coverage of the original subject: cov3R <- as.integer(coverage(mi0, width=length(chr3R))) max(cov3R) mean(cov3R) sum(cov3R != 0) / length(cov3R) # Only 2.44% of chr3R is covered. if (interactive()) { library(graphics) plotCoverage <- function(cx, start, end) { graphics::plot.new() graphics::plot.window(c(start, end), c(0, 20)) graphics::axis(1) graphics::axis(2) graphics::axis(4) graphics::lines(start:end, cx[start:end], type="l") } plotCoverage(cov3R, 27600000, 27900000) } ## --------------------------------------------------------------------- ## B. NAMING THE PATTERNS ## --------------------------------------------------------------------- ## The names of the original patterns, if any, are propagated to the ## PDict and MIndex objects: names(dict0) <- mkAllStrings(letters, 4)[seq_len(length(dict0))] dict0 dict0[["abcd"]] pdict0n <- PDict(dict0) names(pdict0n)[1:30] pdict0n[["abcd"]] mi0n <- matchPDict(pdict0n, chr3R) names(mi0n)[1:30] mi0n[["abcd"]] ## This is particularly useful when unlisting an MIndex object: unlist(mi0)[1:10] unlist(mi0n)[1:10] # keep track of where the matches are coming from ## --------------------------------------------------------------------- ## C. PERFORMANCE ## --------------------------------------------------------------------- ## If getting the number of matches is what matters only (without ## regarding their positions), then countPDict() will be faster, ## especially when there is a high number of matches: nmatch_per_pat0 <- countPDict(pdict0, chr3R) stopifnot(identical(nmatch_per_pat0, nmatch_per_pat)) if (interactive()) { ## What's the impact of the dictionary width on performance? ## Below is some code that can be used to figure out (will take a long ## time to run). For different widths of the original dictionary, we ## look at: ## o pptime: preprocessing time (in sec.) i.e. time needed for ## building the PDict object from the truncated input ## sequences; ## o nnodes: nb of nodes in the resulting Aho-Corasick tree; ## o nupatt: nb of unique truncated input sequences; ## o matchtime: time (in sec.) needed to find all the matches; ## o totalcount: total number of matches. getPDictStats <- function(dict, subject) { ans_width <- width(dict[1]) ans_pptime <- system.time(pdict <- PDict(dict))[["elapsed"]] pptb <- pdict@threeparts@pptb ans_nnodes <- nnodes(pptb) ans_nupatt <- sum(!duplicated(pdict)) ans_matchtime <- system.time( mi0 <- matchPDict(pdict, subject) )[["elapsed"]] ans_totalcount <- sum(elementNROWS(mi0)) list( width=ans_width, pptime=ans_pptime, nnodes=ans_nnodes, nupatt=ans_nupatt, matchtime=ans_matchtime, totalcount=ans_totalcount ) } stats <- lapply(8:25, function(width) getPDictStats(DNAStringSet(dict0, end=width), chr3R)) stats <- data.frame(do.call(rbind, stats)) stats } ## --------------------------------------------------------------------- ## D. USING A NON-PREPROCESSED DICTIONARY ## --------------------------------------------------------------------- dict3 <- DNAStringSet(mkAllStrings(DNA_BASES, 3)) # all trinucleotides dict3 pdict3 <- PDict(dict3) ## The 3 following calls are equivalent (from faster to slower): res3a <- countPDict(pdict3, chr3R) res3b <- countPDict(dict3, chr3R) res3c <- sapply(dict3, function(pattern) countPattern(pattern, chr3R)) stopifnot(identical(res3a, res3b)) stopifnot(identical(res3a, res3c)) ## One reason for using a non-preprocessed dictionary is to get rid of ## all the constraints associated with preprocessing, e.g., when ## preprocessing with PDict(), the input dictionary must be DNA and a ## Trusted Band must be defined (explicitly or implicitly). ## See '?PDict' for more information about these constraints. ## In particular, using a non-preprocessed dictionary can be ## useful for the kind of inexact matching that can't be achieved ## with a PDict object (if performance is not an issue). ## See '?`matchPDict-inexact`' for more information about inexact ## matching. dictD <- xscat(dict3, "N", reverseComplement(dict3)) ## The 2 following calls are equivalent (from faster to slower): resDa <- matchPDict(dictD, chr3R, fixed=FALSE) resDb <- sapply(dictD, function(pattern) matchPattern(pattern, chr3R, fixed=FALSE)) stopifnot(all(sapply(seq_len(length(dictD)), function(i) identical(resDa[[i]], as(resDb[[i]], "IRanges"))))) ## A non-preprocessed dictionary can be of any base class i.e. BString, ## RNAString, and AAString, in addition to DNAString: matchPDict(AAStringSet(c("DARC", "EGH")), AAString("KMFPRNDEGHSTTWTEE")) ## --------------------------------------------------------------------- ## E. vcountPDict() ## --------------------------------------------------------------------- ## Load Fly upstream sequences (i.e. the sequences 2000 bases upstream of ## annotated transcription starts): dm3_upstream_filepath <- system.file("extdata", "dm3_upstream2000.fa.gz", package="Biostrings") dm3_upstream <- readDNAStringSet(dm3_upstream_filepath) dm3_upstream subject <- dm3_upstream[1:100] mat1 <- vcountPDict(pdict0, subject) dim(mat1) # length(pdict0) x length(subject) nhit_per_probe <- rowSums(mat1) table(nhit_per_probe) ## Without vcountPDict(), 'mat1' could have been computed with: mat2 <- sapply(unname(subject), function(x) countPDict(pdict0, x)) stopifnot(identical(mat1, mat2)) ## but using vcountPDict() is faster (10x or more, depending of the ## average length of the sequences in 'subject'). if (interactive()) { ## This will fail (with message "allocMatrix: too many elements ## specified") because, on most platforms, vectors and matrices in R ## are limited to 2^31 elements: subject <- dm3_upstream vcountPDict(pdict0, subject) length(pdict0) * length(dm3_upstream) 1 * length(pdict0) * length(dm3_upstream) # > 2^31 ## But this will work: nhit_per_seq <- vcountPDict(pdict0, subject, collapse=2) sum(nhit_per_seq >= 1) # nb of subject sequences with at least 1 hit table(nhit_per_seq) # max is 74 which.max(nhit_per_seq) # 1133 sum(countPDict(pdict0, subject[[1133]])) # 74 } ## --------------------------------------------------------------------- ## F. RELATIONSHIP BETWEEN vcountPDict(), countPDict() AND ## vcountPattern() ## --------------------------------------------------------------------- subject <- dm3_upstream ## The 4 following calls are equivalent (from faster to slower): mat3a <- vcountPDict(pdict3, subject) mat3b <- vcountPDict(dict3, subject) mat3c <- sapply(dict3, function(pattern) vcountPattern(pattern, subject)) mat3d <- sapply(unname(subject), function(x) countPDict(pdict3, x)) stopifnot(identical(mat3a, mat3b)) stopifnot(identical(mat3a, t(mat3c))) stopifnot(identical(mat3a, mat3d)) ## The 3 following calls are equivalent (from faster to slower): nhitpp3a <- vcountPDict(pdict3, subject, collapse=1) # rowSums(mat3a) nhitpp3b <- vcountPDict(dict3, subject, collapse=1) nhitpp3c <- sapply(dict3, function(pattern) sum(vcountPattern(pattern, subject))) stopifnot(identical(nhitpp3a, nhitpp3b)) stopifnot(identical(nhitpp3a, nhitpp3c)) ## The 3 following calls are equivalent (from faster to slower): nhitps3a <- vcountPDict(pdict3, subject, collapse=2) # colSums(mat3a) nhitps3b <- vcountPDict(dict3, subject, collapse=2) nhitps3c <- sapply(unname(subject), function(x) sum(countPDict(pdict3, x))) stopifnot(identical(nhitps3a, nhitps3b)) stopifnot(identical(nhitps3a, nhitps3c)) ## --------------------------------------------------------------------- ## G. vwhichPDict() ## --------------------------------------------------------------------- subject <- dm3_upstream ## The 4 following calls are equivalent (from faster to slower): vwp3a <- vwhichPDict(pdict3, subject) vwp3b <- vwhichPDict(dict3, subject) vwp3c <- lapply(seq_len(ncol(mat3a)), function(j) which(mat3a[ , j] != 0L)) vwp3d <- lapply(unname(subject), function(x) whichPDict(pdict3, x)) stopifnot(identical(vwp3a, vwp3b)) stopifnot(identical(vwp3a, vwp3c)) stopifnot(identical(vwp3a, vwp3d)) table(sapply(vwp3a, length)) which.min(sapply(vwp3a, length)) ## Get the trinucleotides not represented in upstream sequence 21823: dict3[-vwp3a[[21823]]] # 2 trinucleotides ## Sanity check: tnf <- trinucleotideFrequency(subject[[21823]]) stopifnot(all(names(tnf)[tnf == 0] == dict3[-vwp3a[[21823]]])) ## --------------------------------------------------------------------- ## H. MAPPING PROBE SET IDS BETWEEN CHIPS WITH vwhichPDict() ## --------------------------------------------------------------------- ## Here we show a simple (and very naive) algorithm for mapping probe ## set IDs between the hgu95av2 and hgu133a chips (Affymetrix). ## 2 probe set IDs are considered mapped iff they share at least one ## probe. ## WARNING: This example takes about 10 minutes to run. if (interactive()) { library(hgu95av2probe) library(hgu133aprobe) probes1 <- DNAStringSet(hgu95av2probe) probes2 <- DNAStringSet(hgu133aprobe) pdict2 <- PDict(probes2) ## Get the mapping from probes1 to probes2 (based on exact matching): map1to2 <- vwhichPDict(pdict2, probes1) ## The following helper function uses the probe level mapping to induce ## the mapping at the probe set IDs level (from hgu95av2 to hgu133a). ## To keep things simple, 2 probe set IDs are considered mapped iff ## each of them contains at least one probe mapped to one probe of ## the other: mapProbeSetIDs1to2 <- function(psID) unique(hgu133aprobe$Probe.Set.Name[unlist( map1to2[hgu95av2probe$Probe.Set.Name == psID] )]) ## Use the helper function to build the complete mapping: psIDs1 <- unique(hgu95av2probe$Probe.Set.Name) mapPSIDs1to2 <- lapply(psIDs1, mapProbeSetIDs1to2) # about 3 min. names(mapPSIDs1to2) <- psIDs1 ## Do some basic stats: table(sapply(mapPSIDs1to2, length)) ## [ADVANCED USERS ONLY] ## An alternative that is slightly faster is to put all the probes ## (hgu95av2 + hgu133a) in a single PDict object and then query its ## 'dups0' slot directly. This slot is a Dups object containing the ## mapping between duplicated patterns. ## Note that we can do this only because all the probes have the ## same length (25) and because we are doing exact matching: probes12 <- DNAStringSet(c(hgu95av2probe$sequence, hgu133aprobe$sequence)) pdict12 <- PDict(probes12) dups0 <- pdict12@dups0 mapProbeSetIDs1to2alt <- function(psID) { ii1 <- unique(togroup(dups0, which(hgu95av2probe$Probe.Set.Name == psID))) ii2 <- members(dups0, ii1) - length(probes1) ii2 <- ii2[ii2 >= 1L] unique(hgu133aprobe$Probe.Set.Name[ii2]) } mapPSIDs1to2alt <- lapply(psIDs1, mapProbeSetIDs1to2alt) # about 5 min. names(mapPSIDs1to2alt) <- psIDs1 ## 'mapPSIDs1to2alt' and 'mapPSIDs1to2' contain the same mapping: stopifnot(identical(lapply(mapPSIDs1to2alt, sort), lapply(mapPSIDs1to2, sort))) }## --------------------------------------------------------------------- ## A. A SIMPLE EXAMPLE OF EXACT MATCHING ## --------------------------------------------------------------------- ## Creating the pattern dictionary: library(drosophila2probe) dict0 <- DNAStringSet(drosophila2probe) dict0 # The original dictionary. length(dict0) # Hundreds of thousands of patterns. pdict0 <- PDict(dict0) # Store the original dictionary in # a PDict object (preprocessing). ## Using the pattern dictionary on chromosome 3R: library(BSgenome.Dmelanogaster.UCSC.dm3) chr3R <- Dmelanogaster$chr3R # Load chromosome 3R chr3R mi0 <- matchPDict(pdict0, chr3R) # Search... ## Looking at the matches: start_index <- startIndex(mi0) # Get the start index. length(start_index) # Same as the original dictionary. start_index[[8220]] # Starts of the 8220th pattern. end_index <- endIndex(mi0) # Get the end index. end_index[[8220]] # Ends of the 8220th pattern. nmatch_per_pat <- elementNROWS(mi0) # Get the number of matches per pattern. nmatch_per_pat[[8220]] mi0[[8220]] # Get the matches for the 8220th pattern. start(mi0[[8220]]) # Equivalent to startIndex(mi0)[[8220]]. sum(nmatch_per_pat) # Total number of matches. table(nmatch_per_pat) i0 <- which(nmatch_per_pat == max(nmatch_per_pat)) pdict0[[i0]] # The pattern with most occurrences. mi0[[i0]] # Its matches as an IRanges object. Views(chr3R, mi0[[i0]]) # And as an XStringViews object. ## Get the coverage of the original subject: cov3R <- as.integer(coverage(mi0, width=length(chr3R))) max(cov3R) mean(cov3R) sum(cov3R != 0) / length(cov3R) # Only 2.44% of chr3R is covered. if (interactive()) { library(graphics) plotCoverage <- function(cx, start, end) { graphics::plot.new() graphics::plot.window(c(start, end), c(0, 20)) graphics::axis(1) graphics::axis(2) graphics::axis(4) graphics::lines(start:end, cx[start:end], type="l") } plotCoverage(cov3R, 27600000, 27900000) } ## --------------------------------------------------------------------- ## B. NAMING THE PATTERNS ## --------------------------------------------------------------------- ## The names of the original patterns, if any, are propagated to the ## PDict and MIndex objects: names(dict0) <- mkAllStrings(letters, 4)[seq_len(length(dict0))] dict0 dict0[["abcd"]] pdict0n <- PDict(dict0) names(pdict0n)[1:30] pdict0n[["abcd"]] mi0n <- matchPDict(pdict0n, chr3R) names(mi0n)[1:30] mi0n[["abcd"]] ## This is particularly useful when unlisting an MIndex object: unlist(mi0)[1:10] unlist(mi0n)[1:10] # keep track of where the matches are coming from ## --------------------------------------------------------------------- ## C. PERFORMANCE ## --------------------------------------------------------------------- ## If getting the number of matches is what matters only (without ## regarding their positions), then countPDict() will be faster, ## especially when there is a high number of matches: nmatch_per_pat0 <- countPDict(pdict0, chr3R) stopifnot(identical(nmatch_per_pat0, nmatch_per_pat)) if (interactive()) { ## What's the impact of the dictionary width on performance? ## Below is some code that can be used to figure out (will take a long ## time to run). For different widths of the original dictionary, we ## look at: ## o pptime: preprocessing time (in sec.) i.e. time needed for ## building the PDict object from the truncated input ## sequences; ## o nnodes: nb of nodes in the resulting Aho-Corasick tree; ## o nupatt: nb of unique truncated input sequences; ## o matchtime: time (in sec.) needed to find all the matches; ## o totalcount: total number of matches. getPDictStats <- function(dict, subject) { ans_width <- width(dict[1]) ans_pptime <- system.time(pdict <- PDict(dict))[["elapsed"]] pptb <- pdict@threeparts@pptb ans_nnodes <- nnodes(pptb) ans_nupatt <- sum(!duplicated(pdict)) ans_matchtime <- system.time( mi0 <- matchPDict(pdict, subject) )[["elapsed"]] ans_totalcount <- sum(elementNROWS(mi0)) list( width=ans_width, pptime=ans_pptime, nnodes=ans_nnodes, nupatt=ans_nupatt, matchtime=ans_matchtime, totalcount=ans_totalcount ) } stats <- lapply(8:25, function(width) getPDictStats(DNAStringSet(dict0, end=width), chr3R)) stats <- data.frame(do.call(rbind, stats)) stats } ## --------------------------------------------------------------------- ## D. USING A NON-PREPROCESSED DICTIONARY ## --------------------------------------------------------------------- dict3 <- DNAStringSet(mkAllStrings(DNA_BASES, 3)) # all trinucleotides dict3 pdict3 <- PDict(dict3) ## The 3 following calls are equivalent (from faster to slower): res3a <- countPDict(pdict3, chr3R) res3b <- countPDict(dict3, chr3R) res3c <- sapply(dict3, function(pattern) countPattern(pattern, chr3R)) stopifnot(identical(res3a, res3b)) stopifnot(identical(res3a, res3c)) ## One reason for using a non-preprocessed dictionary is to get rid of ## all the constraints associated with preprocessing, e.g., when ## preprocessing with PDict(), the input dictionary must be DNA and a ## Trusted Band must be defined (explicitly or implicitly). ## See '?PDict' for more information about these constraints. ## In particular, using a non-preprocessed dictionary can be ## useful for the kind of inexact matching that can't be achieved ## with a PDict object (if performance is not an issue). ## See '?`matchPDict-inexact`' for more information about inexact ## matching. dictD <- xscat(dict3, "N", reverseComplement(dict3)) ## The 2 following calls are equivalent (from faster to slower): resDa <- matchPDict(dictD, chr3R, fixed=FALSE) resDb <- sapply(dictD, function(pattern) matchPattern(pattern, chr3R, fixed=FALSE)) stopifnot(all(sapply(seq_len(length(dictD)), function(i) identical(resDa[[i]], as(resDb[[i]], "IRanges"))))) ## A non-preprocessed dictionary can be of any base class i.e. BString, ## RNAString, and AAString, in addition to DNAString: matchPDict(AAStringSet(c("DARC", "EGH")), AAString("KMFPRNDEGHSTTWTEE")) ## --------------------------------------------------------------------- ## E. vcountPDict() ## --------------------------------------------------------------------- ## Load Fly upstream sequences (i.e. the sequences 2000 bases upstream of ## annotated transcription starts): dm3_upstream_filepath <- system.file("extdata", "dm3_upstream2000.fa.gz", package="Biostrings") dm3_upstream <- readDNAStringSet(dm3_upstream_filepath) dm3_upstream subject <- dm3_upstream[1:100] mat1 <- vcountPDict(pdict0, subject) dim(mat1) # length(pdict0) x length(subject) nhit_per_probe <- rowSums(mat1) table(nhit_per_probe) ## Without vcountPDict(), 'mat1' could have been computed with: mat2 <- sapply(unname(subject), function(x) countPDict(pdict0, x)) stopifnot(identical(mat1, mat2)) ## but using vcountPDict() is faster (10x or more, depending of the ## average length of the sequences in 'subject'). if (interactive()) { ## This will fail (with message "allocMatrix: too many elements ## specified") because, on most platforms, vectors and matrices in R ## are limited to 2^31 elements: subject <- dm3_upstream vcountPDict(pdict0, subject) length(pdict0) * length(dm3_upstream) 1 * length(pdict0) * length(dm3_upstream) # > 2^31 ## But this will work: nhit_per_seq <- vcountPDict(pdict0, subject, collapse=2) sum(nhit_per_seq >= 1) # nb of subject sequences with at least 1 hit table(nhit_per_seq) # max is 74 which.max(nhit_per_seq) # 1133 sum(countPDict(pdict0, subject[[1133]])) # 74 } ## --------------------------------------------------------------------- ## F. RELATIONSHIP BETWEEN vcountPDict(), countPDict() AND ## vcountPattern() ## --------------------------------------------------------------------- subject <- dm3_upstream ## The 4 following calls are equivalent (from faster to slower): mat3a <- vcountPDict(pdict3, subject) mat3b <- vcountPDict(dict3, subject) mat3c <- sapply(dict3, function(pattern) vcountPattern(pattern, subject)) mat3d <- sapply(unname(subject), function(x) countPDict(pdict3, x)) stopifnot(identical(mat3a, mat3b)) stopifnot(identical(mat3a, t(mat3c))) stopifnot(identical(mat3a, mat3d)) ## The 3 following calls are equivalent (from faster to slower): nhitpp3a <- vcountPDict(pdict3, subject, collapse=1) # rowSums(mat3a) nhitpp3b <- vcountPDict(dict3, subject, collapse=1) nhitpp3c <- sapply(dict3, function(pattern) sum(vcountPattern(pattern, subject))) stopifnot(identical(nhitpp3a, nhitpp3b)) stopifnot(identical(nhitpp3a, nhitpp3c)) ## The 3 following calls are equivalent (from faster to slower): nhitps3a <- vcountPDict(pdict3, subject, collapse=2) # colSums(mat3a) nhitps3b <- vcountPDict(dict3, subject, collapse=2) nhitps3c <- sapply(unname(subject), function(x) sum(countPDict(pdict3, x))) stopifnot(identical(nhitps3a, nhitps3b)) stopifnot(identical(nhitps3a, nhitps3c)) ## --------------------------------------------------------------------- ## G. vwhichPDict() ## --------------------------------------------------------------------- subject <- dm3_upstream ## The 4 following calls are equivalent (from faster to slower): vwp3a <- vwhichPDict(pdict3, subject) vwp3b <- vwhichPDict(dict3, subject) vwp3c <- lapply(seq_len(ncol(mat3a)), function(j) which(mat3a[ , j] != 0L)) vwp3d <- lapply(unname(subject), function(x) whichPDict(pdict3, x)) stopifnot(identical(vwp3a, vwp3b)) stopifnot(identical(vwp3a, vwp3c)) stopifnot(identical(vwp3a, vwp3d)) table(sapply(vwp3a, length)) which.min(sapply(vwp3a, length)) ## Get the trinucleotides not represented in upstream sequence 21823: dict3[-vwp3a[[21823]]] # 2 trinucleotides ## Sanity check: tnf <- trinucleotideFrequency(subject[[21823]]) stopifnot(all(names(tnf)[tnf == 0] == dict3[-vwp3a[[21823]]])) ## --------------------------------------------------------------------- ## H. MAPPING PROBE SET IDS BETWEEN CHIPS WITH vwhichPDict() ## --------------------------------------------------------------------- ## Here we show a simple (and very naive) algorithm for mapping probe ## set IDs between the hgu95av2 and hgu133a chips (Affymetrix). ## 2 probe set IDs are considered mapped iff they share at least one ## probe. ## WARNING: This example takes about 10 minutes to run. if (interactive()) { library(hgu95av2probe) library(hgu133aprobe) probes1 <- DNAStringSet(hgu95av2probe) probes2 <- DNAStringSet(hgu133aprobe) pdict2 <- PDict(probes2) ## Get the mapping from probes1 to probes2 (based on exact matching): map1to2 <- vwhichPDict(pdict2, probes1) ## The following helper function uses the probe level mapping to induce ## the mapping at the probe set IDs level (from hgu95av2 to hgu133a). ## To keep things simple, 2 probe set IDs are considered mapped iff ## each of them contains at least one probe mapped to one probe of ## the other: mapProbeSetIDs1to2 <- function(psID) unique(hgu133aprobe$Probe.Set.Name[unlist( map1to2[hgu95av2probe$Probe.Set.Name == psID] )]) ## Use the helper function to build the complete mapping: psIDs1 <- unique(hgu95av2probe$Probe.Set.Name) mapPSIDs1to2 <- lapply(psIDs1, mapProbeSetIDs1to2) # about 3 min. names(mapPSIDs1to2) <- psIDs1 ## Do some basic stats: table(sapply(mapPSIDs1to2, length)) ## [ADVANCED USERS ONLY] ## An alternative that is slightly faster is to put all the probes ## (hgu95av2 + hgu133a) in a single PDict object and then query its ## 'dups0' slot directly. This slot is a Dups object containing the ## mapping between duplicated patterns. ## Note that we can do this only because all the probes have the ## same length (25) and because we are doing exact matching: probes12 <- DNAStringSet(c(hgu95av2probe$sequence, hgu133aprobe$sequence)) pdict12 <- PDict(probes12) dups0 <- pdict12@dups0 mapProbeSetIDs1to2alt <- function(psID) { ii1 <- unique(togroup(dups0, which(hgu95av2probe$Probe.Set.Name == psID))) ii2 <- members(dups0, ii1) - length(probes1) ii2 <- ii2[ii2 >= 1L] unique(hgu133aprobe$Probe.Set.Name[ii2]) } mapPSIDs1to2alt <- lapply(psIDs1, mapProbeSetIDs1to2alt) # about 5 min. names(mapPSIDs1to2alt) <- psIDs1 ## 'mapPSIDs1to2alt' and 'mapPSIDs1to2' contain the same mapping: stopifnot(identical(lapply(mapPSIDs1to2alt, sort), lapply(mapPSIDs1to2, sort))) }
The matchPDict, countPDict and whichPDict functions
efficiently find the occurrences in a text (the subject) of all patterns
stored in a preprocessed dictionary.
This man page shows how to use these functions for inexact (or fuzzy) matching or when the original dictionary has a variable width.
See ?matchPDict for how to use these functions for exact
matching of a constant width dictionary i.e. a dictionary where all the
patterns have the same length (same number of nucleotides).
In this man page, we assume that you know how to preprocess
a dictionary of DNA patterns that can then be used with
matchPDict, countPDict or whichPDict.
Please see ?PDict if you don't.
matchPDict and family support different kinds of inexact
matching but with some restrictions. Inexact matching is controlled
via the definition of a Trusted Band during the preprocessing step
and/or via the max.mismatch, min.mismatch and fixed
arguments.
Defining a Trusted Band is also required when the original dictionary
is not rectangular (variable width), even for exact matching.
See ?PDict for how to define a Trusted Band.
Here is how matchPDict and family handle the Trusted Band
defined on pdict:
(1) Find all the exact matches of all the elements in the Trusted Band.
(2) For each element in the Trusted Band that has at least one exact match, compare the head and the tail of this element with the flanking sequences of the matches found in (1).
Note that the number of exact matches found in (1) will decrease
exponentially with the width of the Trusted Band.
Here is a simple guideline in order to get reasonably good
performance: if TBW is the width of the Trusted Band
(TBW <- tb.width(pdict)) and L the number of letters in the
subject (L <- nchar(subject)), then L / (4^TBW) should
be kept as small as possible, typically < 10 or 20.
In addition, when a Trusted Band has been defined during preprocessing,
then matchPDict and family can be called with fixed=FALSE.
In this case, IUPAC ambiguity codes in the head or the tail of the
PDict object are treated as ambiguities.
Finally, fixed="pattern" can be used to indicate that IUPAC
ambiguity codes in the subject should be treated as ambiguities.
It only works if the density of codes is not too high.
It works whether or not a Trusted Band has been defined on pdict.
H. Pagès
Aho, Alfred V.; Margaret J. Corasick (June 1975). "Efficient string matching: An aid to bibliographic search". Communications of the ACM 18 (6): 333-340.
PDict-class, MIndex-class, matchPDict
## --------------------------------------------------------------------- ## A. USING AN EXPLICIT TRUSTED BAND ## --------------------------------------------------------------------- library(drosophila2probe) dict0 <- DNAStringSet(drosophila2probe) dict0 # the original dictionary ## Preprocess the original dictionary by defining a Trusted Band that ## spans nucleotides 1 to 9 of each pattern. pdict9 <- PDict(dict0, tb.end=9) pdict9 tail(pdict9) sum(duplicated(pdict9)) table(patternFrequency(pdict9)) library(BSgenome.Dmelanogaster.UCSC.dm3) chr3R <- Dmelanogaster$chr3R chr3R table(countPDict(pdict9, chr3R, max.mismatch=1)) table(countPDict(pdict9, chr3R, max.mismatch=3)) table(countPDict(pdict9, chr3R, max.mismatch=5)) ## --------------------------------------------------------------------- ## B. COMPARISON WITH EXACT MATCHING ## --------------------------------------------------------------------- ## When the original dictionary is of constant width, exact matching ## (i.e. 'max.mismatch=0' and 'fixed=TRUE) will be more efficient with ## a full-width Trusted Band (i.e. a Trusted Band that covers the entire ## dictionary) than with a Trusted Band of width < width(dict0). pdict0 <- PDict(dict0) count0 <- countPDict(pdict0, chr3R) count0b <- countPDict(pdict9, chr3R, max.mismatch=0) identical(count0b, count0) # TRUE ## --------------------------------------------------------------------- ## C. USING AN EXPLICIT TRUSTED BAND ON A VARIABLE WIDTH DICTIONARY ## --------------------------------------------------------------------- ## Here is a small variable width dictionary that contains IUPAC ## ambiguities (pattern 1 and 3 contain an N): dict0 <- DNAStringSet(c("TACCNG", "TAGT", "CGGNT", "AGTAG", "TAGT")) ## (Note that pattern 2 and 5 are identical.) ## If we only want to do exact matching, then it is recommended to use ## the widest possible Trusted Band i.e. to set its width to ## 'min(width(dict0))' because this is what will give the best ## performance. However, when 'dict0' contains IUPAC ambiguities (like ## in our case), it could be that one of them is falling into the ## Trusted Band so we get an error (only base letters can go in the ## Trusted Band for now): ## Not run: PDict(dict0, tb.end=min(width(dict0))) # Error! ## End(Not run) ## In our case, the Trusted Band cannot be wider than 3: pdict <- PDict(dict0, tb.end=3) tail(pdict) subject <- DNAString("TAGTACCAGTTTCGGG") m <- matchPDict(pdict, subject) elementNROWS(m) # pattern 2 and 5 have 1 exact match m[[2]] ## We can take advantage of the fact that our Trusted Band doesn't cover ## the entire dictionary to allow inexact matching on the uncovered parts ## (the tail in our case): m <- matchPDict(pdict, subject, fixed=FALSE) elementNROWS(m) # now pattern 1 has 1 match too m[[1]] m <- matchPDict(pdict, subject, max.mismatch=1) elementNROWS(m) # now pattern 4 has 1 match too m[[4]] m <- matchPDict(pdict, subject, max.mismatch=1, fixed=FALSE) elementNROWS(m) # now pattern 3 has 1 match too m[[3]] # note that this match is "out of limit" Views(subject, m[[3]]) m <- matchPDict(pdict, subject, max.mismatch=2) elementNROWS(m) # pattern 4 gets 1 additional match m[[4]] ## Unlist all matches: unlist(m) ## --------------------------------------------------------------------- ## D. WITH IUPAC AMBIGUITY CODES IN THE PATTERNS ## --------------------------------------------------------------------- ## The Trusted Band cannot contain IUPAC ambiguity codes so patterns ## with ambiguity codes can only be preprocessed if we can define a ## Trusted Band with no ambiguity codes in it. dict <- DNAStringSet(c("AAACAAKS", "GGGAAA", "TNCCGGG")) pdict <- PDict(dict, tb.start=3, tb.width=4) subject <- DNAString("AAACAATCCCGGGAAACAAGG") matchPDict(pdict, subject) matchPDict(pdict, subject, fixed="subject") ## Sanity checks: res1 <- as.list(matchPDict(pdict, subject)) res2 <- as.list(matchPDict(dict, subject)) res3 <- lapply(dict, function(pattern) as(matchPattern(pattern, subject), "IRanges")) stopifnot(identical(res1, res2)) stopifnot(identical(res1, res3)) res1 <- as.list(matchPDict(pdict, subject, fixed="subject")) res2 <- as.list(matchPDict(dict, subject, fixed="subject")) res3 <- lapply(dict, function(pattern) as(matchPattern(pattern, subject, fixed="subject"), "IRanges")) stopifnot(identical(res1, res2)) stopifnot(identical(res1, res3)) ## --------------------------------------------------------------------- ## E. WITH IUPAC AMBIGUITY CODES IN THE SUBJECT ## --------------------------------------------------------------------- ## 'fixed="pattern"' (or 'fixed=FALSE') can be used to indicate that ## IUPAC ambiguity codes in the subject should be treated as ambiguities. pdict <- PDict(c("ACAC", "TCCG")) matchPDict(pdict, DNAString("ACNCCGT")) matchPDict(pdict, DNAString("ACNCCGT"), fixed="pattern") matchPDict(pdict, DNAString("ACWCCGT"), fixed="pattern") matchPDict(pdict, DNAString("ACRCCGT"), fixed="pattern") matchPDict(pdict, DNAString("ACKCCGT"), fixed="pattern") dict <- DNAStringSet(c("TTC", "CTT")) pdict <- PDict(dict) subject <- DNAString("CYTCACTTC") mi1 <- matchPDict(pdict, subject, fixed="pattern") mi2 <- matchPDict(dict, subject, fixed="pattern") stopifnot(identical(as.list(mi1), as.list(mi2)))## --------------------------------------------------------------------- ## A. USING AN EXPLICIT TRUSTED BAND ## --------------------------------------------------------------------- library(drosophila2probe) dict0 <- DNAStringSet(drosophila2probe) dict0 # the original dictionary ## Preprocess the original dictionary by defining a Trusted Band that ## spans nucleotides 1 to 9 of each pattern. pdict9 <- PDict(dict0, tb.end=9) pdict9 tail(pdict9) sum(duplicated(pdict9)) table(patternFrequency(pdict9)) library(BSgenome.Dmelanogaster.UCSC.dm3) chr3R <- Dmelanogaster$chr3R chr3R table(countPDict(pdict9, chr3R, max.mismatch=1)) table(countPDict(pdict9, chr3R, max.mismatch=3)) table(countPDict(pdict9, chr3R, max.mismatch=5)) ## --------------------------------------------------------------------- ## B. COMPARISON WITH EXACT MATCHING ## --------------------------------------------------------------------- ## When the original dictionary is of constant width, exact matching ## (i.e. 'max.mismatch=0' and 'fixed=TRUE) will be more efficient with ## a full-width Trusted Band (i.e. a Trusted Band that covers the entire ## dictionary) than with a Trusted Band of width < width(dict0). pdict0 <- PDict(dict0) count0 <- countPDict(pdict0, chr3R) count0b <- countPDict(pdict9, chr3R, max.mismatch=0) identical(count0b, count0) # TRUE ## --------------------------------------------------------------------- ## C. USING AN EXPLICIT TRUSTED BAND ON A VARIABLE WIDTH DICTIONARY ## --------------------------------------------------------------------- ## Here is a small variable width dictionary that contains IUPAC ## ambiguities (pattern 1 and 3 contain an N): dict0 <- DNAStringSet(c("TACCNG", "TAGT", "CGGNT", "AGTAG", "TAGT")) ## (Note that pattern 2 and 5 are identical.) ## If we only want to do exact matching, then it is recommended to use ## the widest possible Trusted Band i.e. to set its width to ## 'min(width(dict0))' because this is what will give the best ## performance. However, when 'dict0' contains IUPAC ambiguities (like ## in our case), it could be that one of them is falling into the ## Trusted Band so we get an error (only base letters can go in the ## Trusted Band for now): ## Not run: PDict(dict0, tb.end=min(width(dict0))) # Error! ## End(Not run) ## In our case, the Trusted Band cannot be wider than 3: pdict <- PDict(dict0, tb.end=3) tail(pdict) subject <- DNAString("TAGTACCAGTTTCGGG") m <- matchPDict(pdict, subject) elementNROWS(m) # pattern 2 and 5 have 1 exact match m[[2]] ## We can take advantage of the fact that our Trusted Band doesn't cover ## the entire dictionary to allow inexact matching on the uncovered parts ## (the tail in our case): m <- matchPDict(pdict, subject, fixed=FALSE) elementNROWS(m) # now pattern 1 has 1 match too m[[1]] m <- matchPDict(pdict, subject, max.mismatch=1) elementNROWS(m) # now pattern 4 has 1 match too m[[4]] m <- matchPDict(pdict, subject, max.mismatch=1, fixed=FALSE) elementNROWS(m) # now pattern 3 has 1 match too m[[3]] # note that this match is "out of limit" Views(subject, m[[3]]) m <- matchPDict(pdict, subject, max.mismatch=2) elementNROWS(m) # pattern 4 gets 1 additional match m[[4]] ## Unlist all matches: unlist(m) ## --------------------------------------------------------------------- ## D. WITH IUPAC AMBIGUITY CODES IN THE PATTERNS ## --------------------------------------------------------------------- ## The Trusted Band cannot contain IUPAC ambiguity codes so patterns ## with ambiguity codes can only be preprocessed if we can define a ## Trusted Band with no ambiguity codes in it. dict <- DNAStringSet(c("AAACAAKS", "GGGAAA", "TNCCGGG")) pdict <- PDict(dict, tb.start=3, tb.width=4) subject <- DNAString("AAACAATCCCGGGAAACAAGG") matchPDict(pdict, subject) matchPDict(pdict, subject, fixed="subject") ## Sanity checks: res1 <- as.list(matchPDict(pdict, subject)) res2 <- as.list(matchPDict(dict, subject)) res3 <- lapply(dict, function(pattern) as(matchPattern(pattern, subject), "IRanges")) stopifnot(identical(res1, res2)) stopifnot(identical(res1, res3)) res1 <- as.list(matchPDict(pdict, subject, fixed="subject")) res2 <- as.list(matchPDict(dict, subject, fixed="subject")) res3 <- lapply(dict, function(pattern) as(matchPattern(pattern, subject, fixed="subject"), "IRanges")) stopifnot(identical(res1, res2)) stopifnot(identical(res1, res3)) ## --------------------------------------------------------------------- ## E. WITH IUPAC AMBIGUITY CODES IN THE SUBJECT ## --------------------------------------------------------------------- ## 'fixed="pattern"' (or 'fixed=FALSE') can be used to indicate that ## IUPAC ambiguity codes in the subject should be treated as ambiguities. pdict <- PDict(c("ACAC", "TCCG")) matchPDict(pdict, DNAString("ACNCCGT")) matchPDict(pdict, DNAString("ACNCCGT"), fixed="pattern") matchPDict(pdict, DNAString("ACWCCGT"), fixed="pattern") matchPDict(pdict, DNAString("ACRCCGT"), fixed="pattern") matchPDict(pdict, DNAString("ACKCCGT"), fixed="pattern") dict <- DNAStringSet(c("TTC", "CTT")) pdict <- PDict(dict) subject <- DNAString("CYTCACTTC") mi1 <- matchPDict(pdict, subject, fixed="pattern") mi2 <- matchPDict(dict, subject, fixed="pattern") stopifnot(identical(as.list(mi1), as.list(mi2)))
In the context of a computer-simulated PCR experiment, one wants to find
the amplicons mapped to a given primer pair.
The matchProbePair function can be used for this: given a forward and a
reverse probe (i.e. the chromosome-specific sequences of the forward and
reverse primers used for the experiment) and a target sequence (generally a
chromosome sequence), the matchProbePair function will return all
the "theoretical amplicons" mapped to this probe pair.
matchProbePair(Fprobe, Rprobe, subject, algorithm="auto", logfile=NULL, verbose=FALSE, ...)matchProbePair(Fprobe, Rprobe, subject, algorithm="auto", logfile=NULL, verbose=FALSE, ...)
Fprobe |
The forward probe. |
Rprobe |
The reverse probe. |
subject |
A DNAString object (or an XStringViews object with a DNAString subject) containing the target sequence. |
algorithm |
One of the following: |
logfile |
A file used for logging. |
verbose |
|
... |
Additional arguments passed to |
The matchProbePair function does the following: (1) find all
the "plus hits" i.e. the Fprobe and Rprobe matches on the "plus" strand,
(2) find all the "minus hits" i.e. the Fprobe and Rprobe matches on the
"minus" strand and (3) from the set of all (plus_hit, minus_hit) pairs,
extract and return the subset of "reduced matches" i.e. the (plus_hit,
minus_hit) pairs such that (a) plus_hit <= minus_hit and (b) there are
no hits (plus or minus) between plus_hit and minus_hit.
This set of "reduced matches" is the set of "theoretical amplicons".
Additional arguments can be passed to matchPattern via the
... argument. This supports matching to ambiguity codes. See
matchPattern for more information on supported arguments.
An XStringViews object containing the set of "theoretical amplicons".
H. Pagès
matchPattern,
matchLRPatterns,
findPalindromes,
reverseComplement,
XStringViews-class
library(BSgenome.Dmelanogaster.UCSC.dm3) subject <- Dmelanogaster$chr3R ## With 20-nucleotide forward and reverse probes: Fprobe <- "AGCTCCGAGTTCCTGCAATA" Rprobe <- "CGTTGTTCACAAATATGCGG" matchProbePair(Fprobe, Rprobe, subject) # 1 "theoretical amplicon" ## With shorter forward and reverse probes, the risk of having multiple ## "theoretical amplicons" increases: Fprobe <- "AGCTCCGAGTTCC" Rprobe <- "CGTTGTTCACAA" matchProbePair(Fprobe, Rprobe, subject) # 2 "theoretical amplicons" Fprobe <- "AGCTCCGAGTT" Rprobe <- "CGTTGTTCACA" matchProbePair(Fprobe, Rprobe, subject) # 9 "theoretical amplicons"library(BSgenome.Dmelanogaster.UCSC.dm3) subject <- Dmelanogaster$chr3R ## With 20-nucleotide forward and reverse probes: Fprobe <- "AGCTCCGAGTTCCTGCAATA" Rprobe <- "CGTTGTTCACAAATATGCGG" matchProbePair(Fprobe, Rprobe, subject) # 1 "theoretical amplicon" ## With shorter forward and reverse probes, the risk of having multiple ## "theoretical amplicons" increases: Fprobe <- "AGCTCCGAGTTCC" Rprobe <- "CGTTGTTCACAA" matchProbePair(Fprobe, Rprobe, subject) # 2 "theoretical amplicons" Fprobe <- "AGCTCCGAGTT" Rprobe <- "CGTTGTTCACA" matchProbePair(Fprobe, Rprobe, subject) # 9 "theoretical amplicons"
Position Weight Matrix (PWM) creating, matching, and related utilities for DNA data. (PWM for amino acid sequences are not supported.)
PWM(x, type = c("log2probratio", "prob"), prior.params = c(A=0.25, C=0.25, G=0.25, T=0.25)) matchPWM(pwm, subject, min.score="80%", with.score=FALSE, ...) countPWM(pwm, subject, min.score="80%", ...) PWMscoreStartingAt(pwm, subject, starting.at=1) ## Utility functions for basic manipulation of the Position Weight Matrix maxWeights(x) minWeights(x) maxScore(x) minScore(x) unitScale(x) ## S4 method for signature 'matrix' reverseComplement(x, ...)PWM(x, type = c("log2probratio", "prob"), prior.params = c(A=0.25, C=0.25, G=0.25, T=0.25)) matchPWM(pwm, subject, min.score="80%", with.score=FALSE, ...) countPWM(pwm, subject, min.score="80%", ...) PWMscoreStartingAt(pwm, subject, starting.at=1) ## Utility functions for basic manipulation of the Position Weight Matrix maxWeights(x) minWeights(x) maxScore(x) minScore(x) unitScale(x) ## S4 method for signature 'matrix' reverseComplement(x, ...)
x |
For For |
type |
The type of Position Weight Matrix, either "log2probratio" or "prob". See Details section for more information. |
prior.params |
A positive numeric vector, which represents the parameters of the Dirichlet conjugate prior, with names A, C, G, and T. See Details section for more information. |
pwm |
A Position Weight Matrix represented as a numeric matrix with row names A, C, G and T. |
subject |
Typically a DNAString object. A Views object on a DNAString subject, a MaskedDNAString object, or a single character string, are also supported. IUPAC ambiguity letters in |
min.score |
The minimum score for counting a match.
Can be given as a character string containing a percentage (e.g.
|
with.score |
|
starting.at |
An integer vector specifying the starting positions of the Position Weight Matrix relatively to the subject. |
... |
Additional arguments for methods. |
The PWM function uses a multinomial model with a Dirichlet conjugate
prior to calculate the estimated probability of base b at position i. As
mentioned in the Arguments section, prior.params supplies the
parameters for the DNA bases A, C, G, and T in the Dirichlet prior. These
values result in a position independent initial estimate of the probabilities
for the bases to be
priorProbs = prior.params/sum(prior.params) and the
posterior (data infused) estimate for the probabilities for the bases in each
of the positions to be
postProbs = (consensusMatrix(x) + prior.params)/(length(x) + sum(prior.params)).
When type = "log2probratio", the PWM = unitScale(log2(postProbs/priorProbs)).
When type = "prob", the PWM = unitScale(postProbs).
A numeric matrix representing the Position Weight Matrix for PWM.
A numeric vector containing the Position Weight Matrix-based scores
for PWMscoreStartingAt.
An XStringViews object for matchPWM.
A single integer for countPWM.
A vector containing the max weight for each position in pwm
for maxWeights.
A vector containing the min weight for each position in pwm
for minWeights.
The highest possible score for a given Position Weight Matrix for
maxScore.
The lowest possible score for a given Position Weight Matrix for
minScore.
The modified numeric matrix given by
(x - minScore(x)/ncol(x))/(maxScore(x) - minScore(x)) for
unitScale.
A PWM obtained by reverting the column order in PWM x and by
reassigning each row to its complementary nucleotide
for reverseComplement.
H. Pagès and P. Aboyoun
Wasserman, WW, Sandelin, A., (2004) Applied bioinformatics for the identification of regulatory elements, Nat Rev Genet., 5(4):276-87.
consensusMatrix,
matchPattern,
reverseComplement,
DNAString-class,
XStringViews-class
## Data setup: data(HNF4alpha) library(BSgenome.Dmelanogaster.UCSC.dm3) chr3R <- Dmelanogaster$chr3R chr3R ## Create a PWM from a PFM or directly from a rectangular ## DNAStringSet object: pfm <- consensusMatrix(HNF4alpha) pwm <- PWM(pfm) # same as 'PWM(HNF4alpha)' ## Perform some general routines on the PWM: round(pwm, 2) maxWeights(pwm) maxScore(pwm) reverseComplement(pwm) ## Score the first 5 positions: PWMscoreStartingAt(pwm, chr3R, starting.at=1:5) ## Match the plus strand: hits <- matchPWM(pwm, chr3R) nhit <- countPWM(pwm, chr3R) # same as 'length(hits)' ## Use 'with.score=TRUE' to get the scores of the hits: hits <- matchPWM(pwm, chr3R, with.score=TRUE) head(mcols(hits)$score) min(mcols(hits)$score / maxScore(pwm)) # should be >= 0.8 ## The scores can also easily be post-calculated: scores <- PWMscoreStartingAt(pwm, subject(hits), start(hits)) ## Match the minus strand: matchPWM(reverseComplement(pwm), chr3R)## Data setup: data(HNF4alpha) library(BSgenome.Dmelanogaster.UCSC.dm3) chr3R <- Dmelanogaster$chr3R chr3R ## Create a PWM from a PFM or directly from a rectangular ## DNAStringSet object: pfm <- consensusMatrix(HNF4alpha) pwm <- PWM(pfm) # same as 'PWM(HNF4alpha)' ## Perform some general routines on the PWM: round(pwm, 2) maxWeights(pwm) maxScore(pwm) reverseComplement(pwm) ## Score the first 5 positions: PWMscoreStartingAt(pwm, chr3R, starting.at=1:5) ## Match the plus strand: hits <- matchPWM(pwm, chr3R) nhit <- countPWM(pwm, chr3R) # same as 'length(hits)' ## Use 'with.score=TRUE' to get the scores of the hits: hits <- matchPWM(pwm, chr3R, with.score=TRUE) head(mcols(hits)$score) min(mcols(hits)$score / maxScore(pwm)) # should be >= 0.8 ## The scores can also easily be post-calculated: scores <- PWMscoreStartingAt(pwm, subject(hits), start(hits)) ## Match the minus strand: matchPWM(reverseComplement(pwm), chr3R)
The MIndex class is the basic container for storing the matches of a set of patterns in a subject sequence.
An MIndex object contains the matches (start/end locations) of a set of patterns found in an XString object called "the subject string" or "the subject sequence" or simply "the subject".
matchPDict function returns an MIndex object.
In the code snippets below, x is an MIndex object.
length(x):The number of patterns that matches are stored for.
names(x):The names of the patterns that matches are stored for.
startIndex(x):A list containing the starting positions of the matches for each pattern.
endIndex(x):A list containing the ending positions of the matches for each pattern.
elementNROWS(x):An integer vector containing the number of matches for each pattern.
In the code snippets below, x is an MIndex object.
x[[i]]:Extract the matches for the i-th pattern as an IRanges object.
In the code snippets below, x is an MIndex object.
as(x, "CompressedIRangesList"):Turns x into an
CompressedIRangesList object.
This coercion changes x from one
IntegerRangesList
subtype to another with the underlying
IntegerRanges values remaining unchanged.
In the code snippets below,
x and mindex are MIndex objects
and subject is the XString object
containing the sequence in which the matches were found.
unlist(x, recursive=TRUE, use.names=TRUE):Return all the matches in a single
IRanges object.
recursive and use.names are ignored.
extractAllMatches(subject, mindex):Return all the matches in a single XStringViews object.
H. Pagès
matchPDict,
PDict-class,
IRanges-class,
XStringViews-class
## See ?matchPDict and ?`matchPDict-inexact` for some examples.## See ?matchPDict and ?`matchPDict-inexact` for some examples.
Some miscellaneous stuff.
N50(csizes)N50(csizes)
csizes |
A vector containing the contig sizes. |
N50: The N50 value as an integer.
Definition The N50 contig size of an assembly (aka the N50 value) is the size of the largest contig such that the contigs larger than that have at least 50% the bases of the assembly.
How is it calculated? It is calculated by adding the sizes of the biggest contigs until you reach half the total size of the contigs. The N50 value is then the size of the contig that was added last (i.e. the smallest of the big contigs covering 50% of the genome).
What for? The N50 value is a standard measure of the quality of a de novo assembly.
Nicolas Delhomme <[email protected]>
# Generate 10 random contigs of sizes comprised between 100 and 10000: my.contig <- DNAStringSet( sapply( sample(c(100:10000), 10), function(size) paste(sample(DNA_BASES, size, replace=TRUE), collapse="") ) ) # Get their sizes: my.size <- width(my.contig) # Calculate the N50 value of this set of contigs: my.contig.N50 <- N50(my.size)# Generate 10 random contigs of sizes comprised between 100 and 10000: my.contig <- DNAStringSet( sapply( sample(c(100:10000), 10), function(size) paste(sample(DNA_BASES, size, replace=TRUE), collapse="") ) ) # Get their sizes: my.size <- width(my.contig) # Calculate the N50 value of this set of contigs: my.contig.N50 <- N50(my.size)
The MultipleAlignment class is a container for storing multiple sequence alignments.
## Constructors: DNAMultipleAlignment(x=character(), start=NA, end=NA, width=NA, use.names=TRUE, rowmask=NULL, colmask=NULL) RNAMultipleAlignment(x=character(), start=NA, end=NA, width=NA, use.names=TRUE, rowmask=NULL, colmask=NULL) AAMultipleAlignment(x=character(), start=NA, end=NA, width=NA, use.names=TRUE, rowmask=NULL, colmask=NULL) ## Read functions: readDNAMultipleAlignment(filepath, format) readRNAMultipleAlignment(filepath, format) readAAMultipleAlignment(filepath, format) ## Write funtions: write.phylip(x, filepath) ## ... and more (see below)## Constructors: DNAMultipleAlignment(x=character(), start=NA, end=NA, width=NA, use.names=TRUE, rowmask=NULL, colmask=NULL) RNAMultipleAlignment(x=character(), start=NA, end=NA, width=NA, use.names=TRUE, rowmask=NULL, colmask=NULL) AAMultipleAlignment(x=character(), start=NA, end=NA, width=NA, use.names=TRUE, rowmask=NULL, colmask=NULL) ## Read functions: readDNAMultipleAlignment(filepath, format) readRNAMultipleAlignment(filepath, format) readAAMultipleAlignment(filepath, format) ## Write funtions: write.phylip(x, filepath) ## ... and more (see below)
x |
Either a character vector (with no NAs), or an XString, XStringSet or XStringViews object containing strings with the same number of characters. If writing out a Phylip file, then x would be a MultipleAlignment object |
start, end, width
|
Either |
use.names |
|
filepath |
A character vector (of arbitrary length when reading, of length 1
when writing) containing the paths to the files to read or write.
Note that special values like |
format |
Either |
rowmask |
a NormalIRanges object that will set masking for rows |
colmask |
a NormalIRanges object that will set masking for columns |
The MultipleAlignment class is designed to hold and represent multiple sequence alignments. The rows and columns within an alignment can be masked for ad hoc analyses.
In the code snippets below, x is a MultipleAlignment object.
unmasked(x):The underlying XStringSet object containing the multiple sequence alignment.
rownames(x):NULL or a character vector of the same length as x
containing a short user-provided description or comment for each
sequence in x.
rowmask(x), rowmask(x, append, invert) <- value:Gets and sets the NormalIRanges object representing the
masked rows in x. The append argument takes
union, replace or intersect to indicate how
to combine the new value with rowmask(x). The
invert argument takes a logical argument to indicate
whether or not to invert the new mask. The value argument
can be of any class that is coercible to a NormalIRanges
via the as function.
colmask(x), colmask(x, append, invert) <- value:Gets and sets the NormalIRanges object representing the
masked columns in x. The append argument takes
union, replace or intersect to indicate how
to combine the new value with colmask(x). The
invert argument takes a logical argument to indicate
whether or not to invert the new mask. The value argument
can be of any class that is coercible to a NormalIRanges
via the as function.
maskMotif(x, motif, min.block.width=1, ...):Returns a MultipleAlignment object with a modified column mask based upon motifs found in the consensus string where the consensus string keeps all the columns but drops the masked rows.
The motif to mask.
The minimum width of the blocks to mask.
Additional arguments for matchPattern.
maskGaps(x, min.fraction, min.block.width):Returns a MultipleAlignment object with a modified column mask
based upon gaps in the columns. In particular, this mask is defined
by min.block.width or more consecutive columns that have
min.fraction or more of their non-masked rows containing
gap codes.
A value in [0, 1] that indicates
the minimum fraction needed to call a gap in the consensus string
(default is 0.5).
A positive integer that indicates the
minimum number of consecutive gaps to mask, as defined by
min.fraction (default is 4).
nrow(x):Returns the number of sequences aligned in x.
ncol(x):Returns the number of characters for each alignment in x.
dim(x):Equivalent to c(nrow(x), ncol(x)).
maskednrow(x):Returns the number of masked aligned sequences in x.
maskedncol(x):Returns the number of masked aligned characters in x.
maskeddim(x):Equivalent to c(maskednrow(x), maskedncol(x)).
maskedratio(x):Equivalent to maskeddim(x) / dim(x).
nchar(x):Returns the number of unmasked aligned characters in x,
i.e. ncol(x) - maskedncol(x).
alphabet(x):Equivalent to alphabet(unmasked(x)).
In the code snippets below, x is a MultipleAlignment object.
as(from, "DNAStringSet"), as(from, "RNAStringSet"),
as(from, "AAStringSet"), as(from, "BStringSet"):Creates an instance of the specified XStringSet object subtype
that contains the unmasked regions of the multiple sequence alignment
in x.
as.character(x, use.names):Convert x to a character vector containing the unmasked
regions of the multiple sequence alignment. use.names
controls whether or not rownames(x) should be used to set
the names of the returned vector (default is TRUE).
as.matrix(x, use.names):Returns a character matrix containing the "exploded" representation
of the unmasked regions of the multiple sequence alignment.
use.names controls whether or not rownames(x) should
be used to set the row names of the returned matrix (default is
TRUE).
In the code snippets below, x is a MultipleAlignment object.
consensusMatrix(x, as.prob, baseOnly):Creates an integer matrix containing the column frequencies of
the underlying alphabet with masked columns being represented
with NA values. If as.prob is TRUE, then
probabilities are reported, otherwise counts are reported (the
default). If baseOnly is TRUE, then the non-base
letters are collapsed into an "other" category.
consensusString(x, ...):Creates a consensus string for x with the symbol "#"
representing a masked column. See consensusString
for details on the arguments.
consensusViews(x, ...):Similar to the consensusString method. It returns a
XStringViews on the consensus string containing subsequence
contigs of non-masked columns. Unlike the consensusString
method, the masked columns in the underlying string contain a
consensus value rather than the "#" symbol.
alphabetFrequency(x, as.prob, collapse):Creates an integer matrix containing the row frequencies of
the underlying alphabet. If as.prob is TRUE, then
probabilities are reported, otherwise counts are reported (the
default). If collapse is TRUE, then returns the
overall frequency instead of the frequency by row.
detail(x, invertColMask, hideMaskedCols): Allows for a full
pager driven display of the object so that masked cols and rows
can be removed and the entire sequence can be visually
inspected. If hideMaskedCols is set to it's default value
of TRUE then the output will hide all the the masked
columns in the output. Otherwise, all columns will be displayed
along with a row to indicate the masking status. If
invertColMask is TRUE then any displayed mask will
be flipped so as to represent things in a way consistent with
Phylip style files instead of the mask that is actually stored in
the MultipleAlignment object. Please notice that
invertColMask will be ignored if hideMaskedCols is
set to its default value of TRUE since in that case it will
not make sense to show any masking information in the output.
Masked rows are always hidden in the output.
The letters in a DNAMultipleAlignment or RNAMultipleAlignment object
are colored when displayed by the show() method. Set global
option Biostrings.coloring to FALSE to turn off this coloring.
P. Aboyoun and M. Carlson
XStringSet-class, MaskedXString-class
## create an object from file origMAlign <- readDNAMultipleAlignment(filepath = system.file("extdata", "msx2_mRNA.aln", package="Biostrings"), format="clustal") ## list the names of the sequences in the alignment rownames(origMAlign) ## rename the sequences to be the underlying species for MSX2 rownames(origMAlign) <- c("Human","Chimp","Cow","Mouse","Rat", "Dog","Chicken","Salmon") origMAlign ## See a detailed pager view if (interactive()) { detail(origMAlign) } ## operations to mask rows ## For columns, just use colmask() and do the same kinds of operations rowMasked <- origMAlign rowmask(rowMasked) <- IRanges(start=1,end=3) rowMasked ## remove rowumn masks rowmask(rowMasked) <- NULL rowMasked ## "select" rows of interest rowmask(rowMasked, invert=TRUE) <- IRanges(start=4,end=7) rowMasked ## or mask the rows that intersect with masked rows rowmask(rowMasked, append="intersect") <- IRanges(start=1,end=5) rowMasked ## TATA-masked tataMasked <- maskMotif(origMAlign, "TATA") colmask(tataMasked) ## automatically mask rows based on consecutive gaps autoMasked <- maskGaps(origMAlign, min.fraction=0.5, min.block.width=4) colmask(autoMasked) autoMasked ## calculate frequencies alphabetFrequency(autoMasked) consensusMatrix(autoMasked, baseOnly=TRUE)[, 84:90] ## get consensus values consensusString(autoMasked) consensusViews(autoMasked) ## cluster the masked alignments library(pwalign) sdist <- pwalign::stringDist(as(autoMasked,"DNAStringSet"), method="hamming") clust <- hclust(sdist, method = "single") plot(clust) fourgroups <- cutree(clust, 4) fourgroups ## write out the alignement object (with current masks) to Phylip format write.phylip(x = autoMasked, filepath = tempfile("foo.txt",tempdir()))## create an object from file origMAlign <- readDNAMultipleAlignment(filepath = system.file("extdata", "msx2_mRNA.aln", package="Biostrings"), format="clustal") ## list the names of the sequences in the alignment rownames(origMAlign) ## rename the sequences to be the underlying species for MSX2 rownames(origMAlign) <- c("Human","Chimp","Cow","Mouse","Rat", "Dog","Chicken","Salmon") origMAlign ## See a detailed pager view if (interactive()) { detail(origMAlign) } ## operations to mask rows ## For columns, just use colmask() and do the same kinds of operations rowMasked <- origMAlign rowmask(rowMasked) <- IRanges(start=1,end=3) rowMasked ## remove rowumn masks rowmask(rowMasked) <- NULL rowMasked ## "select" rows of interest rowmask(rowMasked, invert=TRUE) <- IRanges(start=4,end=7) rowMasked ## or mask the rows that intersect with masked rows rowmask(rowMasked, append="intersect") <- IRanges(start=1,end=5) rowMasked ## TATA-masked tataMasked <- maskMotif(origMAlign, "TATA") colmask(tataMasked) ## automatically mask rows based on consecutive gaps autoMasked <- maskGaps(origMAlign, min.fraction=0.5, min.block.width=4) colmask(autoMasked) autoMasked ## calculate frequencies alphabetFrequency(autoMasked) consensusMatrix(autoMasked, baseOnly=TRUE)[, 84:90] ## get consensus values consensusString(autoMasked) consensusViews(autoMasked) ## cluster the masked alignments library(pwalign) sdist <- pwalign::stringDist(as(autoMasked,"DNAStringSet"), method="hamming") clust <- hclust(sdist, method = "single") plot(clust) fourgroups <- cutree(clust, 4) fourgroups ## write out the alignement object (with current masks) to Phylip format write.phylip(x = autoMasked, filepath = tempfile("foo.txt",tempdir()))
Given a DNA or RNA sequence (or a set of DNA or RNA sequences),
the oligonucleotideFrequency function computes the frequency
of all possible oligonucleotides of a given length (called the "width"
in this particular context) in a sliding window that is shifted
step nucleotides at a time.
The dinucleotideFrequency and trinucleotideFrequency
functions are convenient wrappers for calling oligonucleotideFrequency
with width=2 and width=3, respectively.
The nucleotideFrequencyAt function computes the frequency
of the short sequences formed by extracting the nucleotides found
at some fixed positions from each sequence of a set of DNA or RNA
sequences.
In this man page we call "DNA input" (or "RNA input") an XString, XStringSet, XStringViews or MaskedXString object of base type DNA (or RNA).
oligonucleotideFrequency(x, width, step=1, as.prob=FALSE, as.array=FALSE, fast.moving.side="right", with.labels=TRUE, ...) ## S4 method for signature 'XStringSet' oligonucleotideFrequency(x, width, step=1, as.prob=FALSE, as.array=FALSE, fast.moving.side="right", with.labels=TRUE, simplify.as="matrix") dinucleotideFrequency(x, step=1, as.prob=FALSE, as.matrix=FALSE, fast.moving.side="right", with.labels=TRUE, ...) trinucleotideFrequency(x, step=1, as.prob=FALSE, as.array=FALSE, fast.moving.side="right", with.labels=TRUE, ...) nucleotideFrequencyAt(x, at, as.prob=FALSE, as.array=TRUE, fast.moving.side="right", with.labels=TRUE, ...) ## Some related functions: oligonucleotideTransitions(x, left=1, right=1, as.prob=FALSE) mkAllStrings(alphabet, width, fast.moving.side="right")oligonucleotideFrequency(x, width, step=1, as.prob=FALSE, as.array=FALSE, fast.moving.side="right", with.labels=TRUE, ...) ## S4 method for signature 'XStringSet' oligonucleotideFrequency(x, width, step=1, as.prob=FALSE, as.array=FALSE, fast.moving.side="right", with.labels=TRUE, simplify.as="matrix") dinucleotideFrequency(x, step=1, as.prob=FALSE, as.matrix=FALSE, fast.moving.side="right", with.labels=TRUE, ...) trinucleotideFrequency(x, step=1, as.prob=FALSE, as.array=FALSE, fast.moving.side="right", with.labels=TRUE, ...) nucleotideFrequencyAt(x, at, as.prob=FALSE, as.array=TRUE, fast.moving.side="right", with.labels=TRUE, ...) ## Some related functions: oligonucleotideTransitions(x, left=1, right=1, as.prob=FALSE) mkAllStrings(alphabet, width, fast.moving.side="right")
x |
Any DNA or RNA input for the An XStringSet or XStringViews object of base type DNA or RNA
for |
width |
The number of nucleotides per oligonucleotide for
The number of letters per string for |
step |
How many nucleotides should the window be shifted before counting the next
oligonucleotide (i.e. the sliding window step; default 1).
If |
at |
An integer vector containing the positions to look at in each element
of |
as.prob |
If |
as.array, as.matrix
|
Controls the "shape" of the returned object.
If |
fast.moving.side |
Which side of the strings should move fastest?
Note that, when |
with.labels |
If |
... |
Further arguments to be passed to or from other methods. |
simplify.as |
Together with the |
left, right
|
The number of nucleotides per oligonucleotide for the rows
and columns respectively in the transition matrix created
by |
alphabet |
The alphabet to use to make the strings. |
If x is an XString or MaskedXString object,
the *Frequency functions return a numeric vector of length
4^width. If as.array (or as.matrix) is TRUE,
then this vector is formatted as an array (or matrix).
If x is an XStringSet or XStringViews object,
the returned object has the shape specified by the simplify.as
argument.
H. Pagès and P. Aboyoun; K. Vlahovicek for the step argument
alphabetFrequency,
alphabet,
hasLetterAt,
XString-class,
XStringSet-class,
XStringViews-class,
MaskedXString-class,
GENETIC_CODE,
AMINO_ACID_CODE,
reverseComplement,
rev
## --------------------------------------------------------------------- ## A. BASIC *Frequency() EXAMPLES ## --------------------------------------------------------------------- data(yeastSEQCHR1) yeast1 <- DNAString(yeastSEQCHR1) dinucleotideFrequency(yeast1) trinucleotideFrequency(yeast1) oligonucleotideFrequency(yeast1, 4) ## Get the counts of tetranucleotides overlapping by one nucleotide: oligonucleotideFrequency(yeast1, 4, step=3) ## Get the counts of adjacent tetranucleotides, starting from the first ## nucleotide: oligonucleotideFrequency(yeast1, 4, step=4) ## Subset the sequence to change the starting nucleotide (here we start ## counting from third nucleotide): yeast2 <- subseq(yeast1, start=3) oligonucleotideFrequency(yeast2, 4, step=4) ## Get the less and most represented 6-mers: f6 <- oligonucleotideFrequency(yeast1, 6) f6[f6 == min(f6)] f6[f6 == max(f6)] ## Get the result as an array: tri <- trinucleotideFrequency(yeast1, as.array=TRUE) tri["A", "A", "C"] # == trinucleotideFrequency(yeast1)["AAC"] tri["T", , ] # frequencies of trinucleotides starting with a "T" ## With input made of multiple sequences: library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) dfmat <- dinucleotideFrequency(probes) # a big matrix dinucleotideFrequency(probes, simplify.as="collapsed") dinucleotideFrequency(probes, simplify.as="collapsed", as.matrix=TRUE) ## --------------------------------------------------------------------- ## B. OBSERVED DINUCLEOTIDE FREQUENCY VERSUS EXPECTED DINUCLEOTIDE ## FREQUENCY ## --------------------------------------------------------------------- ## The expected frequency of dinucleotide "ab" based on the frequencies ## of its individual letters "a" and "b" is: ## exp_Fab = Fa * Fb / N if the 2 letters are different (e.g. CG) ## exp_Faa = Fa * (Fa-1) / N if the 2 letters are the same (e.g. TT) ## where Fa and Fb are the frequencies of "a" and "b" (respectively) and ## N the length of the sequence. ## Here is a simple function that implements the above formula for a ## DNAString object 'x'. The expected frequencies are returned in a 4x4 ## matrix where the rownames and colnames correspond to the 1st and 2nd ## base in the dinucleotide: expectedDinucleotideFrequency <- function(x) { # Individual base frequencies. bf <- alphabetFrequency(x, baseOnly=TRUE)[DNA_BASES] (as.matrix(bf) %*% t(bf) - diag(bf)) / length(x) } ## On Celegans chrI: library(BSgenome.Celegans.UCSC.ce2) chrI <- Celegans$chrI obs_df <- dinucleotideFrequency(chrI, as.matrix=TRUE) obs_df # CG has the lowest frequency exp_df <- expectedDinucleotideFrequency(chrI) ## A sanity check: stopifnot(as.integer(sum(exp_df)) == sum(obs_df)) ## Ratio of observed frequency to expected frequency: obs_df / exp_df # TA has the lowest ratio, not CG! ## --------------------------------------------------------------------- ## C. nucleotideFrequencyAt() ## --------------------------------------------------------------------- nucleotideFrequencyAt(probes, 13) nucleotideFrequencyAt(probes, c(13, 20)) nucleotideFrequencyAt(probes, c(13, 20), as.array=FALSE) ## nucleotideFrequencyAt() can be used to answer questions like: "how ## many probes in the drosophila2 chip have T, G, T, A at position ## 2, 4, 13 and 20, respectively?" nucleotideFrequencyAt(probes, c(2, 4, 13, 20))["T", "G", "T", "A"] ## or "what's the probability to have an A at position 25 if there is ## one at position 13?" nf <- nucleotideFrequencyAt(probes, c(13, 25)) sum(nf["A", "A"]) / sum(nf["A", ]) ## Probabilities to have other bases at position 25 if there is an A ## at position 13: sum(nf["A", "C"]) / sum(nf["A", ]) # C sum(nf["A", "G"]) / sum(nf["A", ]) # G sum(nf["A", "T"]) / sum(nf["A", ]) # T ## See ?hasLetterAt for another way to get those results. ## --------------------------------------------------------------------- ## D. oligonucleotideTransitions() ## --------------------------------------------------------------------- ## Get nucleotide transition matrices for yeast1 oligonucleotideTransitions(yeast1) oligonucleotideTransitions(yeast1, 2, as.prob=TRUE) ## --------------------------------------------------------------------- ## E. ADVANCED *Frequency() EXAMPLES ## --------------------------------------------------------------------- ## Note that when dropping the dimensions of the 'tri' array, elements ## in the resulting vector are ordered as if they were obtained with ## 'fast.moving.side="left"': triL <- trinucleotideFrequency(yeast1, fast.moving.side="left") all(as.vector(tri) == triL) # TRUE ## Convert the trinucleotide frequency into the amino acid frequency ## based on translation: tri1 <- trinucleotideFrequency(yeast1) names(tri1) <- GENETIC_CODE[names(tri1)] sapply(split(tri1, names(tri1)), sum) # 12512 occurrences of the stop codon ## When the returned vector is very long (e.g. width >= 10), using ## 'with.labels=FALSE' can improve performance significantly. ## Here for example, the observed speed up is between 25x and 500x: f12 <- oligonucleotideFrequency(yeast1, 12, with.labels=FALSE) # very fast! ## With the use of 'step', trinucleotideFrequency() is a very fast way to ## calculate the codon usage table in an ORF (or a set of ORFs). ## Taking the same example as in '?codons': file <- system.file("extdata", "someORF.fa", package="Biostrings") my_ORFs <- readDNAStringSet(file) ## Strip flanking 1000 nucleotides around each ORF and remove first ## sequence as it contains an intron: my_ORFs <- DNAStringSet(my_ORFs, start=1001, end=-1001)[-1] ## Codon usage for each ORF: codon_usage <- trinucleotideFrequency(my_ORFs, step=3) ## Codon usage across all ORFs: global_codon_usage <- trinucleotideFrequency(my_ORFs, step=3, simplify.as="collapsed") stopifnot(all(colSums(codon_usage) == global_codon_usage)) # sanity check ## Some related functions: dict1 <- mkAllStrings(LETTERS[1:3], 4) dict2 <- mkAllStrings(LETTERS[1:3], 4, fast.moving.side="left") stopifnot(identical(reverse(dict1), dict2))## --------------------------------------------------------------------- ## A. BASIC *Frequency() EXAMPLES ## --------------------------------------------------------------------- data(yeastSEQCHR1) yeast1 <- DNAString(yeastSEQCHR1) dinucleotideFrequency(yeast1) trinucleotideFrequency(yeast1) oligonucleotideFrequency(yeast1, 4) ## Get the counts of tetranucleotides overlapping by one nucleotide: oligonucleotideFrequency(yeast1, 4, step=3) ## Get the counts of adjacent tetranucleotides, starting from the first ## nucleotide: oligonucleotideFrequency(yeast1, 4, step=4) ## Subset the sequence to change the starting nucleotide (here we start ## counting from third nucleotide): yeast2 <- subseq(yeast1, start=3) oligonucleotideFrequency(yeast2, 4, step=4) ## Get the less and most represented 6-mers: f6 <- oligonucleotideFrequency(yeast1, 6) f6[f6 == min(f6)] f6[f6 == max(f6)] ## Get the result as an array: tri <- trinucleotideFrequency(yeast1, as.array=TRUE) tri["A", "A", "C"] # == trinucleotideFrequency(yeast1)["AAC"] tri["T", , ] # frequencies of trinucleotides starting with a "T" ## With input made of multiple sequences: library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) dfmat <- dinucleotideFrequency(probes) # a big matrix dinucleotideFrequency(probes, simplify.as="collapsed") dinucleotideFrequency(probes, simplify.as="collapsed", as.matrix=TRUE) ## --------------------------------------------------------------------- ## B. OBSERVED DINUCLEOTIDE FREQUENCY VERSUS EXPECTED DINUCLEOTIDE ## FREQUENCY ## --------------------------------------------------------------------- ## The expected frequency of dinucleotide "ab" based on the frequencies ## of its individual letters "a" and "b" is: ## exp_Fab = Fa * Fb / N if the 2 letters are different (e.g. CG) ## exp_Faa = Fa * (Fa-1) / N if the 2 letters are the same (e.g. TT) ## where Fa and Fb are the frequencies of "a" and "b" (respectively) and ## N the length of the sequence. ## Here is a simple function that implements the above formula for a ## DNAString object 'x'. The expected frequencies are returned in a 4x4 ## matrix where the rownames and colnames correspond to the 1st and 2nd ## base in the dinucleotide: expectedDinucleotideFrequency <- function(x) { # Individual base frequencies. bf <- alphabetFrequency(x, baseOnly=TRUE)[DNA_BASES] (as.matrix(bf) %*% t(bf) - diag(bf)) / length(x) } ## On Celegans chrI: library(BSgenome.Celegans.UCSC.ce2) chrI <- Celegans$chrI obs_df <- dinucleotideFrequency(chrI, as.matrix=TRUE) obs_df # CG has the lowest frequency exp_df <- expectedDinucleotideFrequency(chrI) ## A sanity check: stopifnot(as.integer(sum(exp_df)) == sum(obs_df)) ## Ratio of observed frequency to expected frequency: obs_df / exp_df # TA has the lowest ratio, not CG! ## --------------------------------------------------------------------- ## C. nucleotideFrequencyAt() ## --------------------------------------------------------------------- nucleotideFrequencyAt(probes, 13) nucleotideFrequencyAt(probes, c(13, 20)) nucleotideFrequencyAt(probes, c(13, 20), as.array=FALSE) ## nucleotideFrequencyAt() can be used to answer questions like: "how ## many probes in the drosophila2 chip have T, G, T, A at position ## 2, 4, 13 and 20, respectively?" nucleotideFrequencyAt(probes, c(2, 4, 13, 20))["T", "G", "T", "A"] ## or "what's the probability to have an A at position 25 if there is ## one at position 13?" nf <- nucleotideFrequencyAt(probes, c(13, 25)) sum(nf["A", "A"]) / sum(nf["A", ]) ## Probabilities to have other bases at position 25 if there is an A ## at position 13: sum(nf["A", "C"]) / sum(nf["A", ]) # C sum(nf["A", "G"]) / sum(nf["A", ]) # G sum(nf["A", "T"]) / sum(nf["A", ]) # T ## See ?hasLetterAt for another way to get those results. ## --------------------------------------------------------------------- ## D. oligonucleotideTransitions() ## --------------------------------------------------------------------- ## Get nucleotide transition matrices for yeast1 oligonucleotideTransitions(yeast1) oligonucleotideTransitions(yeast1, 2, as.prob=TRUE) ## --------------------------------------------------------------------- ## E. ADVANCED *Frequency() EXAMPLES ## --------------------------------------------------------------------- ## Note that when dropping the dimensions of the 'tri' array, elements ## in the resulting vector are ordered as if they were obtained with ## 'fast.moving.side="left"': triL <- trinucleotideFrequency(yeast1, fast.moving.side="left") all(as.vector(tri) == triL) # TRUE ## Convert the trinucleotide frequency into the amino acid frequency ## based on translation: tri1 <- trinucleotideFrequency(yeast1) names(tri1) <- GENETIC_CODE[names(tri1)] sapply(split(tri1, names(tri1)), sum) # 12512 occurrences of the stop codon ## When the returned vector is very long (e.g. width >= 10), using ## 'with.labels=FALSE' can improve performance significantly. ## Here for example, the observed speed up is between 25x and 500x: f12 <- oligonucleotideFrequency(yeast1, 12, with.labels=FALSE) # very fast! ## With the use of 'step', trinucleotideFrequency() is a very fast way to ## calculate the codon usage table in an ORF (or a set of ORFs). ## Taking the same example as in '?codons': file <- system.file("extdata", "someORF.fa", package="Biostrings") my_ORFs <- readDNAStringSet(file) ## Strip flanking 1000 nucleotides around each ORF and remove first ## sequence as it contains an intron: my_ORFs <- DNAStringSet(my_ORFs, start=1001, end=-1001)[-1] ## Codon usage for each ORF: codon_usage <- trinucleotideFrequency(my_ORFs, step=3) ## Codon usage across all ORFs: global_codon_usage <- trinucleotideFrequency(my_ORFs, step=3, simplify.as="collapsed") stopifnot(all(colSums(codon_usage) == global_codon_usage)) # sanity check ## Some related functions: dict1 <- mkAllStrings(LETTERS[1:3], 4) dict2 <- mkAllStrings(LETTERS[1:3], 4, fast.moving.side="left") stopifnot(identical(reverse(dict1), dict2))
padAndClip first conceptually pads the supplied strings with an
infinite number of padding letters on both sides, then clip them.
stackStrings is a convenience wrapper to padAndClip
that turns a variable-width set of strings into a rectangular
(i.e. constant-width) set, by padding and clipping the strings,
after conceptually shifting them horizontally.
padAndClip(x, views, Lpadding.letter=" ", Rpadding.letter=" ", remove.out.of.view.strings=FALSE) stackStrings(x, from, to, shift=0L, Lpadding.letter=" ", Rpadding.letter=" ", remove.out.of.view.strings=FALSE)padAndClip(x, views, Lpadding.letter=" ", Rpadding.letter=" ", remove.out.of.view.strings=FALSE) stackStrings(x, from, to, shift=0L, Lpadding.letter=" ", Rpadding.letter=" ", remove.out.of.view.strings=FALSE)
x |
An XStringSet object containing the strings to pad and clip. |
views |
A IntegerRanges object (recycled to the length of
|
Lpadding.letter, Rpadding.letter
|
A single letter to use for padding on the left, and another one to
use for padding on the right. Note that the default letter ( |
remove.out.of.view.strings |
|
from, to
|
Another way to specify the region to keep for each string, but with
the restriction that |
shift |
An integer vector (recycled to the length of |
For padAndClip: An XStringSet object.
If remove.out.of.view.strings is FALSE, it has the same
length and names as x, and its "shape", which is described by the
integer vector returned by width(), is the same as the shape of the
views argument after recycling.
The class of the returned object is the direct concrete subclass of
XStringSet that x belongs to or derives from.
There are 4 direct concrete subclasses of the XStringSet virtual
class: BStringSet, DNAStringSet, RNAStringSet,
and AAStringSet. If x is an instance of one of
those classes, then the returned object has the same class as x
(i.e. in that case, padAndClip acts as an endomorphism).
But if x derives from one of those 4 classes, then the
returned object is downgraded to the class x derives from.
In that case, padAndClip does not act as an endomorphism.
For stackStrings: Same as padAndClip. In addition it is
guaranteed to have a rectangular shape i.e. to be a constant-width
XStringSet object.
H. Pagès
The stackStringsFromBam function
in the GenomicAlignments package for stacking the read
sequences (or their quality strings) stored in a BAM file on
a region of interest.
The XStringViews class to formally represent a set of views on a single string.
The extractAt and replaceAt functions
for extracting/replacing arbitrary substrings from/in a string or
set of strings.
The XStringSet class.
The IntegerRanges class in the IRanges package.
x <- BStringSet(c(seq1="ABCD", seq2="abcdefghijk", seq3="", seq4="XYZ")) padAndClip(x, IRanges(3, 8:5), Lpadding.letter=">", Rpadding.letter="<") padAndClip(x, IRanges(1:-2, 7), Lpadding.letter=">", Rpadding.letter="<") stackStrings(x, 2, 8) stackStrings(x, -2, 8, shift=c(0, -11, 6, 7), Lpadding.letter="#", Rpadding.letter=".") stackStrings(x, -2, 8, shift=c(0, -14, 6, 7), Lpadding.letter="#", Rpadding.letter=".") stackStrings(x, -2, 8, shift=c(0, -14, 6, 7), Lpadding.letter="#", Rpadding.letter=".", remove.out.of.view.strings=TRUE) library(hgu95av2probe) probes <- DNAStringSet(hgu95av2probe) probes stackStrings(probes, 0, 26, Lpadding.letter="+", Rpadding.letter="-") options(showHeadLines=15) stackStrings(probes, 3, 23, shift=6*c(1:5, -(1:5)), Lpadding.letter="+", Rpadding.letter="N", remove.out.of.view.strings=TRUE)x <- BStringSet(c(seq1="ABCD", seq2="abcdefghijk", seq3="", seq4="XYZ")) padAndClip(x, IRanges(3, 8:5), Lpadding.letter=">", Rpadding.letter="<") padAndClip(x, IRanges(1:-2, 7), Lpadding.letter=">", Rpadding.letter="<") stackStrings(x, 2, 8) stackStrings(x, -2, 8, shift=c(0, -11, 6, 7), Lpadding.letter="#", Rpadding.letter=".") stackStrings(x, -2, 8, shift=c(0, -14, 6, 7), Lpadding.letter="#", Rpadding.letter=".") stackStrings(x, -2, 8, shift=c(0, -14, 6, 7), Lpadding.letter="#", Rpadding.letter=".", remove.out.of.view.strings=TRUE) library(hgu95av2probe) probes <- DNAStringSet(hgu95av2probe) probes stackStrings(probes, 0, 26, Lpadding.letter="+", Rpadding.letter="-") options(showHeadLines=15) stackStrings(probes, 3, 23, shift=6*c(1:5, -(1:5)), Lpadding.letter="+", Rpadding.letter="N", remove.out.of.view.strings=TRUE)
The PDict class is a container for storing a preprocessed dictionary of DNA
patterns that can later be passed to the matchPDict function
for fast matching against a reference sequence (the subject).
PDict is the constructor function for creating new PDict objects.
PDict(x, max.mismatch=NA, tb.start=NA, tb.end=NA, tb.width=NA, algorithm="ACtree2", skip.invalid.patterns=FALSE)PDict(x, max.mismatch=NA, tb.start=NA, tb.end=NA, tb.width=NA, algorithm="ACtree2", skip.invalid.patterns=FALSE)
x |
A character vector, a DNAStringSet object or an XStringViews object with a DNAString subject. |
max.mismatch |
A single non-negative integer or |
tb.start, tb.end, tb.width
|
A single integer or |
algorithm |
|
skip.invalid.patterns |
This argument is not supported yet (and might in fact be replaced
by the |
THIS IS STILL WORK IN PROGRESS!
If the original dictionary x is a character vector or
an XStringViews object with a DNAString subject,
then the PDict constructor will first try to turn it
into a DNAStringSet object.
By default (i.e. if PDict is called with max.mismatch=NA,
tb.start=NA, tb.end=NA and tb.width=NA)
the following limitations apply: (1) the original dictionary can only
contain base letters (i.e. only As, Cs, Gs and Ts), therefore IUPAC
ambiguity codes are not allowed; (2) all the
patterns in the dictionary must have the same length ("constant width"
dictionary); and (3) later matchPdict can only be used with
max.mismatch=0.
A Trusted Band can be used in order to relax these limitations (see the "Trusted Band" section below).
If you are planning to use the resulting PDict object in order
to do inexact matching where valid hits are allowed to have a small
number of mismatching letters, then see the "Allowing a small number
of mismatching letters" section below.
Two preprocessing algorithms are currently supported:
algorithm="ACtree2" (the default) and algorithm="Twobit".
With the "ACtree2" algorithm, all the oligonucleotides in the
Trusted Band are stored in a 4-ary Aho-Corasick tree.
With the "Twobit" algorithm, the 2-bit-per-letter
signatures of all the oligonucleotides in the Trusted Band are computed
and the mapping from these signatures to the 1-based position of the
corresponding oligonucleotide in the Trusted Band is stored in a way that
allows very fast lookup.
Only PDict objects preprocessed with the "ACtree2" algo can then
be used with matchPdict (and family) and with fixed="pattern"
(instead of fixed=TRUE, the default), so that IUPAC ambiguity codes
in the subject are treated as ambiguities. PDict objects obtained with the
"Twobit" algo don't allow this.
See ?`matchPDict-inexact` for more information about support
of IUPAC ambiguity codes in the subject.
What's a Trusted Band?
A Trusted Band is a region defined in the original dictionary where the limitations described above will apply.
Why use a Trusted Band?
Because the limitations described above will apply to the Trusted Band only!
For example the Trusted Band cannot contain IUPAC ambiguity codes but the
"head" and the "tail" can (see below for what those are).
Also with a Trusted Band, if matchPdict is called with a non-null
max.mismatch value then mismatching letters will be allowed in the
head and the tail. Or, if matchPdict is called with
fixed="subject", then IUPAC ambiguity codes in the head and the
tail will be treated as ambiguities.
How to specify a Trusted Band?
Use the tb.start, tb.end and tb.width arguments of the
PDict constructor in order to specify a Trusted Band.
This will divide each pattern in the original dictionary into three parts:
a left part, a middle part and a right part.
The middle part is defined by its starting and ending nucleotide positions
given relatively to each pattern thru the tb.start, tb.end
and tb.width arguments. It must have the same length for all
patterns (this common length is called the width of the Trusted Band).
The left and right parts are defined implicitely: they are the
parts that remain before (prefix) and after (suffix) the middle part,
respectively.
Therefore three DNAStringSet objects result from this division:
the first one is made of all the left parts and forms the head of the PDict
object, the second one is made of all the middle parts and forms the Trusted
Band of the PDict object, and the third one is made of all the right parts
and forms the tail of the PDict object.
In other words you can think of the process of specifying a Trusted Band as drawing 2 vertical lines on the original dictionary (note that these 2 lines are not necessarily straight lines but the horizontal space between them must be constant). When doing this, you are dividing the dictionary into three regions (from left to right): the head, the Trusted Band and the tail. Each of them is a DNAStringSet object with the same number of elements than the original dictionary and the original dictionary could easily be reconstructed from those three regions.
The width of the Trusted Band must be >= 1 because Trusted Bands of width 0 are not supported.
Finally note that calling PDict with tb.start=NA,
tb.end=NA and tb.width=NA (the default) is equivalent
to calling it with tb.start=1, tb.end=-1 and
tb.width=NA, which results in a full-width Trusted Band i.e.
a Trusted Band that covers the entire dictionary (no head and no tail).
[TODO]
In the code snippets below,
x is a PDict object.
length(x):The number of patterns in x.
width(x):A vector of non-negative integers containing the number
of letters for each pattern in x.
names(x):The names of the patterns in x.
head(x):The head of x or NULL if x has no head.
tb(x):The Trusted Band defined on x.
tb.width(x):The width of the Trusted Band defined on x.
Note that, unlike width(tb(x)), this is a single integer.
And because the Trusted Band has a constant width, tb.width(x)
is in fact equivalent to unique(width(tb(x))),
or to width(tb(x))[1].
tail(x):The tail of x or NULL if x has no tail.
In the code snippets below,
x is a PDict object.
x[[i]]:Extract the i-th pattern from x as a DNAString object.
In the code snippet below,
x is a PDict object.
duplicated(x):[TODO]
patternFrequency(x):[TODO]
H. Pagès
Aho, Alfred V.; Margaret J. Corasick (June 1975). "Efficient string matching: An aid to bibliographic search". Communications of the ACM 18 (6): 333-340.
matchPDict,
DNA_ALPHABET,
IUPAC_CODE_MAP,
DNAStringSet-class,
XStringViews-class
## --------------------------------------------------------------------- ## A. NO HEAD AND NO TAIL (THE DEFAULT) ## --------------------------------------------------------------------- library(drosophila2probe) dict0 <- DNAStringSet(drosophila2probe) dict0 # The original dictionary. length(dict0) # Hundreds of thousands of patterns. unique(nchar(dict0)) # Patterns are 25-mers. pdict0 <- PDict(dict0) # Store the original dictionary in # a PDict object (preprocessing). pdict0 class(pdict0) length(pdict0) # Same as length(dict0). tb.width(pdict0) # The width of the (implicit) # Trusted Band. sum(duplicated(pdict0)) table(patternFrequency(pdict0)) # 9 patterns are repeated 3 times. pdict0[[1]] pdict0[[5]] ## --------------------------------------------------------------------- ## B. NO HEAD AND A TAIL ## --------------------------------------------------------------------- dict1 <- c("ACNG", "GT", "CGT", "AC") pdict1 <- PDict(dict1, tb.end=2) pdict1 class(pdict1) length(pdict1) width(pdict1) head(pdict1) tb(pdict1) tb.width(pdict1) width(tb(pdict1)) tail(pdict1) pdict1[[3]]## --------------------------------------------------------------------- ## A. NO HEAD AND NO TAIL (THE DEFAULT) ## --------------------------------------------------------------------- library(drosophila2probe) dict0 <- DNAStringSet(drosophila2probe) dict0 # The original dictionary. length(dict0) # Hundreds of thousands of patterns. unique(nchar(dict0)) # Patterns are 25-mers. pdict0 <- PDict(dict0) # Store the original dictionary in # a PDict object (preprocessing). pdict0 class(pdict0) length(pdict0) # Same as length(dict0). tb.width(pdict0) # The width of the (implicit) # Trusted Band. sum(duplicated(pdict0)) table(patternFrequency(pdict0)) # 9 patterns are repeated 3 times. pdict0[[1]] pdict0[[5]] ## --------------------------------------------------------------------- ## B. NO HEAD AND A TAIL ## --------------------------------------------------------------------- dict1 <- c("ACNG", "GT", "CGT", "AC") pdict1 <- PDict(dict1, tb.end=2) pdict1 class(pdict1) length(pdict1) width(pdict1) head(pdict1) tb(pdict1) tb.width(pdict1) width(tb(pdict1)) tail(pdict1) pdict1[[3]]
Predefined scoring matrices for nucleotide and amino acid alignments.
WARNING: All the BLOSUM* and PAM* scoring matrices listed below are now located in the pwalign package and will soon be removed from the Biostrings package.
data(BLOSUM45) data(BLOSUM50) data(BLOSUM62) data(BLOSUM80) data(BLOSUM100) data(PAM30) data(PAM40) data(PAM70) data(PAM120) data(PAM250)data(BLOSUM45) data(BLOSUM50) data(BLOSUM62) data(BLOSUM80) data(BLOSUM100) data(PAM30) data(PAM40) data(PAM70) data(PAM120) data(PAM250)
See ?pwalign::predefined_scoring_matrices
in the pwalign package.
See ?pwalign::predefined_scoring_matrices
in the pwalign package.
## See ?pwalign::predefined_scoring_matrices in the pwalign package.## See ?pwalign::predefined_scoring_matrices in the pwalign package.
The QualityScaledBStringSet class is a container for storing a
BStringSet object with an XStringQuality object.
Similarly, the QualityScaledDNAStringSet (or QualityScaledRNAStringSet, or
QualityScaledAAStringSet) class is a container for storing a
DNAStringSet (or RNAStringSet, or
AAStringSet) objects with an XStringQuality
object.
## Constructors: QualityScaledBStringSet(x, quality) QualityScaledDNAStringSet(x, quality) QualityScaledRNAStringSet(x, quality) QualityScaledAAStringSet(x, quality) ## Read/write a QualityScaledXStringSet object from/to a FASTQ file: readQualityScaledDNAStringSet(filepath, quality.scoring=c("phred", "solexa", "illumina"), nrec=-1L, skip=0L, seek.first.rec=FALSE, use.names=TRUE) writeQualityScaledXStringSet(x, filepath, append=FALSE, compress=FALSE, compression_level=NA)## Constructors: QualityScaledBStringSet(x, quality) QualityScaledDNAStringSet(x, quality) QualityScaledRNAStringSet(x, quality) QualityScaledAAStringSet(x, quality) ## Read/write a QualityScaledXStringSet object from/to a FASTQ file: readQualityScaledDNAStringSet(filepath, quality.scoring=c("phred", "solexa", "illumina"), nrec=-1L, skip=0L, seek.first.rec=FALSE, use.names=TRUE) writeQualityScaledXStringSet(x, filepath, append=FALSE, compress=FALSE, compression_level=NA)
x |
For the For |
quality |
An XStringQuality derivative. |
filepath, nrec, skip, seek.first.rec, use.names, append, compress, compression_level
|
See |
quality.scoring |
Specify the quality scoring used in the FASTQ file. Must be one of
|
The QualityScaledBStringSet, QualityScaledDNAStringSet,
QualityScaledRNAStringSet and QualityScaledAAStringSet
functions are constructors that can be used to "naturally" turn
x into an QualityScaledXStringSet object of the desired base type.
The QualityScaledXStringSet class derives from the XStringSet
class hence all the accessor methods defined for an XStringSet
object can also be used on an QualityScaledXStringSet object. Common
methods include (in the code snippets below, x is an
QualityScaledXStringSet object):
length(x):The number of sequences in x.
width(x):A vector of non-negative integers containing the number
of letters for each element in x.
nchar(x):The same as width(x).
names(x):NULL or a character vector of the same length as x
containing a short user-provided description or comment for each
element in x.
quality(x):The quality of the strings.
In the code snippets below,
x and values are XStringSet objects,
and i should be an index specifying the elements to extract.
x[i]:Return a new QualityScaledXStringSet object made of the selected elements.
P. Aboyoun
BStringSet, DNAStringSet, RNAStringSet, and AAStringSet objects.
XStringQuality objects.
readDNAStringSet and writeXStringSet
for reading/writing a DNAStringSet object (or other
XStringSet derivative) from/to a FASTA or FASTQ file.
## --------------------------------------------------------------------- ## QualityScaled*StringSet() CONSTRUCTORS ## --------------------------------------------------------------------- x1 <- DNAStringSet(c("TTGA", "CTCN")) q1 <- PhredQuality(c("*+,-", "6789")) qdna1 <- QualityScaledDNAStringSet(x1, q1) qdna1 ## --------------------------------------------------------------------- ## READ/WRITE A QualityScaledDNAStringSet OBJECT FROM/TO A FASTQ FILE ## --------------------------------------------------------------------- filepath <- system.file("extdata", "s_1_sequence.txt", package="Biostrings") ## By default, readQualityScaledDNAStringSet() assumes that the FASTQ ## file contains "Phred quality scores" (this is the standard Sanger ## variant to assess reliability of a base call): qdna2 <- readQualityScaledDNAStringSet(filepath) qdna2 outfile2a <- tempfile() writeQualityScaledXStringSet(qdna2, outfile2a) outfile2b <- tempfile() writeQualityScaledXStringSet(qdna2, outfile2b, compress=TRUE) ## Use 'quality.scoring="solexa"' or 'quality.scoring="illumina"' if the ## quality scores are Solexa quality scores: qdna3 <- readQualityScaledDNAStringSet(filepath, quality.scoring="solexa") qdna3 outfile3a <- tempfile() writeQualityScaledXStringSet(qdna3, outfile3a) outfile3b <- tempfile() writeQualityScaledXStringSet(qdna3, outfile3b, compress=TRUE) ## Sanity checks: stopifnot(identical(readLines(outfile2a), readLines(filepath))) stopifnot(identical(readLines(outfile2a), readLines(outfile2b))) stopifnot(identical(readLines(outfile3a), readLines(filepath))) stopifnot(identical(readLines(outfile3a), readLines(outfile3b)))## --------------------------------------------------------------------- ## QualityScaled*StringSet() CONSTRUCTORS ## --------------------------------------------------------------------- x1 <- DNAStringSet(c("TTGA", "CTCN")) q1 <- PhredQuality(c("*+,-", "6789")) qdna1 <- QualityScaledDNAStringSet(x1, q1) qdna1 ## --------------------------------------------------------------------- ## READ/WRITE A QualityScaledDNAStringSet OBJECT FROM/TO A FASTQ FILE ## --------------------------------------------------------------------- filepath <- system.file("extdata", "s_1_sequence.txt", package="Biostrings") ## By default, readQualityScaledDNAStringSet() assumes that the FASTQ ## file contains "Phred quality scores" (this is the standard Sanger ## variant to assess reliability of a base call): qdna2 <- readQualityScaledDNAStringSet(filepath) qdna2 outfile2a <- tempfile() writeQualityScaledXStringSet(qdna2, outfile2a) outfile2b <- tempfile() writeQualityScaledXStringSet(qdna2, outfile2b, compress=TRUE) ## Use 'quality.scoring="solexa"' or 'quality.scoring="illumina"' if the ## quality scores are Solexa quality scores: qdna3 <- readQualityScaledDNAStringSet(filepath, quality.scoring="solexa") qdna3 outfile3a <- tempfile() writeQualityScaledXStringSet(qdna3, outfile3a) outfile3b <- tempfile() writeQualityScaledXStringSet(qdna3, outfile3b, compress=TRUE) ## Sanity checks: stopifnot(identical(readLines(outfile2a), readLines(filepath))) stopifnot(identical(readLines(outfile2a), readLines(outfile2b))) stopifnot(identical(readLines(outfile3a), readLines(filepath))) stopifnot(identical(readLines(outfile3a), readLines(outfile3b)))
extractAt extracts multiple subsequences from XString
object x, or from the individual sequences of XStringSet
object x, at the ranges of positions specified thru at.
replaceAt performs multiple subsequence replacements (a.k.a.
substitutions) in XString object x, or in the individual
sequences of XStringSet object x, at the ranges of positions
specified thru at.
extractAt(x, at) replaceAt(x, at, value="")extractAt(x, at) replaceAt(x, at, value="")
x |
An XString or XStringSet object. |
at |
Typically a IntegerRanges object if Alternatively, the ranges can be specified with only 1 number
per range (its start position), in which case they are considered
to be empty ranges (a.k.a. zero-width ranges). So if The following applies only if
As a special case, |
value |
The replacement sequences. If If As a special case, |
For extractAt: An XStringSet object of the same length as
at if x is an XString object.
An XStringSetList object of the same length as x
(and same effective shape as at) if x is an
XStringSet object.
For replaceAt: An object of the same class as x.
If x is an XStringSet object, its length and names and
metadata columns are preserved.
Like subseq (defined and documented in the
XVector package), extractAt does not copy the sequence data!
extractAt is equivalent to extractList
(defined and documented in the IRanges package) when x is an
XString object and at a IntegerRanges object.
H. Pagès
The subseq and subseq<-
functions in the XVector package for simpler forms of
subsequence extractions and replacements.
The extractList and
unstrsplit functions defined and
documented in the IRanges package.
The replaceLetterAt function for a DNA-specific
single-letter replacement functions useful for SNP injections.
The padAndClip function for padding and clipping
strings.
The XString, XStringSet, and XStringSetList classes.
The IntegerRanges, IntegerRangesList, IntegerList, and CharacterList classes defined and documented in the IRanges package.
## --------------------------------------------------------------------- ## (A) ON AN XString OBJECT ## --------------------------------------------------------------------- x <- BString("abcdefghijklm") at1 <- IRanges(5:1, width=3) extractAt(x, at1) names(at1) <- LETTERS[22:26] extractAt(x, at1) at2 <- IRanges(c(1, 5, 12), c(3, 4, 12), names=c("X", "Y", "Z")) extractAt(x, at2) extractAt(x, rev(at2)) value <- c("+", "-", "*") replaceAt(x, at2, value=value) replaceAt(x, rev(at2), value=rev(value)) at3 <- IRanges(c(14, 1, 1, 1, 1, 11), c(13, 0, 10, 0, 0, 10)) value <- 1:6 replaceAt(x, at3, value=value) # "24536klm1" replaceAt(x, rev(at3), value=rev(value)) # "54236klm1" ## Deletions: stopifnot(replaceAt(x, at2) == "defghijkm") stopifnot(replaceAt(x, rev(at2)) == "defghijkm") stopifnot(replaceAt(x, at3) == "klm") stopifnot(replaceAt(x, rev(at3)) == "klm") ## Insertions: at4 <- IRanges(c(6, 10, 2, 5), width=0) stopifnot(replaceAt(x, at4, value="-") == "a-bcd-e-fghi-jklm") stopifnot(replaceAt(x, start(at4), value="-") == "a-bcd-e-fghi-jklm") at5 <- c(5, 1, 6, 5) # 2 insertions before position 5 replaceAt(x, at5, value=c("+", "-", "*", "/")) ## No-ops: stopifnot(replaceAt(x, NULL, value=NULL) == x) stopifnot(replaceAt(x, at2, value=extractAt(x, at2)) == x) stopifnot(replaceAt(x, at3, value=extractAt(x, at3)) == x) stopifnot(replaceAt(x, at4, value=extractAt(x, at4)) == x) stopifnot(replaceAt(x, at5, value=extractAt(x, at5)) == x) ## The order of successive transformations matters: ## T1: insert "+" before position 1 and 4 ## T2: insert "-" before position 3 ## T1 followed by T2 x2a <- replaceAt(x, c(1, 4), value="+") x3a <- replaceAt(x2a, 3, value="-") ## T2 followed by T1 x2b <- replaceAt(x, 3, value="-") x3b <- replaceAt(x2b, c(1, 4), value="+") ## T1 and T2 simultaneously: x3c <- replaceAt(x, c(1, 3, 4), value=c("+", "-", "+")) ## ==> 'x3a', 'x3b', and 'x3c' are all different! ## Append "**" to 'x3c': replaceAt(x3c, length(x3c) + 1L, value="**") ## --------------------------------------------------------------------- ## (B) ON AN XStringSet OBJECT ## --------------------------------------------------------------------- x <- BStringSet(c(seq1="ABCD", seq2="abcdefghijk", seq3="XYZ")) at6 <- IRanges(c(1, 3), width=1) extractAt(x, at=at6) unstrsplit(extractAt(x, at=at6)) at7 <- IRangesList(IRanges(c(2, 1), c(3, 0)), IRanges(c(7, 2, 12, 7), c(6, 5, 11, 8)), IRanges(2, 2)) ## Set inner names on 'at7'. unlisted_at7 <- unlist(at7) names(unlisted_at7) <- paste0("rg", sprintf("%02d", seq_along(unlisted_at7))) at7 <- relist(unlisted_at7, at7) extractAt(x, at7) # same as 'as(mapply(extractAt, x, at7), "List")' extractAt(x, at7[3]) # same as 'as(mapply(extractAt, x, at7[3]), "List")' replaceAt(x, at7, value=extractAt(x, at7)) # no-op replaceAt(x, at7) # deletions at8 <- IRangesList(IRanges(1:5, width=0), IRanges(c(6, 8, 10, 7, 2, 5), width=c(0, 2, 0, 0, 0, 0)), IRanges(c(1, 2, 1), width=c(0, 1, 0))) replaceAt(x, at8, value="-") value8 <- relist(paste0("[", seq_along(unlist(at8)), "]"), at8) replaceAt(x, at8, value=value8) replaceAt(x, at8, value=as(c("+", "-", "*"), "List")) ## Append "**" to all sequences: replaceAt(x, as(width(x) + 1L, "List"), value="**") ## --------------------------------------------------------------------- ## (C) ADVANCED EXAMPLES ## --------------------------------------------------------------------- library(hgu95av2probe) probes <- DNAStringSet(hgu95av2probe) ## Split the probes in 5-mer chunks: at <- successiveIRanges(rep(5, 5)) extractAt(probes, at) ## Replace base 13 by its complement: at <- IRanges(13, width=1) base13 <- extractAt(probes, at) base13comp <- relist(complement(unlist(base13)), base13) replaceAt(probes, at, value=base13comp) ## See ?xscat for a more efficient way to do this. ## Replace all the occurences of a given pattern with another pattern: midx <- vmatchPattern("VCGTT", probes, fixed=FALSE) matches <- extractAt(probes, midx) unlist(matches) unique(unlist(matches)) probes2 <- replaceAt(probes, midx, value="-++-") ## See strings with 2 or more susbtitutions: probes2[elementNROWS(midx) >= 2] ## 2 sanity checks: stopifnot(all(replaceAt(probes, midx, value=matches) == probes)) probes2b <- gsub("[ACG]CGTT", "-++-", as.character(probes)) stopifnot(identical(as.character(probes2), probes2b))## --------------------------------------------------------------------- ## (A) ON AN XString OBJECT ## --------------------------------------------------------------------- x <- BString("abcdefghijklm") at1 <- IRanges(5:1, width=3) extractAt(x, at1) names(at1) <- LETTERS[22:26] extractAt(x, at1) at2 <- IRanges(c(1, 5, 12), c(3, 4, 12), names=c("X", "Y", "Z")) extractAt(x, at2) extractAt(x, rev(at2)) value <- c("+", "-", "*") replaceAt(x, at2, value=value) replaceAt(x, rev(at2), value=rev(value)) at3 <- IRanges(c(14, 1, 1, 1, 1, 11), c(13, 0, 10, 0, 0, 10)) value <- 1:6 replaceAt(x, at3, value=value) # "24536klm1" replaceAt(x, rev(at3), value=rev(value)) # "54236klm1" ## Deletions: stopifnot(replaceAt(x, at2) == "defghijkm") stopifnot(replaceAt(x, rev(at2)) == "defghijkm") stopifnot(replaceAt(x, at3) == "klm") stopifnot(replaceAt(x, rev(at3)) == "klm") ## Insertions: at4 <- IRanges(c(6, 10, 2, 5), width=0) stopifnot(replaceAt(x, at4, value="-") == "a-bcd-e-fghi-jklm") stopifnot(replaceAt(x, start(at4), value="-") == "a-bcd-e-fghi-jklm") at5 <- c(5, 1, 6, 5) # 2 insertions before position 5 replaceAt(x, at5, value=c("+", "-", "*", "/")) ## No-ops: stopifnot(replaceAt(x, NULL, value=NULL) == x) stopifnot(replaceAt(x, at2, value=extractAt(x, at2)) == x) stopifnot(replaceAt(x, at3, value=extractAt(x, at3)) == x) stopifnot(replaceAt(x, at4, value=extractAt(x, at4)) == x) stopifnot(replaceAt(x, at5, value=extractAt(x, at5)) == x) ## The order of successive transformations matters: ## T1: insert "+" before position 1 and 4 ## T2: insert "-" before position 3 ## T1 followed by T2 x2a <- replaceAt(x, c(1, 4), value="+") x3a <- replaceAt(x2a, 3, value="-") ## T2 followed by T1 x2b <- replaceAt(x, 3, value="-") x3b <- replaceAt(x2b, c(1, 4), value="+") ## T1 and T2 simultaneously: x3c <- replaceAt(x, c(1, 3, 4), value=c("+", "-", "+")) ## ==> 'x3a', 'x3b', and 'x3c' are all different! ## Append "**" to 'x3c': replaceAt(x3c, length(x3c) + 1L, value="**") ## --------------------------------------------------------------------- ## (B) ON AN XStringSet OBJECT ## --------------------------------------------------------------------- x <- BStringSet(c(seq1="ABCD", seq2="abcdefghijk", seq3="XYZ")) at6 <- IRanges(c(1, 3), width=1) extractAt(x, at=at6) unstrsplit(extractAt(x, at=at6)) at7 <- IRangesList(IRanges(c(2, 1), c(3, 0)), IRanges(c(7, 2, 12, 7), c(6, 5, 11, 8)), IRanges(2, 2)) ## Set inner names on 'at7'. unlisted_at7 <- unlist(at7) names(unlisted_at7) <- paste0("rg", sprintf("%02d", seq_along(unlisted_at7))) at7 <- relist(unlisted_at7, at7) extractAt(x, at7) # same as 'as(mapply(extractAt, x, at7), "List")' extractAt(x, at7[3]) # same as 'as(mapply(extractAt, x, at7[3]), "List")' replaceAt(x, at7, value=extractAt(x, at7)) # no-op replaceAt(x, at7) # deletions at8 <- IRangesList(IRanges(1:5, width=0), IRanges(c(6, 8, 10, 7, 2, 5), width=c(0, 2, 0, 0, 0, 0)), IRanges(c(1, 2, 1), width=c(0, 1, 0))) replaceAt(x, at8, value="-") value8 <- relist(paste0("[", seq_along(unlist(at8)), "]"), at8) replaceAt(x, at8, value=value8) replaceAt(x, at8, value=as(c("+", "-", "*"), "List")) ## Append "**" to all sequences: replaceAt(x, as(width(x) + 1L, "List"), value="**") ## --------------------------------------------------------------------- ## (C) ADVANCED EXAMPLES ## --------------------------------------------------------------------- library(hgu95av2probe) probes <- DNAStringSet(hgu95av2probe) ## Split the probes in 5-mer chunks: at <- successiveIRanges(rep(5, 5)) extractAt(probes, at) ## Replace base 13 by its complement: at <- IRanges(13, width=1) base13 <- extractAt(probes, at) base13comp <- relist(complement(unlist(base13)), base13) replaceAt(probes, at, value=base13comp) ## See ?xscat for a more efficient way to do this. ## Replace all the occurences of a given pattern with another pattern: midx <- vmatchPattern("VCGTT", probes, fixed=FALSE) matches <- extractAt(probes, midx) unlist(matches) unique(unlist(matches)) probes2 <- replaceAt(probes, midx, value="-++-") ## See strings with 2 or more susbtitutions: probes2[elementNROWS(midx) >= 2] ## 2 sanity checks: stopifnot(all(replaceAt(probes, midx, value=matches) == probes)) probes2b <- gsub("[ACG]CGTT", "-++-", as.character(probes)) stopifnot(identical(as.character(probes2), probes2b))
replaceLetterAt first makes a copy of a sequence (or set of
sequences) and then replaces some of the original letters by new
letters at the specified locations.
.inplaceReplaceLetterAt is the IN PLACE version of
replaceLetterAt: it will modify the original
sequence in place i.e. without copying it first.
Note that in place modification of a sequence is fundamentally
dangerous because it alters all objects defined in your session
that make reference to the modified sequence.
NEVER use .inplaceReplaceLetterAt, unless you know what
you are doing!
replaceLetterAt(x, at, letter, if.not.extending="replace", verbose=FALSE) ## NEVER USE THIS FUNCTION! .inplaceReplaceLetterAt(x, at, letter)replaceLetterAt(x, at, letter, if.not.extending="replace", verbose=FALSE) ## NEVER USE THIS FUNCTION! .inplaceReplaceLetterAt(x, at, letter)
x |
A DNAString or rectangular DNAStringSet object. |
at |
The locations where the replacements must occur. If If |
letter |
The new letters. If If |
if.not.extending |
What to do if the new letter is not "extending" the old letter?
The new letter "extends" the old letter if both are IUPAC letters
and the new letter is as specific or less specific than the old
one (e.g. M extends A, Y extends Y, but Y doesn't extend S).
Possible values are Note that the gap ( Also note that |
verbose |
When |
.inplaceReplaceLetterAt semantic is equivalent to calling
replaceLetterAt with if.not.extending="merge"
and verbose=FALSE.
Never use .inplaceReplaceLetterAt!
It is used by the injectSNPs function
in the BSgenome package, as part of the "lazy sequence loading"
mechanism, for altering the original sequences of a
BSgenome object at "sequence-load time".
This alteration consists in injecting the IUPAC ambiguity letters
representing the SNPs into the just loaded sequence, which is the
only time where in place modification of the external data of
an XString object is safe.
A DNAString or DNAStringSet object of the same shape
(i.e. length and width) as the orignal object x
for replaceLetterAt.
H. Pagès
The replaceAt function for extracting or replacing
arbitrary subsequences from/in a sequence or set of sequences.
IUPAC_CODE_MAP for the mapping between IUPAC
nucleotide ambiguity codes and their meaning.
The chartr and injectHardMask functions.
The DNAString and DNAStringSet class.
The injectSNPs function and the
BSgenome class in the BSgenome package.
## Replace letters of a DNAString object: replaceLetterAt(DNAString("AAMAA"), c(5, 1, 3, 1), "TYNC") replaceLetterAt(DNAString("AAMAA"), c(5, 1, 3, 1), "TYNC", if.not.extending="merge") ## Replace letters of a DNAStringSet object (sorry for the totally ## artificial example with absolutely no biological meaning): library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) at <- matrix(c(TRUE, TRUE, FALSE, FALSE, FALSE, TRUE, FALSE, FALSE), nrow=length(probes), ncol=width(probes)[1], byrow=TRUE) letter_subject <- DNAString(paste(rep.int("-", width(probes)[1]), collapse="")) letter <- as(Views(letter_subject, start=1, end=rowSums(at)), "XStringSet") replaceLetterAt(probes, at, letter)## Replace letters of a DNAString object: replaceLetterAt(DNAString("AAMAA"), c(5, 1, 3, 1), "TYNC") replaceLetterAt(DNAString("AAMAA"), c(5, 1, 3, 1), "TYNC", if.not.extending="merge") ## Replace letters of a DNAStringSet object (sorry for the totally ## artificial example with absolutely no biological meaning): library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) at <- matrix(c(TRUE, TRUE, FALSE, FALSE, FALSE, TRUE, FALSE, FALSE), nrow=length(probes), ncol=width(probes)[1], byrow=TRUE) letter_subject <- DNAString(paste(rep.int("-", width(probes)[1]), collapse="")) letter <- as(Views(letter_subject, start=1, end=rowSums(at)), "XStringSet") replaceLetterAt(probes, at, letter)
Use these functions for reversing sequences and/or complementing DNA or RNA sequences.
complement(x, ...) reverseComplement(x, ...)complement(x, ...) reverseComplement(x, ...)
x |
A DNAString, RNAString,
DNAStringSet, RNAStringSet,
XStringViews (with DNAString or RNAString subject),
MaskedDNAString or MaskedRNAString object
for |
... |
Additional arguments to be passed to or from methods. |
See ?reverse for reversing an XString,
XStringSet or XStringViews object.
If x is a DNAString or RNAString object,
complement(x) returns an object where each base in x
is "complemented" i.e. A, C, G, T in a DNAString object are replaced
by T, G, C, A respectively and A, C, G, U in a RNAString object
are replaced by U, G, C, A respectively.
Letters belonging to the IUPAC Extended Genetic Alphabet are also
replaced by their complement (M <-> K, R <-> Y, S <-> S, V <-> B,
W <-> W, H <-> D, N <-> N) and the gap ("-") and hard masking
("+") letters are unchanged.
reverseComplement(x) is equivalent to reverse(complement(x))
but is faster and more memory efficient.
An object of the same class and length as the original object.
reverse,
DNAString-class,
RNAString-class,
DNAStringSet-class,
RNAStringSet-class,
XStringViews-class,
MaskedXString-class,
chartr,
findPalindromes,
IUPAC_CODE_MAP
## --------------------------------------------------------------------- ## A. SOME SIMPLE EXAMPLES ## --------------------------------------------------------------------- x <- DNAString("ACGT-YN-") reverseComplement(x) library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) probes alphabetFrequency(probes, collapse=TRUE) rcprobes <- reverseComplement(probes) rcprobes alphabetFrequency(rcprobes, collapse=TRUE) ## --------------------------------------------------------------------- ## B. OBTAINING THE MISMATCH PROBES OF A CHIP ## --------------------------------------------------------------------- pm2mm <- function(probes) { probes <- DNAStringSet(probes) subseq(probes, start=13, end=13) <- complement(subseq(probes, start=13, end=13)) probes } mmprobes <- pm2mm(probes) mmprobes alphabetFrequency(mmprobes, collapse=TRUE) ## --------------------------------------------------------------------- ## C. SEARCHING THE MINUS STRAND OF A CHROMOSOME ## --------------------------------------------------------------------- ## Applying reverseComplement() to the pattern before calling ## matchPattern() is the recommended way of searching hits on the ## minus strand of a chromosome. library(BSgenome.Dmelanogaster.UCSC.dm3) chrX <- Dmelanogaster$chrX pattern <- DNAString("ACCAACNNGGTTG") matchPattern(pattern, chrX, fixed=FALSE) # 3 hits on strand + rcpattern <- reverseComplement(pattern) rcpattern m0 <- matchPattern(rcpattern, chrX, fixed=FALSE) m0 # 5 hits on strand - ## Applying reverseComplement() to the subject instead of the pattern is not ## a good idea for 2 reasons: ## (1) Chromosome sequences are generally big and sometimes very big ## so computing the reverse complement of the positive strand will ## take time and memory proportional to its length. chrXminus <- reverseComplement(chrX) # needs to allocate 22M of memory! chrXminus ## (2) Chromosome locations are generally given relatively to the positive ## strand, even for features located in the negative strand, so after ## doing this: m1 <- matchPattern(pattern, chrXminus, fixed=FALSE) ## the start/end of the matches are now relative to the negative strand. ## You need to apply reverseComplement() again on the result if you want ## them to be relative to the positive strand: m2 <- reverseComplement(m1) # allocates 22M of memory, again! ## and finally to apply rev() to sort the matches from left to right ## (5'3' direction) like in m0: m3 <- rev(m2) # same as m0, finally! ## WARNING: Before you try the example below on human chromosome 1, be aware ## that it will require the allocation of about 500Mb of memory! if (interactive()) { library(BSgenome.Hsapiens.UCSC.hg18) chr1 <- Hsapiens$chr1 matchPattern(pattern, reverseComplement(chr1)) # DON'T DO THIS! matchPattern(reverseComplement(pattern), chr1) # DO THIS INSTEAD }## --------------------------------------------------------------------- ## A. SOME SIMPLE EXAMPLES ## --------------------------------------------------------------------- x <- DNAString("ACGT-YN-") reverseComplement(x) library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) probes alphabetFrequency(probes, collapse=TRUE) rcprobes <- reverseComplement(probes) rcprobes alphabetFrequency(rcprobes, collapse=TRUE) ## --------------------------------------------------------------------- ## B. OBTAINING THE MISMATCH PROBES OF A CHIP ## --------------------------------------------------------------------- pm2mm <- function(probes) { probes <- DNAStringSet(probes) subseq(probes, start=13, end=13) <- complement(subseq(probes, start=13, end=13)) probes } mmprobes <- pm2mm(probes) mmprobes alphabetFrequency(mmprobes, collapse=TRUE) ## --------------------------------------------------------------------- ## C. SEARCHING THE MINUS STRAND OF A CHROMOSOME ## --------------------------------------------------------------------- ## Applying reverseComplement() to the pattern before calling ## matchPattern() is the recommended way of searching hits on the ## minus strand of a chromosome. library(BSgenome.Dmelanogaster.UCSC.dm3) chrX <- Dmelanogaster$chrX pattern <- DNAString("ACCAACNNGGTTG") matchPattern(pattern, chrX, fixed=FALSE) # 3 hits on strand + rcpattern <- reverseComplement(pattern) rcpattern m0 <- matchPattern(rcpattern, chrX, fixed=FALSE) m0 # 5 hits on strand - ## Applying reverseComplement() to the subject instead of the pattern is not ## a good idea for 2 reasons: ## (1) Chromosome sequences are generally big and sometimes very big ## so computing the reverse complement of the positive strand will ## take time and memory proportional to its length. chrXminus <- reverseComplement(chrX) # needs to allocate 22M of memory! chrXminus ## (2) Chromosome locations are generally given relatively to the positive ## strand, even for features located in the negative strand, so after ## doing this: m1 <- matchPattern(pattern, chrXminus, fixed=FALSE) ## the start/end of the matches are now relative to the negative strand. ## You need to apply reverseComplement() again on the result if you want ## them to be relative to the positive strand: m2 <- reverseComplement(m1) # allocates 22M of memory, again! ## and finally to apply rev() to sort the matches from left to right ## (5'3' direction) like in m0: m3 <- rev(m2) # same as m0, finally! ## WARNING: Before you try the example below on human chromosome 1, be aware ## that it will require the allocation of about 500Mb of memory! if (interactive()) { library(BSgenome.Hsapiens.UCSC.hg18) chr1 <- Hsapiens$chr1 matchPattern(pattern, reverseComplement(chr1)) # DON'T DO THIS! matchPattern(reverseComplement(pattern), chr1) # DO THIS INSTEAD }
An RNAString object allows efficient storage and manipulation of a long RNA sequence.
The RNAString class is a direct XString subclass (with no additional slot). Therefore all functions and methods described in the XString man page also work with an RNAString object (inheritance).
Unlike the BString container that allows storage of any single string (based on a single-byte character set) the RNAString container can only store a string based on the RNA alphabet (see below). In addition, the letters stored in an RNAString object are encoded in a way that optimizes fast search algorithms.
This alphabet is the same as the DNA alphabet, except that "T"
is replaced by "U". See ?DNA_ALPHABET for more
information about the DNA alphabet.
The RNA alphabet is stored in the RNA_ALPHABET predefined constant
(character vector).
The alphabet() function returns RNA_ALPHABET when
applied to an RNAString object.
In the code snippet below,
x can be a single string (character vector of length 1),
a BString object or a DNAString object.
RNAString(x="", start=1, nchar=NA):Tries to convert x into an RNAString object by reading
nchar letters starting at position start in x.
In the code snippet below, x is an RNAString object.
alphabet(x, baseOnly=FALSE):If x is an RNAString object, then return the RNA
alphabet (see above).
See the corresponding man pages when x is a
BString, DNAString or AAString object.
The letters in an RNAString object are colored when displayed by the
show() method. Set global option Biostrings.coloring
to FALSE to turn off this coloring.
H. Pagès
The RNAStringSet class to represent a collection of RNAString objects.
RNA_BASES RNA_ALPHABET dna <- DNAString("TTGAAAA-CTC-N") rna <- RNAString(dna) rna # 'options(Biostrings.coloring=FALSE)' to turn off coloring alphabet(rna) # RNA_ALPHABET alphabet(rna, baseOnly=TRUE) # RNA_BASES ## When comparing an RNAString object with a DNAString object, ## U and T are considered equals: rna == dna # TRUERNA_BASES RNA_ALPHABET dna <- DNAString("TTGAAAA-CTC-N") rna <- RNAString(dna) rna # 'options(Biostrings.coloring=FALSE)' to turn off coloring alphabet(rna) # RNA_ALPHABET alphabet(rna, baseOnly=TRUE) # RNA_BASES ## When comparing an RNAString object with a DNAString object, ## U and T are considered equals: rna == dna # TRUE
seqinfo methods for extracting the
sequence information stored in a DNAStringSet
object.
## S4 method for signature 'DNAStringSet' seqinfo(x)## S4 method for signature 'DNAStringSet' seqinfo(x)
x |
A DNAStringSet object. |
A Seqinfo object for the 'seqinfo' getter.
A DNAStringSet object containing sequence information for the 'seqinfo' setter.
## --------------------------------------------------------------------- ## A. SIMPLE EXAMPLE ## --------------------------------------------------------------------- library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) ## Check metadata slot: empty metadata(probes) ## Get generated seqinfo table seqinfo(probes) ## Subsetting seqinfo table to 10 seqnames probes10 <- probes[1:10] seqinfo(probes10) <- seqinfo(probes)[as.character(1:10)] ## See result: 10 seqnames seqinfo(probes10)## --------------------------------------------------------------------- ## A. SIMPLE EXAMPLE ## --------------------------------------------------------------------- library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) ## Check metadata slot: empty metadata(probes) ## Get generated seqinfo table seqinfo(probes) ## Subsetting seqinfo table to 10 seqnames probes10 <- probes[1:10] seqinfo(probes10) <- seqinfo(probes)[as.character(1:10)] ## See result: 10 seqnames seqinfo(probes10)
The toComplex utility function turns a DNAString object
into a complex vector.
toComplex(x, baseValues)toComplex(x, baseValues)
x |
A DNAString object. |
baseValues |
A named complex vector containing the values associated
to each base e.g.
|
A complex vector of the same length as x.
H. Pagès
seq <- DNAString("accacctgaccattgtcct") baseValues1 <- c(A=1+0i, G=0+1i, T=-1+0i, C=0-1i) toComplex(seq, baseValues1) ## GC content: baseValues2 <- c(A=0, C=1, G=1, T=0) sum(as.integer(toComplex(seq, baseValues2))) ## Note that there are better ways to do this (see ?alphabetFrequency)seq <- DNAString("accacctgaccattgtcct") baseValues1 <- c(A=1+0i, G=0+1i, T=-1+0i, C=0-1i) toComplex(seq, baseValues1) ## GC content: baseValues2 <- c(A=0, C=1, G=1, T=0) sum(as.integer(toComplex(seq, baseValues2))) ## Note that there are better ways to do this (see ?alphabetFrequency)
Functions for translating DNA or RNA sequences into amino acid sequences.
## Translating DNA/RNA: translate(x, genetic.code=GENETIC_CODE, no.init.codon=FALSE, if.fuzzy.codon="error") ## Extracting codons without translating them: codons(x)## Translating DNA/RNA: translate(x, genetic.code=GENETIC_CODE, no.init.codon=FALSE, if.fuzzy.codon="error") ## Extracting codons without translating them: codons(x)
x |
A DNAStringSet, RNAStringSet, DNAString,
RNAString, MaskedDNAString or MaskedRNAString
object for A DNAString, RNAString, MaskedDNAString or
MaskedRNAString object for |
genetic.code |
The genetic code to use for the translation of codons into Amino Acid
letters. It must be represented as a named character vector of length
64 similar to predefined constant
The default value for |
no.init.codon |
By default, |
if.fuzzy.codon |
How fuzzy codons (i.e codon with IUPAC ambiguities) should be handled. Accepted values are:
Alternatively
The accepted values for the 2nd string are:
All the 6 possible combinations of 1st and 2nd strings are supported.
Note that |
translate reproduces the biological process of RNA
translation that occurs in the cell.
The input of the function can be either RNA or coding DNA.
By default The Standard Genetic Code (see ?GENETIC_CODE)
is used to translate codons into amino acids but the user can
supply a different genetic code via the genetic.code argument.
codons is a utility for extracting the codons involved
in this translation without translating them.
For translate: An AAString object when x is a
DNAString, RNAString, MaskedDNAString, or
MaskedRNAString object.
An AAStringSet object parallel to x (i.e. with 1
amino acid sequence per DNA or RNA sequence in x) when x
is a DNAStringSet or RNAStringSet object. If x has
names on it, they're propagated to the returned object.
For codons: An XStringViews object with 1 view per codon.
When x is a MaskedDNAString or MaskedRNAString object,
its masked parts are interpreted as introns and filled with the + letter
in the returned object. Therefore codons that span across masked regions
are represented by views that have a width > 3 and contain the + letter.
Note that each view is guaranteed to contain exactly 3 base letters.
AA_ALPHABET for the Amino Acid alphabet.
GENETIC_CODE for The Standard Genetic Code and
its known variants.
The examples for
extractTranscriptSeqs
in the GenomicFeatures package for computing the
full proteome of a given organism.
The reverseComplement function.
The DNAStringSet and AAStringSet classes.
The XStringViews and MaskedXString classes.
## --------------------------------------------------------------------- ## 1. BASIC EXAMPLES ## --------------------------------------------------------------------- dna1 <- DNAString("TTGATATGGCCCTTATAA") translate(dna1) ## TTG is an alternative initiation codon in the Standard Genetic Code: translate(dna1, no.init.codon=TRUE) SGC1 <- getGeneticCode("SGC1") # Vertebrate Mitochondrial code translate(dna1, genetic.code=SGC1) ## TTG is NOT an alternative initiation codon in the Vertebrate ## Mitochondrial code: translate(dna1, genetic.code=SGC1, no.init.codon=TRUE) ## All 6 codons except 4th (CCC) are fuzzy: dna2 <- DNAString("HTGATHTGRCCCYTRTRA") ## Not run: translate(dna2) # error because of fuzzy codons ## End(Not run) ## Translate all fuzzy codons to X: translate(dna2, if.fuzzy.codon="X") ## Or solve the non-ambiguous ones (3rd codon is ambiguous so cannot be ## solved): translate(dna2, if.fuzzy.codon="solve") ## Fuzzy codons that are non-ambiguous with a given genetic code can ## become ambiguous with another genetic code, and vice versa: translate(dna2, genetic.code=SGC1, if.fuzzy.codon="solve") ## --------------------------------------------------------------------- ## 2. TRANSLATING AN OPEN READING FRAME ## --------------------------------------------------------------------- file <- system.file("extdata", "someORF.fa", package="Biostrings") x <- readDNAStringSet(file) x ## The first and last 1000 nucleotides are not part of the ORFs: x <- DNAStringSet(x, start=1001, end=-1001) ## Before calling translate() on an ORF, we need to mask the introns ## if any. We can get this information fron the SGD database ## (http://www.yeastgenome.org/). ## According to SGD, the 1st ORF (YAL001C) has an intron at 71..160 ## (see http://db.yeastgenome.org/cgi-bin/locus.pl?locus=YAL001C) y1 <- x[[1]] mask1 <- Mask(length(y1), start=71, end=160) masks(y1) <- mask1 y1 translate(y1) ## Codons: codons(y1) which(width(codons(y1)) != 3) codons(y1)[20:28] ## --------------------------------------------------------------------- ## 3. AN ADVANCED EXAMPLE ## --------------------------------------------------------------------- ## Translation on the '-' strand: dna3 <- DNAStringSet(c("ATC", "GCTG", "CGACT")) translate(reverseComplement(dna3)) ## Translate sequences on both '+' and '-' strand across all ## possible reading frames (i.e., codon position 1, 2 or 3): ## First create a DNAStringSet of '+' and '-' strand sequences, ## removing the nucleotides prior to the reading frame start position. dna3_subseqs <- lapply(1:3, function(pos) subseq(c(dna3, reverseComplement(dna3)), start=pos)) ## Translation of 'dna3_subseqs' produces a list of length 3, each with ## 6 elements (3 '+' strand results followed by 3 '-' strand results). lapply(dna3_subseqs, translate) ## Note that translate() throws a warning when the length of the sequence ## is not divisible by 3. To avoid this warning wrap the function in ## suppressWarnings().## --------------------------------------------------------------------- ## 1. BASIC EXAMPLES ## --------------------------------------------------------------------- dna1 <- DNAString("TTGATATGGCCCTTATAA") translate(dna1) ## TTG is an alternative initiation codon in the Standard Genetic Code: translate(dna1, no.init.codon=TRUE) SGC1 <- getGeneticCode("SGC1") # Vertebrate Mitochondrial code translate(dna1, genetic.code=SGC1) ## TTG is NOT an alternative initiation codon in the Vertebrate ## Mitochondrial code: translate(dna1, genetic.code=SGC1, no.init.codon=TRUE) ## All 6 codons except 4th (CCC) are fuzzy: dna2 <- DNAString("HTGATHTGRCCCYTRTRA") ## Not run: translate(dna2) # error because of fuzzy codons ## End(Not run) ## Translate all fuzzy codons to X: translate(dna2, if.fuzzy.codon="X") ## Or solve the non-ambiguous ones (3rd codon is ambiguous so cannot be ## solved): translate(dna2, if.fuzzy.codon="solve") ## Fuzzy codons that are non-ambiguous with a given genetic code can ## become ambiguous with another genetic code, and vice versa: translate(dna2, genetic.code=SGC1, if.fuzzy.codon="solve") ## --------------------------------------------------------------------- ## 2. TRANSLATING AN OPEN READING FRAME ## --------------------------------------------------------------------- file <- system.file("extdata", "someORF.fa", package="Biostrings") x <- readDNAStringSet(file) x ## The first and last 1000 nucleotides are not part of the ORFs: x <- DNAStringSet(x, start=1001, end=-1001) ## Before calling translate() on an ORF, we need to mask the introns ## if any. We can get this information fron the SGD database ## (http://www.yeastgenome.org/). ## According to SGD, the 1st ORF (YAL001C) has an intron at 71..160 ## (see http://db.yeastgenome.org/cgi-bin/locus.pl?locus=YAL001C) y1 <- x[[1]] mask1 <- Mask(length(y1), start=71, end=160) masks(y1) <- mask1 y1 translate(y1) ## Codons: codons(y1) which(width(codons(y1)) != 3) codons(y1)[20:28] ## --------------------------------------------------------------------- ## 3. AN ADVANCED EXAMPLE ## --------------------------------------------------------------------- ## Translation on the '-' strand: dna3 <- DNAStringSet(c("ATC", "GCTG", "CGACT")) translate(reverseComplement(dna3)) ## Translate sequences on both '+' and '-' strand across all ## possible reading frames (i.e., codon position 1, 2 or 3): ## First create a DNAStringSet of '+' and '-' strand sequences, ## removing the nucleotides prior to the reading frame start position. dna3_subseqs <- lapply(1:3, function(pos) subseq(c(dna3, reverseComplement(dna3)), start=pos)) ## Translation of 'dna3_subseqs' produces a list of length 3, each with ## 6 elements (3 '+' strand results followed by 3 '-' strand results). lapply(dna3_subseqs, translate) ## Note that translate() throws a warning when the length of the sequence ## is not divisible by 3. To avoid this warning wrap the function in ## suppressWarnings().
The trimLRPatterns function trims left and/or right flanking patterns
from sequences.
trimLRPatterns(Lpattern = "", Rpattern = "", subject, max.Lmismatch = 0, max.Rmismatch = 0, with.Lindels = FALSE, with.Rindels = FALSE, Lfixed = TRUE, Rfixed = TRUE, ranges = FALSE)trimLRPatterns(Lpattern = "", Rpattern = "", subject, max.Lmismatch = 0, max.Rmismatch = 0, with.Lindels = FALSE, with.Rindels = FALSE, Lfixed = TRUE, Rfixed = TRUE, ranges = FALSE)
Lpattern |
The left pattern. |
Rpattern |
The right pattern. |
subject |
An XString object, XStringSet object, or character vector containing the target sequence(s). |
max.Lmismatch |
Either an integer vector of length When Otherwise, Once the integer vector is constructed using the rules given above, when
For a given element |
max.Rmismatch |
Same as For a given element |
with.Lindels |
If |
with.Rindels |
Same as |
Lfixed, Rfixed
|
Whether IUPAC extended letters in the left or right pattern should
be interpreted as ambiguities (see |
ranges |
If |
A new XString object, XStringSet object, or character vector with the "longest" flanking matches removed, as described above.
P. Aboyoun and H. Jaffee
matchPattern,
matchLRPatterns,
lowlevel-matching,
XString-class,
XStringSet-class
Lpattern <- "TTCTGCTTG" Rpattern <- "GATCGGAAG" subject <- DNAString("TTCTGCTTGACGTGATCGGA") subjectSet <- DNAStringSet(c("TGCTTGACGGCAGATCGG", "TTCTGCTTGGATCGGAAG")) ## Only allow for perfect matches on the flanks trimLRPatterns(Lpattern = Lpattern, subject = subject) trimLRPatterns(Rpattern = Rpattern, subject = subject) trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet) ## Allow for perfect matches on the flanking overlaps trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet, max.Lmismatch = 0, max.Rmismatch = 0) ## Allow for mismatches on the flanks trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subject, max.Lmismatch = 0.2, max.Rmismatch = 0.2) maxMismatches <- as.integer(0.2 * 1:9) maxMismatches trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet, max.Lmismatch = maxMismatches, max.Rmismatch = maxMismatches) ## Produce ranges that can be an input into other functions trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet, max.Lmismatch = 0, max.Rmismatch = 0, ranges = TRUE) trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subject, max.Lmismatch = 0.2, max.Rmismatch = 0.2, ranges = TRUE)Lpattern <- "TTCTGCTTG" Rpattern <- "GATCGGAAG" subject <- DNAString("TTCTGCTTGACGTGATCGGA") subjectSet <- DNAStringSet(c("TGCTTGACGGCAGATCGG", "TTCTGCTTGGATCGGAAG")) ## Only allow for perfect matches on the flanks trimLRPatterns(Lpattern = Lpattern, subject = subject) trimLRPatterns(Rpattern = Rpattern, subject = subject) trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet) ## Allow for perfect matches on the flanking overlaps trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet, max.Lmismatch = 0, max.Rmismatch = 0) ## Allow for mismatches on the flanks trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subject, max.Lmismatch = 0.2, max.Rmismatch = 0.2) maxMismatches <- as.integer(0.2 * 1:9) maxMismatches trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet, max.Lmismatch = maxMismatches, max.Rmismatch = maxMismatches) ## Produce ranges that can be an input into other functions trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet, max.Lmismatch = 0, max.Rmismatch = 0, ranges = TRUE) trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subject, max.Lmismatch = 0.2, max.Rmismatch = 0.2, ranges = TRUE)
This function mimics the semantic of paste(..., sep="")
but accepts XString, XStringSet or XStringViews
arguments and returns an XString or XStringSet object.
xscat(...)xscat(...)
... |
One or more character vectors (with no NAs), XString, XStringSet or XStringViews objects. |
An XString object if all the arguments are either XString objects or character strings. An XStringSet object otherwise.
H. Pagès
XString-class,
XStringSet-class,
XStringViews-class,
paste
## Return a BString object: xscat(BString("abc"), BString("EF")) xscat(BString("abc"), "EF") xscat("abc", "EF") ## Return a BStringSet object: xscat(BStringSet("abc"), "EF") ## Return a DNAStringSet object: xscat(c("t", "a"), DNAString("N")) ## Arguments are recycled to the length of the longest argument: res1a <- xscat("x", LETTERS, c("3", "44", "555")) res1b <- paste0("x", LETTERS, c("3", "44", "555")) stopifnot(identical(as.character(res1a), as.character(res1b))) ## Concatenating big XStringSet objects: library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) mm <- complement(narrow(probes, start=13, end=13)) left <- narrow(probes, end=12) right <- narrow(probes, start=14) xscat(left, mm, right) ## Collapsing an XStringSet (or XStringViews) object with a small ## number of elements: probes1000 <- as.list(probes[1:1000]) y1 <- do.call(xscat, probes1000) y2 <- do.call(c, probes1000) # slightly faster than the above y1 == y2 # TRUE ## Note that this method won't be efficient when the number of ## elements to collapse is big (> 10000) so we need to provide a ## collapse() (or xscollapse()) function in Biostrings that will be ## efficient at doing this. Please request this on the Bioconductor ## mailing list (http://bioconductor.org/help/mailing-list/) if you ## need it.## Return a BString object: xscat(BString("abc"), BString("EF")) xscat(BString("abc"), "EF") xscat("abc", "EF") ## Return a BStringSet object: xscat(BStringSet("abc"), "EF") ## Return a DNAStringSet object: xscat(c("t", "a"), DNAString("N")) ## Arguments are recycled to the length of the longest argument: res1a <- xscat("x", LETTERS, c("3", "44", "555")) res1b <- paste0("x", LETTERS, c("3", "44", "555")) stopifnot(identical(as.character(res1a), as.character(res1b))) ## Concatenating big XStringSet objects: library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) mm <- complement(narrow(probes, start=13, end=13)) left <- narrow(probes, end=12) right <- narrow(probes, start=14) xscat(left, mm, right) ## Collapsing an XStringSet (or XStringViews) object with a small ## number of elements: probes1000 <- as.list(probes[1:1000]) y1 <- do.call(xscat, probes1000) y2 <- do.call(c, probes1000) # slightly faster than the above y1 == y2 # TRUE ## Note that this method won't be efficient when the number of ## elements to collapse is big (> 10000) so we need to provide a ## collapse() (or xscollapse()) function in Biostrings that will be ## efficient at doing this. Please request this on the Bioconductor ## mailing list (http://bioconductor.org/help/mailing-list/) if you ## need it.
The BString class is a general container for storing a big string (a long sequence of characters) and for making its manipulation easy and efficient.
The DNAString, RNAString and AAString classes are similar containers but with the more biology-oriented purpose of storing a DNA sequence (DNAString), an RNA sequence (RNAString), or a sequence of amino acids (AAString).
All those containers derive directly (and with no additional slots) from the XString virtual class.
The 2 main differences between an XString object and a standard character vector are: (1) the data stored in an XString object are not copied on object duplication and (2) an XString object can only store a single string (see the XStringSet container for an efficient way to store a big collection of strings in a single object).
Unlike the DNAString, RNAString and AAString containers that accept only a predefined set of letters (the alphabet), a BString object can be used for storing any single string based on a single-byte character set.
In the code snippet below,
x can be a single string (character vector of length 1)
or an XString object.
BString(x="", start=1, nchar=NA):Tries to convert x into a BString object by reading
nchar letters starting at position start in x.
In the code snippets below, x is an XString object.
alphabet(x):NULL for a BString object.
See the corresponding man pages when x is a
DNAString, RNAString or AAString object.
length(x): or nchar(x):
Get the length of an XString object, i.e., its number of letters.
In the code snippets below, x is an XString object.
as.character(x):Converts x to a character string.
toString(x):Equivalent to as.character(x).
In the code snippets below, x is an XString object.
x[i]:Return a new XString object made of the selected letters (subscript
i must be an NA-free numeric vector specifying the positions of
the letters to select).
The returned object belongs to the same class as x.
Note that, unlike subseq, x[i] does copy the sequence
data and therefore will be very inefficient for extracting a big number
of letters (e.g. when i contains millions of positions).
In the code snippets below, e1 and e2 are XString objects.
e1 == e2:TRUE if e1 is equal to e2.
FALSE otherwise.
Comparison between two XString objects of different base types (e.g. a BString object and a DNAString object) is not supported with one exception: a DNAString object and an RNAString object can be compared (see RNAString-class for more details about this).
Comparison between a BString object and a character string is also supported (see examples below).
e1 != e2:Equivalent to !(e1 == e2).
H. Pagès
subseq,
letter,
DNAString-class,
RNAString-class,
AAString-class,
XStringSet-class,
XStringViews-class,
reverseComplement,
compact,
XVector-class
b <- BString("I am a BString object") b length(b) ## Extracting a linear subsequence: subseq(b) subseq(b, start=3) subseq(b, start=-3) subseq(b, end=-3) subseq(b, end=-3, width=5) ## Subsetting: b2 <- b[length(b):1] # better done with reverse(b) as.character(b2) b2 == b # FALSE b2 == as.character(b2) # TRUE ## b[1:length(b)] is equal but not identical to b! b == b[1:length(b)] # TRUE identical(b, 1:length(b)) # FALSE ## This is because subsetting an XString object with [ makes a copy ## of part or all its sequence data. Hence, for the resulting object, ## the internal slot containing the memory address of the sequence ## data differs from the original. This is enough for identical() to ## see the 2 objects as different. ## Compacting. As a particular type of XVector objects, XString ## objects can optionally be compacted. Compacting is done typically ## before serialization. See ?compact for more information.b <- BString("I am a BString object") b length(b) ## Extracting a linear subsequence: subseq(b) subseq(b, start=3) subseq(b, start=-3) subseq(b, end=-3) subseq(b, end=-3, width=5) ## Subsetting: b2 <- b[length(b):1] # better done with reverse(b) as.character(b2) b2 == b # FALSE b2 == as.character(b2) # TRUE ## b[1:length(b)] is equal but not identical to b! b == b[1:length(b)] # TRUE identical(b, 1:length(b)) # FALSE ## This is because subsetting an XString object with [ makes a copy ## of part or all its sequence data. Hence, for the resulting object, ## the internal slot containing the memory address of the sequence ## data differs from the original. This is enough for identical() to ## see the 2 objects as different. ## Compacting. As a particular type of XVector objects, XString ## objects can optionally be compacted. Compacting is done typically ## before serialization. See ?compact for more information.
Objects for storing string quality measures.
## Constructors: PhredQuality(x) SolexaQuality(x) IlluminaQuality(x) ## alphabet and encoding ## S4 method for signature 'XStringQuality' alphabet(x) ## S4 method for signature 'XStringQuality' encoding(x)## Constructors: PhredQuality(x) SolexaQuality(x) IlluminaQuality(x) ## alphabet and encoding ## S4 method for signature 'XStringQuality' alphabet(x) ## S4 method for signature 'XStringQuality' encoding(x)
x |
Either a character vector, BString, BStringSet, integer vector, or number vector of error probabilities. |
PhredQuality objects store characters that are interpreted as
[0 - 99] quality measures by subtracting 33 from their ASCII decimal
representation (e.g. ! = 0, " = 1, # = 2, ...). Quality measures q
encode probabilities as -10 * log10(p).
SolexaQuality objects store characters that are interpreted as
[-5 - 99] quality measures by subtracting 64 from their ASCII decimal
representation (e.g. ; = -5, < = -4, = = -3, ...). Quality measures q
encode probabilities as -10 * (log10(p) - log10(1 - p)).
IlluminaQuality objects store characters that are interpreted
as [0 - 99] quality measures by subtracting 64 from their ASCII
decimal representation (e.g. @ = 0, A = 1, B = 2, ...). Quality
measures q encode probabilities as -10 * log10(p)
In the code snippets below, x is an XStringQuality object.
alphabet(x):Valid letters in this quality score; not all letters are encountered in actual sequencing runs.
encoding(x): Map between letters and their corresponding
integer encoding. Use as.integer and as.numeric to
coerce objects to their integer and probability representations.
P. Aboyoun
pairwiseAlignment and
PairwiseAlignments-class in the pwalign package,
DNAString-class,
BStringSet-class
PhredQuality(0:40) SolexaQuality(0:40) IlluminaQuality(0:40) pq <- PhredQuality(c("*+,-./", "0123456789:;")) qs <- as(pq, "IntegerList") # quality scores qs as(qs, "PhredQuality") p <- as(pq, "NumericList") # probabilities as(p, "PhredQuality") PhredQuality(seq(1e-4,0.5,length=10)) SolexaQuality(seq(1e-4,0.5,length=10)) IlluminaQuality(seq(1e-4,0.5,length=10)) x <- SolexaQuality(BStringSet(c(a="@ABC", b="abcd"))) as(x, "IntegerList") # quality scores as(x, "NumericList") # probabilities as.matrix(x) # quality scoresPhredQuality(0:40) SolexaQuality(0:40) IlluminaQuality(0:40) pq <- PhredQuality(c("*+,-./", "0123456789:;")) qs <- as(pq, "IntegerList") # quality scores qs as(qs, "PhredQuality") p <- as(pq, "NumericList") # probabilities as(p, "PhredQuality") PhredQuality(seq(1e-4,0.5,length=10)) SolexaQuality(seq(1e-4,0.5,length=10)) IlluminaQuality(seq(1e-4,0.5,length=10)) x <- SolexaQuality(BStringSet(c(a="@ABC", b="abcd"))) as(x, "IntegerList") # quality scores as(x, "NumericList") # probabilities as.matrix(x) # quality scores
The BStringSet class is a container for storing a set of
BString objects and for making its manipulation
easy and efficient.
Similarly, the DNAStringSet (or RNAStringSet, or AAStringSet) class is
a container for storing a set of DNAString
(or RNAString, or AAString) objects.
All those containers derive directly (and with no additional slots) from the XStringSet virtual class.
## Constructors: BStringSet(x=character(), start=NA, end=NA, width=NA, use.names=TRUE) DNAStringSet(x=character(), start=NA, end=NA, width=NA, use.names=TRUE) RNAStringSet(x=character(), start=NA, end=NA, width=NA, use.names=TRUE) AAStringSet(x=character(), start=NA, end=NA, width=NA, use.names=TRUE) ## Accessor-like methods: ## S4 method for signature 'character' width(x) ## S4 method for signature 'XStringSet' nchar(x, type="chars", allowNA=FALSE) ## ... and more (see below)## Constructors: BStringSet(x=character(), start=NA, end=NA, width=NA, use.names=TRUE) DNAStringSet(x=character(), start=NA, end=NA, width=NA, use.names=TRUE) RNAStringSet(x=character(), start=NA, end=NA, width=NA, use.names=TRUE) AAStringSet(x=character(), start=NA, end=NA, width=NA, use.names=TRUE) ## Accessor-like methods: ## S4 method for signature 'character' width(x) ## S4 method for signature 'XStringSet' nchar(x, type="chars", allowNA=FALSE) ## ... and more (see below)
x |
Either a character vector (with no NAs), or an XString, XStringSet, or XStringViews object. |
start, end, width
|
Either |
use.names |
|
type, allowNA
|
Ignored. |
The BStringSet, DNAStringSet, RNAStringSet and
AAStringSet functions are constructors that can be used to
turn input x into an XStringSet object of the desired base type.
They also allow the user to "narrow" the sequences contained in x
via proper use of the start, end and/or width
arguments. In this context, "narrowing" means dropping a prefix or/and
a suffix of each sequence in x.
The "narrowing" capabilities of these constructors can be illustrated
by the following property: if x is a character vector
(with no NAs), or an XStringSet (or XStringViews) object,
then the 3 following transformations are equivalent:
BStringSet(x, start=mystart, end=myend, width=mywidth)
narrow(BStringSet(x), start=mystart, end=myend, width=mywidth)
BStringSet(narrow(x, start=mystart, end=myend, width=mywidth))
Note that, besides being more convenient, the first form is also more efficient on character vectors.
In the code snippets below,
x is an XStringSet object.
length(x):The number of sequences in x.
width(x):A vector of non-negative integers containing the number
of letters for each element in x.
Note that width(x) is also defined for a character vector
with no NAs and is equivalent to nchar(x, type="bytes").
names(x):NULL or a character vector of the same length as x
containing a short user-provided description or comment for each
element in x.
These are the only data in an XStringSet object that can safely
be changed by the user. All the other data are immutable!
As a general recommendation, the user should never try to modify
an object by accessing its slots directly.
alphabet(x):Return NULL, DNA_ALPHABET,
RNA_ALPHABET or AA_ALPHABET depending on
whether x is a BStringSet, DNAStringSet, RNAStringSet or
AAStringSet object.
nchar(x):The same as width(x).
is.na(x):Returns FALSE for every element.
anyNA(x):Returns FALSE.
In the code snippets below, x is a character vector (with
no NAs) or an XStringSet object.
narrow(x, start=NA, end=NA, width=NA, use.names=TRUE):Applies subseq() on each element in x.
See ?subseq for the details.
Note that this is similar to what substr does on a
character vector. However there are some noticeable differences:
narrow() has arguments start, end, and
width, where substr() only has arguments
start and stop;
The SEW interface (start/end/width) interface of narrow()
is richer (e.g. it supports negative start and/or end values);
Unlike substr(), narrow() checks that the
supplied start/end/width values are valid, that is, it throws
an error if they specify "out of limits" subsequences or
subsequences with a negative width;
narrow() has the use.names argument to let the
user choose whether the names on the input should be propagated
or not.
Note that narrow() also works on a character vector.
subseq(x, start=NA, end=NA, width=NA):Same as narrow(). The only difference is that subseq()
has no use.names argument.
Other than that they do the same thing on an XStringSet object or
character vector.
subseq(x, start=NA, end=NA, width=NA) <- value:A vectorized version of the subseq<-
method for XVector objects.
See ?`subseq<-` for the details.
Note that subseq<- also works on a character vector.
threebands(x, start=NA, end=NA, width=NA):Like the method for IRanges objects, the
threebands() method for XStringSet objects extends the
capability of narrow() by returning the 3 set of subsequences
(the left, middle and right subsequences) associated with the narrowing
operation. See ?threebands in the IRanges
package for the details.
Note that threebands() also works on a character vector.
In the code snippets below,
x and values are XStringSet objects,
and i should be an index specifying the elements to extract.
x[i]:Return a new XStringSet object made of the selected elements.
x[[i]]:Extract the i-th XString object from x.
append(x, values, after=length(x)):Add sequences in values to x.
In the code snippets below,
x and y are XStringSet objects.
union(x, y):Union of x and y.
intersect(x, y):Intersection of x and y.
setdiff(x, y):Asymmetric set difference of x and y.
setequal(x, y):Set equality of x to y.
In the code snippets below,
x is an XStringSet object.
unlist(x):Turns x into an XString object by combining the
sequences in x together.
Fast equivalent to do.call(c, as.list(x)).
as.character(x, use.names=TRUE):Converts x to a character vector of the same length as x.
The use.names argument controls whether or not names(x)
should be propagated to the names of the returned vector.
as.factor(x):Converts x to a factor, via as.character(x).
as.matrix(x, use.names=TRUE):Returns a character matrix containing the "exploded" representation of
the strings. Can only be used on an XStringSet object with
equal-width strings.
The use.names argument controls whether or not names(x)
should be propagated to the row names of the returned matrix.
toString(x):Equivalent to toString(as.character(x)).
show(x):By default the show method displays 5 head and 5 tail
lines. The number of lines can be altered by setting the global
options showHeadLines and showTailLines. If the
object length is less than the sum of the options, the full object
is displayed. These options affect GRanges, GAlignments, IRanges,
and XStringSet objects.
The letters in a DNAStringSet, RNAStringSet, or AAStringSet
object are colored when displayed by the show() method.
Set global option Biostrings.coloring to FALSE to turn off
this coloring.
H. Pagès
readDNAStringSet and writeXStringSet
for reading/writing a DNAStringSet object (or other
XStringSet derivative) from/to a FASTA or FASTQ file.
XString objects.
XStringViews objects.
XStringSetList objects.
XVectorList objects.
## --------------------------------------------------------------------- ## A. USING THE XStringSet CONSTRUCTORS ON A CHARACTER VECTOR OR FACTOR ## --------------------------------------------------------------------- ## Note that there is no XStringSet() constructor, but an XStringSet ## family of constructors: BStringSet(), DNAStringSet(), RNAStringSet(), ## etc... x0 <- c("#CTC-NACCAGTAT", "#TTGA", "TACCTAGAG") width(x0) x1 <- BStringSet(x0) x1 ## 3 equivalent ways to obtain the same BStringSet object: BStringSet(x0, start=4, end=-3) subseq(x1, start=4, end=-3) BStringSet(subseq(x0, start=4, end=-3)) dna0 <- DNAStringSet(x0, start=4, end=-3) dna0 # 'options(Biostrings.coloring=FALSE)' to turn off coloring names(dna0) names(dna0)[2] <- "seqB" dna0 ## When the input vector contains a lot of duplicates, turning it into ## a factor first before passing it to the constructor will produce an ## XStringSet object that is more compact in memory: library(hgu95av2probe) x2 <- sample(hgu95av2probe$sequence, 999000, replace=TRUE) dna2a <- DNAStringSet(x2) dna2b <- DNAStringSet(factor(x2)) # slower but result is more compact object.size(dna2a) object.size(dna2b) ## --------------------------------------------------------------------- ## B. USING THE XStringSet CONSTRUCTORS ON A SINGLE SEQUENCE (XString ## OBJECT OR CHARACTER STRING) ## --------------------------------------------------------------------- x3 <- "abcdefghij" BStringSet(x3, start=2, end=6:2) # behaves like 'substring(x3, 2, 6:2)' BStringSet(x3, start=-(1:6)) x4 <- BString(x3) BStringSet(x4, end=-(1:6), width=3) ## Randomly extract 1 million 40-mers from C. elegans chrI: extractRandomReads <- function(subject, nread, readlength) { if (!is.integer(readlength)) readlength <- as.integer(readlength) start <- sample(length(subject) - readlength + 1L, nread, replace=TRUE) DNAStringSet(subject, start=start, width=readlength) } library(BSgenome.Celegans.UCSC.ce2) rndreads <- extractRandomReads(Celegans$chrI, 1000000, 40) ## Notes: ## - This takes only 2 or 3 seconds versus several hours for a solution ## using substring() on a standard character string. ## - The short sequences in 'rndreads' can be seen as the result of a ## simulated high-throughput sequencing experiment. A non-realistic ## one though because: ## (a) It assumes that the underlying technology is perfect (the ## generated reads have no technology induced errors). ## (b) It assumes that the sequenced genome is exactly the same as the ## reference genome. ## (c) The simulated reads can contain IUPAC ambiguity letters only ## because the reference genome contains them. In a real ## high-throughput sequencing experiment, the sequenced genome ## of course doesn't contain those letters, but the sequencer ## can introduce them in the generated reads to indicate ambiguous ## base-calling. ## (d) The simulated reads come from the plus strand only of a single ## chromosome. ## - See the getSeq() function in the BSgenome package for how to ## circumvent (d) i.e. how to generate reads that come from the whole ## genome (plus and minus strands of all chromosomes). ## --------------------------------------------------------------------- ## C. USING THE XStringSet CONSTRUCTORS ON AN XStringSet OBJECT ## --------------------------------------------------------------------- library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) probes RNAStringSet(probes, start=2, end=-5) # does NOT copy the sequence data! ## --------------------------------------------------------------------- ## D. USING THE XStringSet CONSTRUCTORS ON AN ORDINARY list OF XString ## OBJECTS ## --------------------------------------------------------------------- probes10 <- head(probes, n=10) set.seed(33) shuffled_nucleotides <- lapply(probes10, sample) shuffled_nucleotides DNAStringSet(shuffled_nucleotides) # does NOT copy the sequence data! ## Note that the same result can be obtained in a more compact way with ## just: set.seed(33) endoapply(probes10, sample) ## --------------------------------------------------------------------- ## E. USING subseq() ON AN XStringSet OBJECT ## --------------------------------------------------------------------- subseq(probes, start=2, end=-5) subseq(probes, start=13, end=13) <- "N" probes ## Add/remove a prefix: subseq(probes, start=1, end=0) <- "--" probes subseq(probes, end=2) <- "" probes ## Do more complicated things: subseq(probes, start=4:7, end=7) <- c("YYYY", "YYY", "YY", "Y") subseq(probes, start=4, end=6) <- subseq(probes, start=-2:-5) probes ## --------------------------------------------------------------------- ## F. UNLISTING AN XStringSet OBJECT ## --------------------------------------------------------------------- library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) unlist(probes) ## --------------------------------------------------------------------- ## G. COMPACTING AN XStringSet OBJECT ## --------------------------------------------------------------------- ## As a particular type of XVectorList objects, XStringSet objects can ## optionally be compacted. Compacting is done typically before ## serialization. See ?compact for more information. library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) y <- subseq(probes[1:12], start=5) probes@pool y@pool object.size(probes) object.size(y) y0 <- compact(y) y0@pool object.size(y0)## --------------------------------------------------------------------- ## A. USING THE XStringSet CONSTRUCTORS ON A CHARACTER VECTOR OR FACTOR ## --------------------------------------------------------------------- ## Note that there is no XStringSet() constructor, but an XStringSet ## family of constructors: BStringSet(), DNAStringSet(), RNAStringSet(), ## etc... x0 <- c("#CTC-NACCAGTAT", "#TTGA", "TACCTAGAG") width(x0) x1 <- BStringSet(x0) x1 ## 3 equivalent ways to obtain the same BStringSet object: BStringSet(x0, start=4, end=-3) subseq(x1, start=4, end=-3) BStringSet(subseq(x0, start=4, end=-3)) dna0 <- DNAStringSet(x0, start=4, end=-3) dna0 # 'options(Biostrings.coloring=FALSE)' to turn off coloring names(dna0) names(dna0)[2] <- "seqB" dna0 ## When the input vector contains a lot of duplicates, turning it into ## a factor first before passing it to the constructor will produce an ## XStringSet object that is more compact in memory: library(hgu95av2probe) x2 <- sample(hgu95av2probe$sequence, 999000, replace=TRUE) dna2a <- DNAStringSet(x2) dna2b <- DNAStringSet(factor(x2)) # slower but result is more compact object.size(dna2a) object.size(dna2b) ## --------------------------------------------------------------------- ## B. USING THE XStringSet CONSTRUCTORS ON A SINGLE SEQUENCE (XString ## OBJECT OR CHARACTER STRING) ## --------------------------------------------------------------------- x3 <- "abcdefghij" BStringSet(x3, start=2, end=6:2) # behaves like 'substring(x3, 2, 6:2)' BStringSet(x3, start=-(1:6)) x4 <- BString(x3) BStringSet(x4, end=-(1:6), width=3) ## Randomly extract 1 million 40-mers from C. elegans chrI: extractRandomReads <- function(subject, nread, readlength) { if (!is.integer(readlength)) readlength <- as.integer(readlength) start <- sample(length(subject) - readlength + 1L, nread, replace=TRUE) DNAStringSet(subject, start=start, width=readlength) } library(BSgenome.Celegans.UCSC.ce2) rndreads <- extractRandomReads(Celegans$chrI, 1000000, 40) ## Notes: ## - This takes only 2 or 3 seconds versus several hours for a solution ## using substring() on a standard character string. ## - The short sequences in 'rndreads' can be seen as the result of a ## simulated high-throughput sequencing experiment. A non-realistic ## one though because: ## (a) It assumes that the underlying technology is perfect (the ## generated reads have no technology induced errors). ## (b) It assumes that the sequenced genome is exactly the same as the ## reference genome. ## (c) The simulated reads can contain IUPAC ambiguity letters only ## because the reference genome contains them. In a real ## high-throughput sequencing experiment, the sequenced genome ## of course doesn't contain those letters, but the sequencer ## can introduce them in the generated reads to indicate ambiguous ## base-calling. ## (d) The simulated reads come from the plus strand only of a single ## chromosome. ## - See the getSeq() function in the BSgenome package for how to ## circumvent (d) i.e. how to generate reads that come from the whole ## genome (plus and minus strands of all chromosomes). ## --------------------------------------------------------------------- ## C. USING THE XStringSet CONSTRUCTORS ON AN XStringSet OBJECT ## --------------------------------------------------------------------- library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) probes RNAStringSet(probes, start=2, end=-5) # does NOT copy the sequence data! ## --------------------------------------------------------------------- ## D. USING THE XStringSet CONSTRUCTORS ON AN ORDINARY list OF XString ## OBJECTS ## --------------------------------------------------------------------- probes10 <- head(probes, n=10) set.seed(33) shuffled_nucleotides <- lapply(probes10, sample) shuffled_nucleotides DNAStringSet(shuffled_nucleotides) # does NOT copy the sequence data! ## Note that the same result can be obtained in a more compact way with ## just: set.seed(33) endoapply(probes10, sample) ## --------------------------------------------------------------------- ## E. USING subseq() ON AN XStringSet OBJECT ## --------------------------------------------------------------------- subseq(probes, start=2, end=-5) subseq(probes, start=13, end=13) <- "N" probes ## Add/remove a prefix: subseq(probes, start=1, end=0) <- "--" probes subseq(probes, end=2) <- "" probes ## Do more complicated things: subseq(probes, start=4:7, end=7) <- c("YYYY", "YYY", "YY", "Y") subseq(probes, start=4, end=6) <- subseq(probes, start=-2:-5) probes ## --------------------------------------------------------------------- ## F. UNLISTING AN XStringSet OBJECT ## --------------------------------------------------------------------- library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) unlist(probes) ## --------------------------------------------------------------------- ## G. COMPACTING AN XStringSet OBJECT ## --------------------------------------------------------------------- ## As a particular type of XVectorList objects, XStringSet objects can ## optionally be compacted. Compacting is done typically before ## serialization. See ?compact for more information. library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) y <- subseq(probes[1:12], start=5) probes@pool y@pool object.size(probes) object.size(y) y0 <- compact(y) y0@pool object.size(y0)
Methods for comparing and ordering the elements in one or more XStringSet objects.
Element-wise (aka "parallel") comparison of 2 XStringSet objects is based on the lexicographic order between 2 BString, DNAString, RNAString, or AAString objects.
For DNAStringSet and RNAStringSet objects, the letters in the respective alphabets (i.e. DNA_ALPHABET and RNA_ALPHABET) are ordered based on a predefined code assigned to each letter. The code assigned to each letter can be retrieved with:
dna_codes <- as.integer(DNAString(paste(DNA_ALPHABET, collapse=""))) names(dna_codes) <- DNA_ALPHABET rna_codes <- as.integer(RNAString(paste(RNA_ALPHABET, collapse=""))) names(rna_codes) <- RNA_ALPHABET
Note that this order does NOT depend on the locale in use. Also note that comparing DNA sequences with RNA sequences is supported and in that case T and U are considered to be the same letter.
For BStringSet and AAStringSet objects, the alphabetical order is defined by the C collation. Note that, at the moment, AAStringSet objects are treated like BStringSet objects i.e. the alphabetical order is NOT defined by the order of the letters in AA_ALPHABET. This might change at some point.
pcompare() and related methodsIn the code snippets below,
x and y are XStringSet objects.
pcompare(x, y):Performs element-wise (aka "parallel") comparison of x and
y, that is, returns an integer vector where the i-th element
is less than, equal to, or greater than zero if the i-th element in
x is considered to be respectively less than, equal to, or
greater than the i-th element in y.
If x and y don't have the same length, then the shortest
is recycled to the length of the longest (the standard recycling rules
apply).
x == y, x != y, x <= y, x >= y,
x < y, x > y:Equivalent to pcompare(x, y) == 0, pcompare(x, y) != 0,
pcompare(x, y) <= 0, pcompare(x, y) >= 0,
pcompare(x, y) < 0, and pcompare(x, y) > 0, respectively.
order() and related methodsIn the code snippets below, x is an XStringSet object.
is.unsorted(x, strictly=FALSE):Return a logical values specifying if x is unsorted. The
strictly argument takes logical value indicating if the check
should be for _strictly_ increasing values.
order(x, decreasing=FALSE):Return a permutation which rearranges x into ascending or
descending order.
rank(x, ties.method=c("first", "min")):Rank x in ascending order.
sort(x, decreasing=FALSE):Sort x into ascending or descending order.
duplicated() and unique()
In the code snippets below, x is an XStringSet object.
duplicated(x):Return a logical vector whose elements denotes duplicates in x.
unique(x):Return the subset of x made of its unique elements.
match() and %in%
In the code snippets below,
x and table are XStringSet objects.
match(x, table, nomatch=NA_integer_):Returns an integer vector containing the first positions of an identical
match in table for the elements in x.
x %in% table:Returns a logical vector indicating which elements in x match
identically with an element in table.
H. Pagès
XStringSet-class,
==,
is.unsorted,
order,
rank,
sort,
duplicated,
unique,
match,
%in%
## --------------------------------------------------------------------- ## A. SIMPLE EXAMPLES ## --------------------------------------------------------------------- dna <- DNAStringSet(c("AAA", "TC", "", "TC", "AAA", "CAAC", "G")) match(c("", "G", "AA", "TC"), dna) library(drosophila2probe) fly_probes <- DNAStringSet(drosophila2probe) sum(duplicated(fly_probes)) # 481 duplicated probes is.unsorted(fly_probes) # TRUE fly_probes <- sort(fly_probes) is.unsorted(fly_probes) # FALSE is.unsorted(fly_probes, strictly=TRUE) # TRUE, because of duplicates is.unsorted(unique(fly_probes), strictly=TRUE) # FALSE ## Nb of probes that are the reverse complement of another probe: nb1 <- sum(reverseComplement(fly_probes) %in% fly_probes) stopifnot(identical(nb1, 455L)) # 455 probes ## Probes shared between drosophila2probe and hgu95av2probe: library(hgu95av2probe) human_probes <- DNAStringSet(hgu95av2probe) m <- match(fly_probes, human_probes) stopifnot(identical(sum(!is.na(m)), 493L)) # 493 shared probes ## --------------------------------------------------------------------- ## B. AN ADVANCED EXAMPLE ## --------------------------------------------------------------------- ## We want to compare the first 5 bases with the 5 last bases of each ## probe in drosophila2probe. More precisely, we want to compute the ## percentage of probes for which the first 5 bases are the reverse ## complement of the 5 last bases. library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) first5 <- narrow(probes, end=5) last5 <- narrow(probes, start=-5) nb2 <- sum(first5 == reverseComplement(last5)) stopifnot(identical(nb2, 17L)) ## Percentage: 100 * nb2 / length(probes) # 0.0064 % ## If the probes were random DNA sequences, a probe would have 1 chance ## out of 4^5 to have this property so the percentage would be: 100 / 4^5 # 0.098 % ## With randomly generated probes: set.seed(33) random_dna <- sample(DNAString(paste(DNA_BASES, collapse="")), sum(width(probes)), replace=TRUE) random_probes <- successiveViews(random_dna, width(probes)) random_probes random_probes <- as(random_probes, "XStringSet") random_probes random_first5 <- narrow(random_probes, end=5) random_last5 <- narrow(random_probes, start=-5) nb3 <- sum(random_first5 == reverseComplement(random_last5)) 100 * nb3 / length(random_probes) # 0.099 %## --------------------------------------------------------------------- ## A. SIMPLE EXAMPLES ## --------------------------------------------------------------------- dna <- DNAStringSet(c("AAA", "TC", "", "TC", "AAA", "CAAC", "G")) match(c("", "G", "AA", "TC"), dna) library(drosophila2probe) fly_probes <- DNAStringSet(drosophila2probe) sum(duplicated(fly_probes)) # 481 duplicated probes is.unsorted(fly_probes) # TRUE fly_probes <- sort(fly_probes) is.unsorted(fly_probes) # FALSE is.unsorted(fly_probes, strictly=TRUE) # TRUE, because of duplicates is.unsorted(unique(fly_probes), strictly=TRUE) # FALSE ## Nb of probes that are the reverse complement of another probe: nb1 <- sum(reverseComplement(fly_probes) %in% fly_probes) stopifnot(identical(nb1, 455L)) # 455 probes ## Probes shared between drosophila2probe and hgu95av2probe: library(hgu95av2probe) human_probes <- DNAStringSet(hgu95av2probe) m <- match(fly_probes, human_probes) stopifnot(identical(sum(!is.na(m)), 493L)) # 493 shared probes ## --------------------------------------------------------------------- ## B. AN ADVANCED EXAMPLE ## --------------------------------------------------------------------- ## We want to compare the first 5 bases with the 5 last bases of each ## probe in drosophila2probe. More precisely, we want to compute the ## percentage of probes for which the first 5 bases are the reverse ## complement of the 5 last bases. library(drosophila2probe) probes <- DNAStringSet(drosophila2probe) first5 <- narrow(probes, end=5) last5 <- narrow(probes, start=-5) nb2 <- sum(first5 == reverseComplement(last5)) stopifnot(identical(nb2, 17L)) ## Percentage: 100 * nb2 / length(probes) # 0.0064 % ## If the probes were random DNA sequences, a probe would have 1 chance ## out of 4^5 to have this property so the percentage would be: 100 / 4^5 # 0.098 % ## With randomly generated probes: set.seed(33) random_dna <- sample(DNAString(paste(DNA_BASES, collapse="")), sum(width(probes)), replace=TRUE) random_probes <- successiveViews(random_dna, width(probes)) random_probes random_probes <- as(random_probes, "XStringSet") random_probes random_first5 <- narrow(random_probes, end=5) random_last5 <- narrow(random_probes, start=-5) nb3 <- sum(random_first5 == reverseComplement(random_last5)) 100 * nb3 / length(random_probes) # 0.099 %
Functions to read/write an XStringSet object from/to a file.
## Read FASTA (or FASTQ) files in an XStringSet object: readBStringSet(filepath, format="fasta", nrec=-1L, skip=0L, seek.first.rec=FALSE, use.names=TRUE, with.qualities=FALSE) readDNAStringSet(filepath, format="fasta", nrec=-1L, skip=0L, seek.first.rec=FALSE, use.names=TRUE, with.qualities=FALSE) readRNAStringSet(filepath, format="fasta", nrec=-1L, skip=0L, seek.first.rec=FALSE, use.names=TRUE, with.qualities=FALSE) readAAStringSet(filepath, format="fasta", nrec=-1L, skip=0L, seek.first.rec=FALSE, use.names=TRUE, with.qualities=FALSE) ## Extract basic information about FASTA (or FASTQ) files ## without actually loading the sequence data: fasta.seqlengths(filepath, nrec=-1L, skip=0L, seek.first.rec=FALSE, seqtype="B", use.names=TRUE) fasta.index(filepath, nrec=-1L, skip=0L, seek.first.rec=FALSE, seqtype="B") fastq.seqlengths(filepath, nrec=-1L, skip=0L, seek.first.rec=FALSE) fastq.geometry(filepath, nrec=-1L, skip=0L, seek.first.rec=FALSE) ## Write an XStringSet object to a FASTA (or FASTQ) file: writeXStringSet(x, filepath, append=FALSE, compress=FALSE, compression_level=NA, format="fasta", ...) ## Serialize an XStringSet object: saveXStringSet(x, objname, dirpath=".", save.dups=FALSE, verbose=TRUE)## Read FASTA (or FASTQ) files in an XStringSet object: readBStringSet(filepath, format="fasta", nrec=-1L, skip=0L, seek.first.rec=FALSE, use.names=TRUE, with.qualities=FALSE) readDNAStringSet(filepath, format="fasta", nrec=-1L, skip=0L, seek.first.rec=FALSE, use.names=TRUE, with.qualities=FALSE) readRNAStringSet(filepath, format="fasta", nrec=-1L, skip=0L, seek.first.rec=FALSE, use.names=TRUE, with.qualities=FALSE) readAAStringSet(filepath, format="fasta", nrec=-1L, skip=0L, seek.first.rec=FALSE, use.names=TRUE, with.qualities=FALSE) ## Extract basic information about FASTA (or FASTQ) files ## without actually loading the sequence data: fasta.seqlengths(filepath, nrec=-1L, skip=0L, seek.first.rec=FALSE, seqtype="B", use.names=TRUE) fasta.index(filepath, nrec=-1L, skip=0L, seek.first.rec=FALSE, seqtype="B") fastq.seqlengths(filepath, nrec=-1L, skip=0L, seek.first.rec=FALSE) fastq.geometry(filepath, nrec=-1L, skip=0L, seek.first.rec=FALSE) ## Write an XStringSet object to a FASTA (or FASTQ) file: writeXStringSet(x, filepath, append=FALSE, compress=FALSE, compression_level=NA, format="fasta", ...) ## Serialize an XStringSet object: saveXStringSet(x, objname, dirpath=".", save.dups=FALSE, verbose=TRUE)
filepath |
A character vector (of arbitrary length when reading, of length 1 when writing) containing the path(s) to the file(s) to read or write. Reading files in gzip format (which usually have the '.gz' extension) is supported. Note that special values like Also |
format |
Either |
nrec |
Single integer. The maximum of number of records to read in. Negative values are ignored. |
skip |
Single non-negative integer. The number of records of the data file(s) to skip before beginning to read in records. |
seek.first.rec |
Normal parsing then starts from there, and everything happens like if the file actually started there. In particular it will be an error if this first record is not a valid FASTA or FASTQ record. Using |
use.names |
|
with.qualities |
Note that using |
seqtype |
A single string specifying the type of sequences contained in the FASTA file(s). Supported sequence types:
Invalid one-letter sequence codes are ignored with a warning. |
x |
For For |
append |
|
compress |
Like for the Passing |
compression_level |
Not implemented yet. |
... |
Further format-specific arguments. If If |
objname |
The name of the serialized object. |
dirpath |
The path to the directory where to save the serialized object. |
save.dups |
|
verbose |
|
gzip compression is supported by reading and writing functions on all platforms.
readDNAStringSet and family (i.e. readBStringSet,
readDNAStringSet, readRNAStringSet and readAAStringSet)
load sequences from an input file (or multiple input files) into an
XStringSet object. When multiple input files are specified,
all must have the same format (i.e. FASTA or FASTQ) and files with
different compression types can be mixed with non-compressed files.
The files are read in the order they were specified and the sequences
are stored in the returned object in the order they were read.
Only FASTA and FASTQ files are supported for now.
The fasta.seqlengths utility returns an integer vector with one
element per FASTA record in the input files. Each element is the length
of the sequence found in the corresponding record, that is, the number of
valid one-letter sequence codes in the record. See description of the
seqtype argument above for how to control the set of valid
one-letter sequence codes.
The fasta.index utility returns a data frame with 1 row per
FASTA record in the input files and the following columns:
recno: The rank of the record in the (virtually) concatenated
input files.
fileno: The rank of the file where the record is located.
offset: The offset of the record relative to the start of the
file where it's located. Measured in bytes.
desc: The description line (a.k.a. header) of the record.
seqlength: The length of the sequence in the record (not
counting invalid letters).
filepath: The path to the file where the record is located.
Always a local file, so if the user specified a remote file, this
column will contain the path to the downloaded file.
A subset of this data frame can be passed to readDNAStringSet
and family for direct access to an arbitrary subset of sequences. More
precisely, if fai is a FASTA index that was obtained with
fasta.index(filepath, ..., seqtype="DNA"), then
readDNAStringSet(fai[i, ]) is equivalent to
readDNAStringSet(filepath, ...)[i] for any valid subscript i,
except that the former only loads the requested sequences in memory
and thus will be more memory efficient if only a small subset of sequences
is requested.
The fastq.seqlengths utility returns the read lengths in an integer
vector with one element per FASTQ record in the input files.
The fastq.geometry utility is a convenience wrapper around
fastq.seqlengths that returns an integer vector of length 2
describing the geometry of the FASTQ files. The first integer gives
the total number of FASTQ records in the files and the second element the
common length of the reads (this common length is set to NA in case
of variable length reads or if no FASTQ record was found). This compact
representation of the geometry can be useful if the FASTQ files are known
to contain fixed length reads.
writeXStringSet writes an XStringSet object to a file.
Like with readDNAStringSet and family, only FASTA and FASTQ
files are supported for now.
WARNING: Please be aware that using writeXStringSet on a
BStringSet object that contains the '\n' (LF) or '\r' (CR)
characters or the FASTA markup characters '>' or ';' is almost
guaranteed to produce a broken FASTA file!
Serializing an XStringSet object with saveXStringSet
is equivalent to using the standard save mechanism. But it will
try to reduce the size of x in memory first before calling
save. Most of the times this leads to a much reduced size on disk.
http://en.wikipedia.org/wiki/FASTA_format
BStringSet, DNAStringSet, RNAStringSet, and AAStringSet objects.
readQualityScaledDNAStringSet and
writeQualityScaledXStringSet for reading/writing
a QualityScaledDNAStringSet object (or other
QualityScaledXStringSet derivative) from/to a FASTQ file.
## --------------------------------------------------------------------- ## A. READ/WRITE FASTA FILES ## --------------------------------------------------------------------- ## Read a non-compressed FASTA files: filepath1 <- system.file("extdata", "someORF.fa", package="Biostrings") fasta.seqlengths(filepath1, seqtype="DNA") x1 <- readDNAStringSet(filepath1) x1 ## Read a gzip-compressed FASTA file: filepath2 <- system.file("extdata", "someORF.fa.gz", package="Biostrings") fasta.seqlengths(filepath2, seqtype="DNA") x2 <- readDNAStringSet(filepath2) x2 ## Sanity check: stopifnot(identical(as.character(x1), as.character(x2))) ## Read 2 FASTA files at once: filepath3 <- system.file("extdata", "fastaEx.fa", package="Biostrings") fasta.seqlengths(c(filepath2, filepath3), seqtype="DNA") x23 <- readDNAStringSet(c(filepath2, filepath3)) x23 ## Sanity check: x3 <- readDNAStringSet(filepath3) stopifnot(identical(as.character(x23), as.character(c(x2, x3)))) ## Use a FASTA index to load only an arbitrary subset of sequences: filepath4 <- system.file("extdata", "dm3_upstream2000.fa.gz", package="Biostrings") fai <- fasta.index(filepath4, seqtype="DNA") head(fai) head(fai$desc) i <- sample(nrow(fai), 10) # randomly pick up 10 sequences x4 <- readDNAStringSet(fai[i, ]) ## Sanity check: stopifnot(identical(as.character(readDNAStringSet(filepath4)[i]), as.character(x4))) ## Write FASTA files: out23a <- tempfile() writeXStringSet(x23, out23a) out23b <- tempfile() writeXStringSet(x23, out23b, compress=TRUE) file.info(c(out23a, out23b))$size ## Sanity checks: stopifnot(identical(as.character(readDNAStringSet(out23a)), as.character(x23))) stopifnot(identical(readLines(out23a), readLines(out23b))) ## --------------------------------------------------------------------- ## B. READ/WRITE FASTQ FILES ## --------------------------------------------------------------------- filepath5 <- system.file("extdata", "s_1_sequence.txt", package="Biostrings") fastq.geometry(filepath5) ## The quality strings are ignored by default: reads <- readDNAStringSet(filepath5, format="fastq") reads mcols(reads) ## Use 'with.qualities=TRUE' to load them: reads <- readDNAStringSet(filepath5, format="fastq", with.qualities=TRUE) reads mcols(reads) mcols(reads)$qualities ## Each quality string contains one letter per nucleotide in the ## corresponding read: stopifnot(identical(width(mcols(reads)$qualities), width(reads))) ## Write the reads to a FASTQ file: outfile <- tempfile() writeXStringSet(reads, outfile, format="fastq") outfile2 <- tempfile() writeXStringSet(reads, outfile2, compress=TRUE, format="fastq") ## Sanity checks: stopifnot(identical(readLines(outfile), readLines(filepath5))) stopifnot(identical(readLines(outfile), readLines(outfile2))) ## --------------------------------------------------------------------- ## C. READ FILES BY CHUNK ## --------------------------------------------------------------------- ## readDNAStringSet() supports reading an arbitrary number of FASTA or ## FASTQ records at a time in a loop. This can be useful to process ## big FASTA or FASTQ files by chunk and thus avoids loading the entire ## file in memory. To achieve this the files to read from need to be ## opened with open_input_files() first. Note that open_input_files() ## accepts a vector of file paths and/or URLs. ## With FASTA files: files <- open_input_files(filepath4) i <- 0 while (TRUE) { i <- i + 1 ## Load 4000 records at a time. Each new call to readDNAStringSet() ## picks up where the previous call left. dna <- readDNAStringSet(files, nrec=4000) if (length(dna) == 0L) break cat("processing chunk", i, "...\n") ## do something with 'dna' ... } ## With FASTQ files: files <- open_input_files(filepath5) i <- 0 while (TRUE) { i <- i + 1 ## Load 75 records at a time. reads <- readDNAStringSet(files, format="fastq", nrec=75) if (length(reads) == 0L) break cat("processing chunk", i, "...\n") ## do something with 'reads' ... } ## IMPORTANT NOTE: Like connections, the object returned by ## open_input_files() can NOT be shared across workers in the ## context of parallelization! ## --------------------------------------------------------------------- ## D. READ A FASTQ FILE AS A QualityScaledDNAStringSet OBJECT ## --------------------------------------------------------------------- ## Use readQualityScaledDNAStringSet() if you want the object to be ## returned as a QualityScaledDNAStringSet instead of a DNAStringSet ## object. See ?readQualityScaledDNAStringSet for more information. ## Note that readQualityScaledDNAStringSet() is a simple wrapper around ## readDNAStringSet() that does the following if the file contains ## "Phred quality scores" (which is the standard Sanger variant to ## assess reliability of a base call): reads <- readDNAStringSet(filepath5, format="fastq", with.qualities=TRUE) quals <- PhredQuality(mcols(reads)$qualities) QualityScaledDNAStringSet(reads, quals) ## The call to PhredQuality() is replaced with a call to SolexaQuality() ## or IlluminaQuality() if the quality scores are Solexa quality scores. ## --------------------------------------------------------------------- ## E. GENERATE FAKE READS AND WRITE THEM TO A FASTQ FILE ## --------------------------------------------------------------------- library(BSgenome.Celegans.UCSC.ce2) ## Create a "sliding window" on chr I: sw_start <- seq.int(1, length(Celegans$chrI)-50, by=50) sw <- Views(Celegans$chrI, start=sw_start, width=10) my_fake_reads <- as(sw, "XStringSet") my_fake_ids <- sprintf("ID%06d", seq_len(length(my_fake_reads))) names(my_fake_reads) <- my_fake_ids my_fake_reads ## Fake quality ';' will be assigned to each base in 'my_fake_reads': out2 <- tempfile() writeXStringSet(my_fake_reads, out2, format="fastq") ## Passing qualities thru the 'qualities' argument: my_fake_quals <- rep.int(BStringSet("DCBA@?>=<;"), length(my_fake_reads)) my_fake_quals out3 <- tempfile() writeXStringSet(my_fake_reads, out3, format="fastq", qualities=my_fake_quals) ## --------------------------------------------------------------------- ## F. SERIALIZATION ## --------------------------------------------------------------------- saveXStringSet(my_fake_reads, "my_fake_reads", dirpath=tempdir())## --------------------------------------------------------------------- ## A. READ/WRITE FASTA FILES ## --------------------------------------------------------------------- ## Read a non-compressed FASTA files: filepath1 <- system.file("extdata", "someORF.fa", package="Biostrings") fasta.seqlengths(filepath1, seqtype="DNA") x1 <- readDNAStringSet(filepath1) x1 ## Read a gzip-compressed FASTA file: filepath2 <- system.file("extdata", "someORF.fa.gz", package="Biostrings") fasta.seqlengths(filepath2, seqtype="DNA") x2 <- readDNAStringSet(filepath2) x2 ## Sanity check: stopifnot(identical(as.character(x1), as.character(x2))) ## Read 2 FASTA files at once: filepath3 <- system.file("extdata", "fastaEx.fa", package="Biostrings") fasta.seqlengths(c(filepath2, filepath3), seqtype="DNA") x23 <- readDNAStringSet(c(filepath2, filepath3)) x23 ## Sanity check: x3 <- readDNAStringSet(filepath3) stopifnot(identical(as.character(x23), as.character(c(x2, x3)))) ## Use a FASTA index to load only an arbitrary subset of sequences: filepath4 <- system.file("extdata", "dm3_upstream2000.fa.gz", package="Biostrings") fai <- fasta.index(filepath4, seqtype="DNA") head(fai) head(fai$desc) i <- sample(nrow(fai), 10) # randomly pick up 10 sequences x4 <- readDNAStringSet(fai[i, ]) ## Sanity check: stopifnot(identical(as.character(readDNAStringSet(filepath4)[i]), as.character(x4))) ## Write FASTA files: out23a <- tempfile() writeXStringSet(x23, out23a) out23b <- tempfile() writeXStringSet(x23, out23b, compress=TRUE) file.info(c(out23a, out23b))$size ## Sanity checks: stopifnot(identical(as.character(readDNAStringSet(out23a)), as.character(x23))) stopifnot(identical(readLines(out23a), readLines(out23b))) ## --------------------------------------------------------------------- ## B. READ/WRITE FASTQ FILES ## --------------------------------------------------------------------- filepath5 <- system.file("extdata", "s_1_sequence.txt", package="Biostrings") fastq.geometry(filepath5) ## The quality strings are ignored by default: reads <- readDNAStringSet(filepath5, format="fastq") reads mcols(reads) ## Use 'with.qualities=TRUE' to load them: reads <- readDNAStringSet(filepath5, format="fastq", with.qualities=TRUE) reads mcols(reads) mcols(reads)$qualities ## Each quality string contains one letter per nucleotide in the ## corresponding read: stopifnot(identical(width(mcols(reads)$qualities), width(reads))) ## Write the reads to a FASTQ file: outfile <- tempfile() writeXStringSet(reads, outfile, format="fastq") outfile2 <- tempfile() writeXStringSet(reads, outfile2, compress=TRUE, format="fastq") ## Sanity checks: stopifnot(identical(readLines(outfile), readLines(filepath5))) stopifnot(identical(readLines(outfile), readLines(outfile2))) ## --------------------------------------------------------------------- ## C. READ FILES BY CHUNK ## --------------------------------------------------------------------- ## readDNAStringSet() supports reading an arbitrary number of FASTA or ## FASTQ records at a time in a loop. This can be useful to process ## big FASTA or FASTQ files by chunk and thus avoids loading the entire ## file in memory. To achieve this the files to read from need to be ## opened with open_input_files() first. Note that open_input_files() ## accepts a vector of file paths and/or URLs. ## With FASTA files: files <- open_input_files(filepath4) i <- 0 while (TRUE) { i <- i + 1 ## Load 4000 records at a time. Each new call to readDNAStringSet() ## picks up where the previous call left. dna <- readDNAStringSet(files, nrec=4000) if (length(dna) == 0L) break cat("processing chunk", i, "...\n") ## do something with 'dna' ... } ## With FASTQ files: files <- open_input_files(filepath5) i <- 0 while (TRUE) { i <- i + 1 ## Load 75 records at a time. reads <- readDNAStringSet(files, format="fastq", nrec=75) if (length(reads) == 0L) break cat("processing chunk", i, "...\n") ## do something with 'reads' ... } ## IMPORTANT NOTE: Like connections, the object returned by ## open_input_files() can NOT be shared across workers in the ## context of parallelization! ## --------------------------------------------------------------------- ## D. READ A FASTQ FILE AS A QualityScaledDNAStringSet OBJECT ## --------------------------------------------------------------------- ## Use readQualityScaledDNAStringSet() if you want the object to be ## returned as a QualityScaledDNAStringSet instead of a DNAStringSet ## object. See ?readQualityScaledDNAStringSet for more information. ## Note that readQualityScaledDNAStringSet() is a simple wrapper around ## readDNAStringSet() that does the following if the file contains ## "Phred quality scores" (which is the standard Sanger variant to ## assess reliability of a base call): reads <- readDNAStringSet(filepath5, format="fastq", with.qualities=TRUE) quals <- PhredQuality(mcols(reads)$qualities) QualityScaledDNAStringSet(reads, quals) ## The call to PhredQuality() is replaced with a call to SolexaQuality() ## or IlluminaQuality() if the quality scores are Solexa quality scores. ## --------------------------------------------------------------------- ## E. GENERATE FAKE READS AND WRITE THEM TO A FASTQ FILE ## --------------------------------------------------------------------- library(BSgenome.Celegans.UCSC.ce2) ## Create a "sliding window" on chr I: sw_start <- seq.int(1, length(Celegans$chrI)-50, by=50) sw <- Views(Celegans$chrI, start=sw_start, width=10) my_fake_reads <- as(sw, "XStringSet") my_fake_ids <- sprintf("ID%06d", seq_len(length(my_fake_reads))) names(my_fake_reads) <- my_fake_ids my_fake_reads ## Fake quality ';' will be assigned to each base in 'my_fake_reads': out2 <- tempfile() writeXStringSet(my_fake_reads, out2, format="fastq") ## Passing qualities thru the 'qualities' argument: my_fake_quals <- rep.int(BStringSet("DCBA@?>=<;"), length(my_fake_reads)) my_fake_quals out3 <- tempfile() writeXStringSet(my_fake_reads, out3, format="fastq", qualities=my_fake_quals) ## --------------------------------------------------------------------- ## F. SERIALIZATION ## --------------------------------------------------------------------- saveXStringSet(my_fake_reads, "my_fake_reads", dirpath=tempdir())
The XStringSetList class is a virtual container for storing a list of XStringSet objects.
## Constructors: BStringSetList(..., use.names=TRUE) DNAStringSetList(..., use.names=TRUE) RNAStringSetList(..., use.names=TRUE) AAStringSetList(..., use.names=TRUE)## Constructors: BStringSetList(..., use.names=TRUE) DNAStringSetList(..., use.names=TRUE) RNAStringSetList(..., use.names=TRUE) AAStringSetList(..., use.names=TRUE)
... |
Character vector(s) (with no NAs), or XStringSet object(s), or XStringViews object(s) to be concatenated into a XStringSetList. |
use.names |
|
Concrete flavors of the XStringSetList container are the BStringSetList, DNAStringSetList, RNAStringSetList and AAStringSetList containers for storing a list of BStringSet, DNAStringSet, RNAStringSet and AAStringSet objects, respectively. These four containers are direct subclasses of XStringSetList with no additional slots. The XStringSetList class itself is virtual and has no constructor.
The XStringSetList class extends the List class defined
in the IRanges package. Using a less technical jargon, this just means
that an XStringSetList object is a list-like object that can be manipulated
like an ordinary list. Or, said otherwise, most of the operations that work
on an ordinary list (e.g. length, names, [, [[,
c, unlist, etc...) should work on an XStringSetList object.
In addition, Bioconductor specific list operations like
elementNROWS and
PartitioningByEnd (defined in the IRanges
package) are supported too.
H. Pagès
## ------------------------------------------------------------------------ ## A. THE XStringSetList CONSTRUCTORS ## ------------------------------------------------------------------------ dna1 <- c("AAA", "AC", "", "T", "GGATA") dna2 <- c("G", "TT", "C") x <- DNAStringSetList(dna1, dna2) x DNAStringSetList(DNAStringSet(dna1), DNAStringSet(dna2)) DNAStringSetList(dna1, DNAStringSet(dna2)) DNAStringSetList(DNAStringSet(dna1), dna2) DNAStringSetList(dna1, RNAStringSet(DNAStringSet(dna2))) DNAStringSetList(list(dna1, dna2)) DNAStringSetList(CharacterList(dna1, dna2)) ## Empty object (i.e. zero-length): DNAStringSetList() ## Not empty (length is 1): DNAStringSetList(character(0)) ## --------------------------------------------------------------------- ## B. UNLISTING AN XStringSetList OBJECT ## --------------------------------------------------------------------- length(x) elementNROWS(x) unlist(x) x[[1]] x[[2]] as.list(x) names(x) <- LETTERS[1:length(x)] x[["A"]] x[["B"]] as.list(x) # named list## ------------------------------------------------------------------------ ## A. THE XStringSetList CONSTRUCTORS ## ------------------------------------------------------------------------ dna1 <- c("AAA", "AC", "", "T", "GGATA") dna2 <- c("G", "TT", "C") x <- DNAStringSetList(dna1, dna2) x DNAStringSetList(DNAStringSet(dna1), DNAStringSet(dna2)) DNAStringSetList(dna1, DNAStringSet(dna2)) DNAStringSetList(DNAStringSet(dna1), dna2) DNAStringSetList(dna1, RNAStringSet(DNAStringSet(dna2))) DNAStringSetList(list(dna1, dna2)) DNAStringSetList(CharacterList(dna1, dna2)) ## Empty object (i.e. zero-length): DNAStringSetList() ## Not empty (length is 1): DNAStringSetList(character(0)) ## --------------------------------------------------------------------- ## B. UNLISTING AN XStringSetList OBJECT ## --------------------------------------------------------------------- length(x) elementNROWS(x) unlist(x) x[[1]] x[[2]] as.list(x) names(x) <- LETTERS[1:length(x)] x[["A"]] x[["B"]] as.list(x) # named list
The XStringViews class is the basic container for storing a set of views (start/end locations) on the same sequence (an XString object).
An XStringViews object contains a set of views (start/end locations) on the
same XString object called "the subject string"
or "the subject sequence" or simply "the subject".
Each view is defined by its start and end locations: both are
integers such that start <= end.
An XStringViews object is in fact a particular case of an
Views
object (the XStringViews class contains the
Views class) so it
can be manipulated in a similar manner: see
?Views for
more information.
Note that two views can overlap and that a view can be "out of limits"
i.e. it can start before the first letter of the subject or/and end
after its last letter.
Views(subject, start=NULL, end=NULL, width=NULL, names=NULL):See ?Views in the IRanges
package for the details.
All the accessor-like methods defined for Views objects
work on XStringViews objects. In addition, the following accessors are defined
for XStringViews objects:
nchar(x):A vector of non-negative integers containing the number
of letters in each view.
Values in nchar(x) coincide with values in width(x)
except for "out of limits" views where they are lower.
In the code snippets below,
x, object, e1 and e2 are XStringViews objects,
and i can be a numeric or logical vector.
e1 == e2:A vector of logicals indicating the result of the view by view comparison. The views in the shorter of the two XStringViews object being compared are recycled as necessary.
Like for comparison between XString objects, comparison between two XStringViews objects with subjects of different classes is not supported with one exception: when the subjects are DNAString and RNAString instances.
Also, like with XString objects, comparison between an XStringViews object with a BString subject and a character vector is supported (see examples below).
e1 != e2:Equivalent to !(e1 == e2).
as.character(x, use.names=TRUE, check.limits=TRUE):Converts x to a character vector of the same length as x.
The use.names argument controls whether or not names(x)
should be propagated to the names of the returned vector.
The check.limits argument controls whether or not an error
should be raised if x has "out of limit" views.
If check.limits is FALSE then "out of limit" views are
trimmed with a warning.
as.data.frame(x, row.names = NULL, optional = FALSE,
...)Equivalent of as.data.frame(as.character(x)).
as.matrix(x, use.names=TRUE):Returns a character matrix containing the "exploded" representation
of the views. Can only be used on an XStringViews object with
equal-width views.
The use.names argument controls whether or not names(x)
should be propagated to the row names of the returned matrix.
toString(x):Equivalent to toString(as.character(x)).
H. Pagès
Views-class,
gaps,
XString-class,
XStringSet-class,
letter,
MIndex-class
## One standard way to create an XStringViews object is to use ## the Views() constructor. ## Views on a DNAString object: s <- DNAString("-CTC-N") v4 <- Views(s, start=3:0, end=5:8) v4 subject(v4) length(v4) start(v4) end(v4) width(v4) ## Attach a comment to views #3 and #4: names(v4)[3:4] <- "out of limits" names(v4) ## A more programatical way to "tag" the "out of limits" views: names(v4)[start(v4) < 1 | nchar(subject(v4)) < end(v4)] <- "out of limits" ## or just: names(v4)[nchar(v4) < width(v4)] <- "out of limits" ## Two equivalent ways to extract a view as an XString object: s2a <- v4[[2]] s2b <- subseq(subject(v4), start=start(v4)[2], end=end(v4)[2]) identical(s2a, s2b) # TRUE ## It is an error to try to extract an "out of limits" view: #v4[[3]] # Error! v12 <- Views(DNAString("TAATAATG"), start=-2:9, end=0:11) v12 == DNAString("TAA") v12[v12 == v12[4]] v12[v12 == v12[1]] v12[3] == Views(RNAString("AU"), start=0, end=2) ## Here the first view doesn't even overlap with the subject: Views(BString("aaa--b"), start=-3:4, end=-3:4 + c(3:6, 6:3)) ## 'start' and 'end' are recycled: subject <- "abcdefghij" Views(subject, start=2:1, end=4) Views(subject, start=5:7, end=nchar(subject)) Views(subject, start=1, end=5:7) ## Applying gaps() to an XStringViews object: v2 <- Views("abCDefgHIJK", start=c(8, 3), end=c(14, 4)) gaps(v2) ## Coercion: as(v12, "XStringSet") # same as 'as(v12, "DNAStringSet")' rna <- as(v12, "RNAStringSet") as(rna, "Views")## One standard way to create an XStringViews object is to use ## the Views() constructor. ## Views on a DNAString object: s <- DNAString("-CTC-N") v4 <- Views(s, start=3:0, end=5:8) v4 subject(v4) length(v4) start(v4) end(v4) width(v4) ## Attach a comment to views #3 and #4: names(v4)[3:4] <- "out of limits" names(v4) ## A more programatical way to "tag" the "out of limits" views: names(v4)[start(v4) < 1 | nchar(subject(v4)) < end(v4)] <- "out of limits" ## or just: names(v4)[nchar(v4) < width(v4)] <- "out of limits" ## Two equivalent ways to extract a view as an XString object: s2a <- v4[[2]] s2b <- subseq(subject(v4), start=start(v4)[2], end=end(v4)[2]) identical(s2a, s2b) # TRUE ## It is an error to try to extract an "out of limits" view: #v4[[3]] # Error! v12 <- Views(DNAString("TAATAATG"), start=-2:9, end=0:11) v12 == DNAString("TAA") v12[v12 == v12[4]] v12[v12 == v12[1]] v12[3] == Views(RNAString("AU"), start=0, end=2) ## Here the first view doesn't even overlap with the subject: Views(BString("aaa--b"), start=-3:4, end=-3:4 + c(3:6, 6:3)) ## 'start' and 'end' are recycled: subject <- "abcdefghij" Views(subject, start=2:1, end=4) Views(subject, start=5:7, end=nchar(subject)) Views(subject, start=1, end=5:7) ## Applying gaps() to an XStringViews object: v2 <- Views("abCDefgHIJK", start=c(8, 3), end=c(14, 4)) gaps(v2) ## Coercion: as(v12, "XStringSet") # same as 'as(v12, "DNAStringSet")' rna <- as(v12, "RNAStringSet") as(rna, "Views")
This is a single character string containing DNA sequence of yeast chromosome number 1. The data were obtained from the Saccharomyces Genome Database (ftp://genome-ftp.stanford.edu/pub/yeast/data\_download/sequence/genomic\_sequence/chromosomes/fasta/).
Annotation based on data provided by Yeast Genome project.
Source data built:Yeast Genome data are built at various time intervals. Sources used were downloaded Fri Nov 21 14:00:47 2003 Package built: Fri Nov 21 14:00:47 2003
http://www.yeastgenome.org/DownloadContents.shtml
data(yeastSEQCHR1) nchar(yeastSEQCHR1)data(yeastSEQCHR1) nchar(yeastSEQCHR1)