| Title: | Batch annotation of the peaks identified from either ChIP-seq, ChIP-chip experiments, or any experiments that result in large number of genomic interval data |
|---|---|
| Description: | The package encompasses a range of functions for identifying the closest gene, exon, miRNA, or custom features—such as highly conserved elements and user-supplied transcription factor binding sites. Additionally, users can retrieve sequences around the peaks and obtain enriched Gene Ontology (GO) or Pathway terms. In version 2.0.5 and beyond, new functionalities have been introduced. These include features for identifying peaks associated with bi-directional promoters along with summary statistics (peaksNearBDP), summarizing motif occurrences in peaks (summarizePatternInPeaks), and associating additional identifiers with annotated peaks or enrichedGO (addGeneIDs). The package integrates with various other packages such as biomaRt, IRanges, Biostrings, BSgenome, GO.db, multtest, and stat to enhance its analytical capabilities. |
| Authors: | Lihua Julie Zhu, Jianhong Ou, Jun Yu, Kai Hu, Haibo Liu, Junhui Li, Hervé Pagès, Claude Gazin, Nathan Lawson, Ryan Thompson, Simon Lin, David Lapointe, Michael Green |
| Maintainer: | Jianhong Ou <[email protected]>, Lihua Julie Zhu <[email protected]>, Kai Hu <[email protected]>, Junhui Li <[email protected]> |
| License: | GPL (>= 2) |
| Version: | 3.46.0 |
| Built: | 2026-05-30 09:27:01 UTC |
| Source: | https://github.com/bioc/ChIPpeakAnno |
The package includes functions to retrieve the sequences around the peak, obtain enriched Gene Ontology (GO) terms, find the nearest gene, exon, miRNA or custom features such as most conserved elements and other transcription factor binding sites leveraging biomaRt, IRanges, Biostrings, BSgenome, GO.db, hypergeometric test phyper and multtest package.
| Package: | ChIPpeakAnno |
| Type: | Package |
| Version: | 3.0.0 |
| Date: | 2014-10-24 |
| License: | LGPL |
| LazyLoad: | yes |
Lihua Julie Zhu, Jianhong Ou, Hervé Pagès, Claude Gazin, Nathan Lawson, Simon Lin, David Lapointe and Michael Green
Maintainer: Jianhong Ou <[email protected]>, Lihua Julie Zhu <[email protected]>
1. Y. Benjamini and Y. Hochberg (1995). Controlling the false
discovery rate: a practical and powerful approach to multiple testing. J. R.
Statist. Soc. B. Vol. 57: 289-300.
2. Y. Benjamini and D. Yekutieli
(2001). The control of the false discovery rate in multiple hypothesis
testing under dependency. Annals of Statistics. Accepted.
3. S. Durinck
et al. (2005) BioMart and Bioconductor: a powerful link between biological
biomarts and microarray data analysis. Bioinformatics, 21, 3439-3440.
4.
S. Dudoit, J. P. Shaffer, and J. C. Boldrick (Submitted). Multiple
hypothesis testing in microarray experiments.
5. Y. Ge, S. Dudoit, and
T. P. Speed. Resampling-based multiple testing for microarray data
hypothesis, Technical Report #633 of UCB Stat.
http://www.stat.berkeley.edu/~gyc
6. Y. Hochberg (1988). A sharper
Bonferroni procedure for multiple tests of significance, Biometrika. Vol.
75: 800-802.
7. S. Holm (1979). A simple sequentially rejective multiple
test procedure. Scand. J. Statist.. Vol. 6: 65-70.
8. N. L. Johnson,S.
Kotz and A. W. Kemp (1992) Univariate Discrete Distributions, Second
Edition. New York: Wiley
9. Zhu L.J. et al. (2010) ChIPpeakAnno: a
Bioconductor package to annotate ChIP-seq and ChIP-chip data. BMC
Bioinformatics 2010, 11:237doi:10.1186/1471-2105-11-237.
if(interactive()){ data(myPeakList) library(ensembldb) library(EnsDb.Hsapiens.v75) anno <- annoGR(EnsDb.Hsapiens.v75) annotatedPeak <- annotatePeakInBatch(myPeakList[1:6], AnnotationData=anno) }if(interactive()){ data(myPeakList) library(ensembldb) library(EnsDb.Hsapiens.v75) anno <- annoGR(EnsDb.Hsapiens.v75) annotatedPeak <- annotatePeakInBatch(myPeakList[1:6], AnnotationData=anno) }
Add GO IDs of the ancestors for a given vector of GO IDs leveraging GO.db
addAncestors(go.ids, ontology = c("bp", "cc", "mf"))addAncestors(go.ids, ontology = c("bp", "cc", "mf"))
go.ids |
A matrix with 4 columns: first column is GO IDs and 4th column is entrez IDs. |
ontology |
bp for biological process, cc for cellular component and mf for molecular function. |
A vector of GO IDs containing the input GO IDs with the GO IDs of their ancestors added.
Lihua Julie Zhu
go.ids = cbind(c("GO:0008150", "GO:0005576", "GO:0003674"), c("ND", "IDA", "ND"), c("BP", "BP", "BP"), c("1", "1", "1")) library(GO.db) addAncestors(go.ids, ontology="bp")go.ids = cbind(c("GO:0008150", "GO:0005576", "GO:0003674"), c("ND", "IDA", "ND"), c("BP", "BP", "BP"), c("1", "1", "1")) library(GO.db) addAncestors(go.ids, ontology="bp")
Add common IDs to annotated peaks such as gene symbol, entrez ID, ensemble gene id and refseq id leveraging organism annotation dataset. For example, org.Hs.eg.db is the dataset from orgs.Hs.eg.db package for human, while org.Mm.eg.db is the dataset from the org.Mm.eg.db package for mouse.
addGeneIDs( annotatedPeak, orgAnn, IDs2Add = c("symbol"), feature_id_type = "ensembl_gene_id", silence = TRUE, mart )addGeneIDs( annotatedPeak, orgAnn, IDs2Add = c("symbol"), feature_id_type = "ensembl_gene_id", silence = TRUE, mart )
annotatedPeak |
GRanges or a vector of feature IDs. |
orgAnn |
organism annotation dataset such as org.Hs.eg.db. |
IDs2Add |
a vector of annotation identifiers to be added |
feature_id_type |
type of ID to be annotated, default is ensembl_gene_id |
silence |
TRUE or FALSE. If TRUE, will not show unmapped entrez id for feature ids. |
mart |
mart object, see useMart of biomaRt package for details |
One of orgAnn and mart should be assigned.
If orgAnn is given, parameter feature_id_type should be ensemble_gene_id, entrez_id, gene_symbol, gene_alias or refseq_id. And parameter IDs2Add can be set to any combination of identifiers such as "accnum", "ensembl", "ensemblprot", "ensembltrans", "entrez_id", "enzyme", "genename", "pfam", "pmid", "prosite", "refseq", "symbol", "unigene" and "uniprot". Some IDs are unique to an organism, such as "omim" for org.Hs.eg.db and "mgi" for org.Mm.eg.db.
Here is the definition of different IDs :
accnum: GenBank accession numbers
ensembl: Ensembl gene accession numbers
ensemblprot: Ensembl protein accession numbers
ensembltrans: Ensembl transcript accession numbers
entrez_id: entrez gene identifiers
enzyme: EC numbers
genename: gene name
pfam: Pfam identifiers
pmid: PubMed identifiers
prosite: PROSITE identifiers
refseq: RefSeq identifiers
symbol: gene abbreviations
unigene: UniGene cluster identifiers
uniprot: Uniprot accession numbers
omim: OMIM(Mendelian Inheritance in Man) identifiers
mgi: Jackson Laboratory MGI gene accession numbers
If mart is used instead of orgAnn, for valid parameter feature_id_type and IDs2Add parameters, please refer to getBM in bioMart package. Parameter feature_id_type should be one valid filter name listed by listFilters(mart) such as ensemble_gene_id. And parameter IDs2Add should be one or more valid attributes name listed by listAttributes(mart) such as external_gene_id, entrezgene, wikigene_name, or mirbase_transcript_name.
GRanges if the input is a GRanges or dataframe if input is a vector.
Jianhong Ou, Lihua Julie Zhu
http://www.bioconductor.org/packages/release/data/annotation/
getBM, AnnotationDb
data(annotatedPeak) library(org.Hs.eg.db) addGeneIDs(annotatedPeak[1:6,],orgAnn="org.Hs.eg.db", IDs2Add=c("symbol","omim")) ##addGeneIDs(annotatedPeak$feature[1:6],orgAnn="org.Hs.eg.db", ## IDs2Add=c("symbol","genename")) if(interactive()){ mart <- useMart("ENSEMBL_MART_ENSEMBL",host="www.ensembl.org", dataset="hsapiens_gene_ensembl") ##mart <- useMart(biomart="ensembl",dataset="hsapiens_gene_ensembl") addGeneIDs(annotatedPeak[1:6,], mart=mart, IDs2Add=c("hgnc_symbol","entrezgene")) }data(annotatedPeak) library(org.Hs.eg.db) addGeneIDs(annotatedPeak[1:6,],orgAnn="org.Hs.eg.db", IDs2Add=c("symbol","omim")) ##addGeneIDs(annotatedPeak$feature[1:6],orgAnn="org.Hs.eg.db", ## IDs2Add=c("symbol","genename")) if(interactive()){ mart <- useMart("ENSEMBL_MART_ENSEMBL",host="www.ensembl.org", dataset="hsapiens_gene_ensembl") ##mart <- useMart(biomart="ensembl",dataset="hsapiens_gene_ensembl") addGeneIDs(annotatedPeak[1:6,], mart=mart, IDs2Add=c("hgnc_symbol","entrezgene")) }
Add metadata to to overlapping peaks after calling findOverlapsOfPeaks.
addMetadata(ol, colNames = NULL, FUN = c, ...)addMetadata(ol, colNames = NULL, FUN = c, ...)
ol |
An object of overlappingPeaks, which is output of findOverlapsOfPeaks. |
colNames |
Names of metadata column to be added. If it is NULL, addMetadata will guess what to add. |
FUN |
A function to be called |
... |
Arguments to the function call. |
return value is An object of overlappingPeaks.
Jianhong Ou
See Also as findOverlapsOfPeaks
peaks1 <- GRanges(seqnames=c(6,6,6,6,5), IRanges(start=c(1543200,1557200,1563000,1569800,167889600), end=c(1555199,1560599,1565199,1573799,167893599), names=c("p1","p2","p3","p4","p5")), strand="+", score=1:5, id=letters[1:5]) peaks2 <- GRanges(seqnames=c(6,6,6,6,5), IRanges(start=c(1549800,1554400,1565000,1569400,167888600), end=c(1550599,1560799,1565399,1571199,167888999), names=c("f1","f2","f3","f4","f5")), strand="+", score=6:10, id=LETTERS[1:5]) ol <- findOverlapsOfPeaks(peaks1, peaks2) addMetadata(ol)peaks1 <- GRanges(seqnames=c(6,6,6,6,5), IRanges(start=c(1543200,1557200,1563000,1569800,167889600), end=c(1555199,1560599,1565199,1573799,167893599), names=c("p1","p2","p3","p4","p5")), strand="+", score=1:5, id=letters[1:5]) peaks2 <- GRanges(seqnames=c(6,6,6,6,5), IRanges(start=c(1549800,1554400,1565000,1569400,167888600), end=c(1550599,1560799,1565399,1571199,167888999), names=c("f1","f2","f3","f4","f5")), strand="+", score=6:10, id=LETTERS[1:5]) ol <- findOverlapsOfPeaks(peaks1, peaks2) addMetadata(ol)
annoGR
An object of class annoGR represents the annotation data could be
used by annotationPeakInBatch.
## S4 method for signature 'annoGR' info(object) ## S4 method for signature 'GRanges' annoGR(ranges, feature = "group", date, ...) ## S4 method for signature 'TxDb' annoGR( ranges, feature = c("gene", "transcript", "exon", "CDS", "fiveUTR", "threeUTR", "tRNAs", "geneModel"), date, source, mdata, OrganismDb ) ## S4 method for signature 'EnsDb' annoGR( ranges, feature = c("gene", "transcript", "exon", "disjointExons"), date, source, mdata )## S4 method for signature 'annoGR' info(object) ## S4 method for signature 'GRanges' annoGR(ranges, feature = "group", date, ...) ## S4 method for signature 'TxDb' annoGR( ranges, feature = c("gene", "transcript", "exon", "CDS", "fiveUTR", "threeUTR", "tRNAs", "geneModel"), date, source, mdata, OrganismDb ) ## S4 method for signature 'EnsDb' annoGR( ranges, feature = c("gene", "transcript", "exon", "disjointExons"), date, source, mdata )
object |
annoGR object. |
ranges |
|
feature |
annotation type |
date |
a Date object |
... |
could be following parameters |
source |
character, where the annotation comes from |
mdata |
data frame, metadata from annotation |
OrganismDb |
an object of OrganismDb. It is used for extracting gene symbol for geneModel group for TxDb |
seqnames,ranges,strand,elementMetadata,seqinfoslots inherit from GRanges. The ranges must have unique names.
sourcecharacter, where the annotation comes from
datea Date object
featureannotation type, could be "gene", "exon", "transcript", "CDS", "fiveUTR", "threeUTR", "microRNA", "tRNAs", "geneModel" for TxDb object, or "gene", "exon", "transcript" for EnsDb object
mdatadata frame, metadata from annotation
Objects can be created by calls of the form
new("annoGR", date, elementMetadata, feature, mdata, ranges, seqinfo,
seqnames, source, strand)
Jianhong Ou
if(interactive() || Sys.getenv("USER")=="jou"){ library(EnsDb.Hsapiens.v79) anno <- annoGR(EnsDb.Hsapiens.v79) }if(interactive() || Sys.getenv("USER")=="jou"){ library(EnsDb.Hsapiens.v79) anno <- annoGR(EnsDb.Hsapiens.v79) }
Annotate peaks by annoGR object in the given range.
annoPeaks( peaks, annoData, bindingType = c("nearestBiDirectionalPromoters", "startSite", "endSite", "fullRange"), bindingRegion = c(-5000, 5000), ignore.peak.strand = TRUE, select = c("all", "bestOne"), ... )annoPeaks( peaks, annoData, bindingType = c("nearestBiDirectionalPromoters", "startSite", "endSite", "fullRange"), bindingRegion = c(-5000, 5000), ignore.peak.strand = TRUE, select = c("all", "bestOne"), ... )
peaks |
peak list, GRanges object |
annoData |
annotation data, GRanges object |
bindingType |
Specifying the criteria to associate peaks with annotation. Here is how to use it together with the parameter bindingRegion
|
bindingRegion |
Annotation range used together with bindingType, which is a vector with two integer values, default to c (-5000, 5000). The first one must be no bigger than 0, which means upstream. And the sec ond one must be no less than 1, which means downstream (1 is the site position, 2 is the next base of the site position). For details, see bindingType. |
ignore.peak.strand |
ignore the peaks strand or not. |
select |
"all" or "bestOne". Return the annotation containing all or the best one. The "bestOne" is selected by the shortest distance to the sites and then similarity between peak and annotations. Ignored if bindingType is nearestBiDirectionalPromoters. |
... |
Not used. |
Output is a GRanges object of the annotated peaks.
Jianhong Ou
See Also as annotatePeakInBatch
library(ensembldb) library(EnsDb.Hsapiens.v75) data("myPeakList") annoGR <- toGRanges(EnsDb.Hsapiens.v75) seqlevelsStyle(myPeakList) <- seqlevelsStyle(annoGR) annoPeaks(myPeakList, annoGR)library(ensembldb) library(EnsDb.Hsapiens.v75) data("myPeakList") annoGR <- toGRanges(EnsDb.Hsapiens.v75) seqlevelsStyle(myPeakList) <- seqlevelsStyle(annoGR) annoPeaks(myPeakList, annoGR)
TSS annotated putative STAT1-binding regions that are identified in un-stimulated cells using ChIP-seq technology (Robertson et al., 2007)
annotatedPeakannotatedPeak
GRanges with slot start holding the start position of the peak, slot end holding the end position of the peak, slot names holding the id of the peak, slot strand holding the strands and slot space holding the chromosome location where the peak is located. In addition, the following variables are included.
id of the feature such as ensembl gene ID
upstream: peak resides upstream of the feature; downstream: peak resides downstream of the feature; inside: peak resides inside the feature; overlapStart: peak overlaps with the start of the feature; overlapEnd: peak overlaps with the end of the feature; includeFeature: peak include the feature entirely
distance to the nearest feature such as transcription start site
start position of the feature such as gene
end position of the feature such as the gene
obtained by data(TSS.human.GRCh37)
data(myPeakList)
annotatePeakInBatch(myPeakList, AnnotationData = TSS.human.GRCh37, output="b", multiple=F)
data(annotatedPeak) head(annotatedPeak, 4) # show first 4 ranges if (interactive() || Sys.getenv("USER")=="jou") { y = annotatedPeak$distancetoFeature[!is.na(annotatedPeak$distancetoFeature)] hist(as.numeric(as.character(y)), xlab="Distance To Nearest TSS", main="", breaks=1000, ylim=c(0, 50), xlim=c(min(as.numeric(as.character(y)))-100, max(as.numeric(as.character(y)))+100)) }data(annotatedPeak) head(annotatedPeak, 4) # show first 4 ranges if (interactive() || Sys.getenv("USER")=="jou") { y = annotatedPeak$distancetoFeature[!is.na(annotatedPeak$distancetoFeature)] hist(as.numeric(as.character(y)), xlab="Distance To Nearest TSS", main="", breaks=1000, ylim=c(0, 50), xlim=c(min(as.numeric(as.character(y)))-100, max(as.numeric(as.character(y)))+100)) }
Obtain the distance to the nearest TSS, miRNA, exon et al for a list of peak locations leveraging IRanges and biomaRt package
annotatePeakInBatch( myPeakList, mart, featureType = c("TSS", "miRNA", "Exon"), AnnotationData, output = c("nearestLocation", "overlapping", "both", "shortestDistance", "inside", "upstream&inside", "inside&downstream", "upstream", "downstream", "upstreamORdownstream", "nearestBiDirectionalPromoters"), multiple = c(TRUE, FALSE), maxgap = -1L, PeakLocForDistance = c("start", "middle", "end", "endMinusStart"), FeatureLocForDistance = c("TSS", "middle", "start", "end", "geneEnd"), select = c("all", "first", "last", "arbitrary"), ignore.strand = TRUE, bindingRegion = NULL, ... )annotatePeakInBatch( myPeakList, mart, featureType = c("TSS", "miRNA", "Exon"), AnnotationData, output = c("nearestLocation", "overlapping", "both", "shortestDistance", "inside", "upstream&inside", "inside&downstream", "upstream", "downstream", "upstreamORdownstream", "nearestBiDirectionalPromoters"), multiple = c(TRUE, FALSE), maxgap = -1L, PeakLocForDistance = c("start", "middle", "end", "endMinusStart"), FeatureLocForDistance = c("TSS", "middle", "start", "end", "geneEnd"), select = c("all", "first", "last", "arbitrary"), ignore.strand = TRUE, bindingRegion = NULL, ... )
myPeakList |
A GRanges object |
mart |
A mart object, used if AnnotationData is not supplied, see useMart of bioMaRt package for details |
featureType |
A charcter vector used with mart argument if AnnotationData is not supplied; choose from "TSS", "miRNA" or "Exon" |
AnnotationData |
A GRanges or annoGR object. It can be obtained from the function getAnnotation or customized annotation of class GRanges containing additional variable: strand (1 or + for plus strand and -1 or - for minus strand). Pre-compliled annotations, such as TSS.human.NCBI36, TSS.mouse.NCBIM37, TSS.rat.RGSC3.4 and TSS.zebrafish.Zv8, are provided by this package (attach them with data() function). Another method to provide annotation data is to obtain through biomaRt in real time by using the mart and featureType option |
output |
|
multiple |
Not applicable when output is nearest. TRUE: output multiple overlapping features for each peak. FALSE: output at most one overlapping feature for each peak. This parameter is kept for backward compatibility, please use select. |
maxgap |
The maximum gap that is allowed between 2 ranges for the ranges to be considered as overlapping. The gap between 2 ranges is the number of positions that separate them. The gap between 2 adjacent ranges is 0. By convention when one range has its start or end strictly inside the other (i.e. non-disjoint ranges), the gap is considered to be -1. |
PeakLocForDistance |
Specify the location of peak for calculating distance,i.e., middle means using middle of the peak to calculate distance to feature, start means using start of the peak to calculate the distance to feature, endMinusStart means using the end of the peak to calculate the distance to features on plus strand and the start of the peak to calculate the distance to features on minus strand. To be compatible with previous version, by default using start |
FeatureLocForDistance |
Specify the location of feature for calculating distance,i.e., middle means using middle of the feature to calculate distance of peak to feature, start means using start of the feature to calculate the distance to feature, TSS means using start of feature when feature is on plus strand and using end of feature when feature is on minus strand, geneEnd means using end of feature when feature is on plus strand and using start of feature when feature is on minus strand. To be compatible with previous version, by default using TSS |
select |
"all" may return multiple overlapping peaks, "first" will return the first overlapping peak, "last" will return the last overlapping peak and "arbitrary" will return one of the overlapping peaks. |
ignore.strand |
When set to TRUE, the strand information is ignored in the annotation. Unless you have stranded peaks and you are interested in annotating peaks to the features in the same strand only, you should just use the default setting ignore.strand = TRUE. |
bindingRegion |
Annotation range used for annoPeaks, which is a vector with two integer values, default to c (-5000, 5000). The first one must be no bigger than 0. And the sec ond one must be no less than 1. Once bindingRegion is defined, annotation will based on annoPeaks. Here is how to use it together with the parameter output and FeatureLocForDistance.
For details, see annoPeaks. |
... |
Parameters could be passed to annoPeaks |
An object of GRanges with slot start holding the start position of the peak, slot end holding the end position of the peak, slot space holding the chromosome location where the peak is located, slot rownames holding the id of the peak. In addition, the following variables are included.
list("feature") |
id of the feature such as ensembl gene ID |
list("insideFeature") |
upstream: peak resides upstream of the feature; downstream: peak resides downstream of the feature; inside: peak resides inside the feature; overlapStart: peak overlaps with the start of the feature; overlapEnd: peak overlaps with the end of the feature; includeFeature: peak include the feature entirely |
list("distancetoFeature") |
distance to the nearest feature such as transcription start site. By default, the distance is calculated as the distance between the start of the binding site and the TSS that is the gene start for genes located on the forward strand and the gene end for genes located on the reverse strand. The user can specify the location of peak and location of feature for calculating this |
list("start_position") |
start position of the feature such as gene |
list("end_position") |
end position of the feature such as the gene |
list("strand") |
1 or + for positive strand and -1 or - for negative strand where the feature is located |
list("shortestDistance") |
The shortest distance from either end of peak to either end the feature. |
list("fromOverlappingOrNearest") |
Relevant only when output is set to "both". If "nearestLocation": indicates this feature's start (feature's end for features from minus strand) is the closest to the peak start ("strictly nearest" or "nearest overlapping"); if "Overlapping": indicates this feature overlaps with this peak although it is not the nearest (non-nearest overlapping) |
Lihua Julie Zhu, Jianhong Ou
1. Zhu L.J. et al. (2010) ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data. BMC Bioinformatics 2010, 11:237doi:10.1186/1471-2105-11-237
2. Zhu L (2013). "Integrative analysis of ChIP-chip and ChIP-seq dataset." In Lee T and Luk ACS (eds.), Tilling Arrays, volume 1067, chapter 4, pp. -19. Humana Press. http://dx.doi.org/10.1007/978-1-62703-607-8_8
getAnnotation, findOverlappingPeaks, makeVennDiagram, addGeneIDs, peaksNearBDP, summarizePatternInPeaks, annoGR, annoPeaks
## example 1: annotate myPeakList by TxDb or EnsDb. data(myPeakList) library(ensembldb) library(EnsDb.Hsapiens.v75) annoData <- annoGR(EnsDb.Hsapiens.v75) annotatePeak = annotatePeakInBatch(myPeakList[1:6], AnnotationData=annoData) annotatePeak ## example 2: annotate myPeakList (GRanges) ## with TSS.human.NCBI36 (Granges) data(TSS.human.NCBI36) annotatedPeak = annotatePeakInBatch(myPeakList[1:6], AnnotationData=TSS.human.NCBI36) annotatedPeak ## example 3: you have a list of transcription factor biding sites from ## literature and are interested in determining the extent of the overlap ## to the list of peaks from your experiment. Prior calling the function ## annotatePeakInBatch, need to represent both dataset as GRanges ## where start is the start of the binding site, end is the end of the ## binding site, names is the name of the binding site, space and strand ## are the chromosome name and strand where the binding site is located. myexp <- GRanges(seqnames=c(6,6,6,6,5,4,4), IRanges(start=c(1543200,1557200,1563000,1569800, 167889600,100,1000), end=c(1555199,1560599,1565199,1573799, 167893599,200,1200), names=c("p1","p2","p3","p4","p5","p6", "p7")), strand="+") literature <- GRanges(seqnames=c(6,6,6,6,5,4,4), IRanges(start=c(1549800,1554400,1565000,1569400, 167888600,120,800), end=c(1550599,1560799,1565399,1571199, 167888999,140,1400), names=c("f1","f2","f3","f4","f5","f6","f7")), strand=rep(c("+", "-"), c(5, 2))) annotatedPeak1 <- annotatePeakInBatch(myexp, AnnotationData=literature) pie(table(annotatedPeak1$insideFeature)) annotatedPeak1 ### use toGRanges or rtracklayer::import to convert BED or GFF format ### to GRanges before calling annotatePeakInBatch test.bed <- data.frame(space=c("4", "6"), start=c("100", "1000"), end=c("200", "1100"), name=c("peak1", "peak2")) test.GR = toGRanges(test.bed) annotatePeakInBatch(test.GR, AnnotationData = literature) library(testthat) peak <- GRanges(seqnames = "chr1", IRanges(start = 24736757, end=24737528, names = "testPeak")) data(TSS.human.GRCh37) TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001461"] # GRanges object with 1 range and 1 metadata column: # seqnames ranges strand | description #<Rle> <IRanges> <Rle> | <character> # ENSG00000001461 1 24742285-24799466 + | NIPA-like domain con.. peak #GRanges object with 1 range and 0 metadata columns: # seqnames ranges strand #<Rle> <IRanges> <Rle> # testPeak chr1 24736757-24737528 * TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001460"] #GRanges object with 1 range and 1 metadata column: # seqnames ranges strand | description #<Rle> <IRanges> <Rle> | <character> # ENSG00000001460 1 24683490-24743424 - | UPF0490 protein C1or.. ap <- annotatePeakInBatch(peak, Annotation=TSS.human.GRCh37, PeakLocForDistance = "start") stopifnot(ap$feature=="ENSG00000001461") ap <- annotatePeakInBatch(peak, Annotation=TSS.human.GRCh37, PeakLocForDistance = "end") stopifnot(ap$feature=="ENSG00000001461") ap <- annotatePeakInBatch(peak, Annotation=TSS.human.GRCh37, PeakLocForDistance = "middle") stopifnot(ap$feature=="ENSG00000001461") ap <- annotatePeakInBatch(peak, Annotation=TSS.human.GRCh37, PeakLocForDistance = "endMinusStart") stopifnot(ap$feature=="ENSG00000001461") ## Let's calculate the distances between the peak and the TSS of the genes ## in the annotation file used for annotating the peaks. ## Please note that we need to compute the distance using the annotation ## file TSS.human.GRCh37. ## If you would like to use TxDb.Hsapiens.UCSC.hg19.knownGene, ## then you will need to annotate the peaks ## using TxDb.Hsapiens.UCSC.hg19.knownGene as well. ### using start start(peak) -start(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001461"]) #picked #[1] -5528 start(peak) -end(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001460"]) #[1] -6667 #### using middle (start(peak) + end(peak))/2 - start(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001461"]) #[1] -5142.5 (start(peak) + end(peak))/2 - end(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001460"]) # [1] 49480566 end(peak) -start(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001461"]) #picked # [1] -4757 end(peak) -end(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001460"]) # [1] -5896 #### using endMinusStart end(peak) - start(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001461"]) ## picked # [1] -4575 start(peak) -end(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001460"]) #[1] -6667 ###### using txdb object to annotate the peaks library(org.Hs.eg.db) select(org.Hs.eg.db, key="STPG1", keytype="SYMBOL", columns=c("ENSEMBL", "ENTREZID", "SYMBOL")) # SYMBOL ENSEMBL ENTREZID # STPG1 ENSG00000001460 90529 select(org.Hs.eg.db, key= "ENSG00000001461", keytype="ENSEMBL", columns=c("ENSEMBL", "ENTREZID", "SYMBOL")) #ENSEMBL ENTREZID SYMBOL # ENSG00000001461 57185 NIPAL3 require(TxDb.Hsapiens.UCSC.hg19.knownGene) txdb.ann.current <- genes(TxDb.Hsapiens.UCSC.hg19.knownGene) # note: the annotation of STPG1 shifted from old version # here we set the old one for the test txdb.ann <- GRanges('chr1', IRanges(start=c(24683489, 24742245), end=c(24741587, 24799473)), strand=c('-', '+'), gene_id=c('90529', '57185')) names(txdb.ann) <- txdb.ann$gene_id STPG1 <- select(org.Hs.eg.db, key="STPG1", keytype="SYMBOL", columns=c( "SYMBOL", "ENSEMBL", "ENTREZID"))[1,3] NIPAL3 <- select(org.Hs.eg.db, key="NIPAL3", keytype="SYMBOL", columns=c( "SYMBOL", "ENSEMBL", "ENTREZID"))[1,3] ap <- annotatePeakInBatch(peak, Annotation=txdb.ann, PeakLocForDistance = "start") expect_equal(ap$feature, STPG1) ap <- annotatePeakInBatch(peak, Annotation=txdb.ann, PeakLocForDistance = "end") expect_equal(ap$feature, STPG1) ap <- annotatePeakInBatch(peak, Annotation=txdb.ann, PeakLocForDistance = "middle") expect_equal(ap$feature, STPG1) ap <- annotatePeakInBatch(peak, Annotation=txdb.ann, PeakLocForDistance = "endMinusStart") expect_equal(ap$feature, NIPAL3) txdb.ann.current[NIPAL3] txdb.ann[txdb.ann$gene_id == NIPAL3] # GRanges object with 1 range and 1 metadata column: # seqnames ranges strand | gene_id # <Rle> <IRanges> <Rle> | <character> # 57185 chr1 24742245-24799473 + | 57185 #------- txdb.ann.current[STPG1] txdb.ann[txdb.ann$gene_id == STPG1] # GRanges object with 1 range and 1 metadata column: # seqnames ranges strand | gene_id # <Rle> <IRanges> <Rle> | <character> # 90529 chr1 24683489-24741587 - | 90529## example 1: annotate myPeakList by TxDb or EnsDb. data(myPeakList) library(ensembldb) library(EnsDb.Hsapiens.v75) annoData <- annoGR(EnsDb.Hsapiens.v75) annotatePeak = annotatePeakInBatch(myPeakList[1:6], AnnotationData=annoData) annotatePeak ## example 2: annotate myPeakList (GRanges) ## with TSS.human.NCBI36 (Granges) data(TSS.human.NCBI36) annotatedPeak = annotatePeakInBatch(myPeakList[1:6], AnnotationData=TSS.human.NCBI36) annotatedPeak ## example 3: you have a list of transcription factor biding sites from ## literature and are interested in determining the extent of the overlap ## to the list of peaks from your experiment. Prior calling the function ## annotatePeakInBatch, need to represent both dataset as GRanges ## where start is the start of the binding site, end is the end of the ## binding site, names is the name of the binding site, space and strand ## are the chromosome name and strand where the binding site is located. myexp <- GRanges(seqnames=c(6,6,6,6,5,4,4), IRanges(start=c(1543200,1557200,1563000,1569800, 167889600,100,1000), end=c(1555199,1560599,1565199,1573799, 167893599,200,1200), names=c("p1","p2","p3","p4","p5","p6", "p7")), strand="+") literature <- GRanges(seqnames=c(6,6,6,6,5,4,4), IRanges(start=c(1549800,1554400,1565000,1569400, 167888600,120,800), end=c(1550599,1560799,1565399,1571199, 167888999,140,1400), names=c("f1","f2","f3","f4","f5","f6","f7")), strand=rep(c("+", "-"), c(5, 2))) annotatedPeak1 <- annotatePeakInBatch(myexp, AnnotationData=literature) pie(table(annotatedPeak1$insideFeature)) annotatedPeak1 ### use toGRanges or rtracklayer::import to convert BED or GFF format ### to GRanges before calling annotatePeakInBatch test.bed <- data.frame(space=c("4", "6"), start=c("100", "1000"), end=c("200", "1100"), name=c("peak1", "peak2")) test.GR = toGRanges(test.bed) annotatePeakInBatch(test.GR, AnnotationData = literature) library(testthat) peak <- GRanges(seqnames = "chr1", IRanges(start = 24736757, end=24737528, names = "testPeak")) data(TSS.human.GRCh37) TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001461"] # GRanges object with 1 range and 1 metadata column: # seqnames ranges strand | description #<Rle> <IRanges> <Rle> | <character> # ENSG00000001461 1 24742285-24799466 + | NIPA-like domain con.. peak #GRanges object with 1 range and 0 metadata columns: # seqnames ranges strand #<Rle> <IRanges> <Rle> # testPeak chr1 24736757-24737528 * TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001460"] #GRanges object with 1 range and 1 metadata column: # seqnames ranges strand | description #<Rle> <IRanges> <Rle> | <character> # ENSG00000001460 1 24683490-24743424 - | UPF0490 protein C1or.. ap <- annotatePeakInBatch(peak, Annotation=TSS.human.GRCh37, PeakLocForDistance = "start") stopifnot(ap$feature=="ENSG00000001461") ap <- annotatePeakInBatch(peak, Annotation=TSS.human.GRCh37, PeakLocForDistance = "end") stopifnot(ap$feature=="ENSG00000001461") ap <- annotatePeakInBatch(peak, Annotation=TSS.human.GRCh37, PeakLocForDistance = "middle") stopifnot(ap$feature=="ENSG00000001461") ap <- annotatePeakInBatch(peak, Annotation=TSS.human.GRCh37, PeakLocForDistance = "endMinusStart") stopifnot(ap$feature=="ENSG00000001461") ## Let's calculate the distances between the peak and the TSS of the genes ## in the annotation file used for annotating the peaks. ## Please note that we need to compute the distance using the annotation ## file TSS.human.GRCh37. ## If you would like to use TxDb.Hsapiens.UCSC.hg19.knownGene, ## then you will need to annotate the peaks ## using TxDb.Hsapiens.UCSC.hg19.knownGene as well. ### using start start(peak) -start(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001461"]) #picked #[1] -5528 start(peak) -end(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001460"]) #[1] -6667 #### using middle (start(peak) + end(peak))/2 - start(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001461"]) #[1] -5142.5 (start(peak) + end(peak))/2 - end(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001460"]) # [1] 49480566 end(peak) -start(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001461"]) #picked # [1] -4757 end(peak) -end(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001460"]) # [1] -5896 #### using endMinusStart end(peak) - start(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001461"]) ## picked # [1] -4575 start(peak) -end(TSS.human.GRCh37[names(TSS.human.GRCh37)== "ENSG00000001460"]) #[1] -6667 ###### using txdb object to annotate the peaks library(org.Hs.eg.db) select(org.Hs.eg.db, key="STPG1", keytype="SYMBOL", columns=c("ENSEMBL", "ENTREZID", "SYMBOL")) # SYMBOL ENSEMBL ENTREZID # STPG1 ENSG00000001460 90529 select(org.Hs.eg.db, key= "ENSG00000001461", keytype="ENSEMBL", columns=c("ENSEMBL", "ENTREZID", "SYMBOL")) #ENSEMBL ENTREZID SYMBOL # ENSG00000001461 57185 NIPAL3 require(TxDb.Hsapiens.UCSC.hg19.knownGene) txdb.ann.current <- genes(TxDb.Hsapiens.UCSC.hg19.knownGene) # note: the annotation of STPG1 shifted from old version # here we set the old one for the test txdb.ann <- GRanges('chr1', IRanges(start=c(24683489, 24742245), end=c(24741587, 24799473)), strand=c('-', '+'), gene_id=c('90529', '57185')) names(txdb.ann) <- txdb.ann$gene_id STPG1 <- select(org.Hs.eg.db, key="STPG1", keytype="SYMBOL", columns=c( "SYMBOL", "ENSEMBL", "ENTREZID"))[1,3] NIPAL3 <- select(org.Hs.eg.db, key="NIPAL3", keytype="SYMBOL", columns=c( "SYMBOL", "ENSEMBL", "ENTREZID"))[1,3] ap <- annotatePeakInBatch(peak, Annotation=txdb.ann, PeakLocForDistance = "start") expect_equal(ap$feature, STPG1) ap <- annotatePeakInBatch(peak, Annotation=txdb.ann, PeakLocForDistance = "end") expect_equal(ap$feature, STPG1) ap <- annotatePeakInBatch(peak, Annotation=txdb.ann, PeakLocForDistance = "middle") expect_equal(ap$feature, STPG1) ap <- annotatePeakInBatch(peak, Annotation=txdb.ann, PeakLocForDistance = "endMinusStart") expect_equal(ap$feature, NIPAL3) txdb.ann.current[NIPAL3] txdb.ann[txdb.ann$gene_id == NIPAL3] # GRanges object with 1 range and 1 metadata column: # seqnames ranges strand | gene_id # <Rle> <IRanges> <Rle> | <character> # 57185 chr1 24742245-24799473 + | 57185 #------- txdb.ann.current[STPG1] txdb.ann[txdb.ann$gene_id == STPG1] # GRanges object with 1 range and 1 metadata column: # seqnames ranges strand | gene_id # <Rle> <IRanges> <Rle> | <character> # 90529 chr1 24683489-24741587 - | 90529
Summarize peak distribution over exon, intron, enhancer, proximal promoter, 5 prime UTR and 3 prime UTR
assignChromosomeRegion( peaks.RD, exon, TSS, utr5, utr3, proximal.promoter.cutoff = c(upstream = 2000, downstream = 100), immediate.downstream.cutoff = c(upstream = 0, downstream = 1000), nucleotideLevel = FALSE, precedence = NULL, TxDb = NULL )assignChromosomeRegion( peaks.RD, exon, TSS, utr5, utr3, proximal.promoter.cutoff = c(upstream = 2000, downstream = 100), immediate.downstream.cutoff = c(upstream = 0, downstream = 1000), nucleotideLevel = FALSE, precedence = NULL, TxDb = NULL )
peaks.RD |
peaks in GRanges: See example below |
exon |
exon data obtained from getAnnotation or customized annotation
of class GRanges containing additional variable: strand (1 or + for plus
strand and -1 or - for minus strand). This parameter is for backward
compatibility only. |
TSS |
TSS data obtained from getAnnotation or customized annotation of
class GRanges containing additional variable: strand (1 or + for plus strand
and -1 or - for minus strand). For example,
data(TSS.human.NCBI36),data(TSS.mouse.NCBIM37), data(TSS.rat.RGSC3.4) and
data(TSS.zebrafish.Zv8). This parameter is for backward compatibility only.
|
utr5 |
5 prime UTR data obtained from getAnnotation or customized
annotation of class GRanges containing additional variable: strand (1 or +
for plus strand and -1 or - for minus strand). This parameter is for
backward compatibility only. |
utr3 |
3 prime UTR data obtained from getAnnotation or customized
annotation of class GRanges containing additional variable: strand (1 or +
for plus strand and -1 or - for minus strand). This parameter is for
backward compatibility only. |
proximal.promoter.cutoff |
Specify the cutoff in bases to classify proximal promoter or enhencer. Peaks that reside within proximal.promoter.cutoff upstream from or overlap with transcription start site are classified as proximal promoters. Peaks that reside upstream of the proximal.promoter.cutoff from gene start are classified as enhancers. The default is upstream 2000 bases and downstream 100 bases. |
immediate.downstream.cutoff |
Specify the cutoff in bases to classify immediate downstream region or enhancer region. Peaks that reside within immediate.downstream.cutoff downstream of gene end but not overlap 3 prime UTR are classified as immediate downstream. Peaks that reside downstream over immediate.downstreatm.cutoff from gene end are classified as enhancers. The default is upstream 0 bases and downstream 1000 bases. |
nucleotideLevel |
Logical. Choose between peak centric and nucleotide centric view. Default=FALSE |
precedence |
If no precedence specified, double count will be enabled, which means that if a peak overlap with both promoter and 5'UTR, both promoter and 5'UTR will be incremented. If a precedence order is specified, for example, if promoter is specified before 5'UTR, then only promoter will be incremented for the same example. The values could be any conbinations of "Promoters", "immediateDownstream", "fiveUTRs", "threeUTRs", "Exons" and "Introns", Default=NULL |
TxDb |
A list of two named vectors: percentage and jaccard (Jaccard Index). The information in the vectors:
list("Exons") |
Percent or the picard index of the peaks resided in exon regions. |
list("Introns") |
Percent or the picard index of the peaks resided in intron regions. |
list("fiveUTRs") |
Percent or the picard index of the peaks resided in 5 prime UTR regions. |
list("threeUTRs") |
Percent or the picard index of the peaks resided in 3 prime UTR regions. |
list("Promoter") |
Percent or the picard index of the peaks resided in proximal promoter regions. |
list("ImmediateDownstream") |
Percent or the picard index of the peaks resided in immediate downstream regions. |
list("Intergenic.Region") |
Percent or the picard index of the peaks resided in intergenic regions. |
The Jaccard index, also known as Intersection over Union. The Jaccard index is between 0 and 1. The higher the index, the more significant the overlap between the peak region and the genomic features in consideration.
Jianhong Ou, Lihua Julie Zhu
1. Zhu L.J. et al. (2010) ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data. BMC Bioinformatics 2010, 11:237doi:10.1186/1471-2105-11-237
2. Zhu L.J. (2013) Integrative analysis of ChIP-chip and ChIP-seq dataset. Methods Mol Biol. 2013;1067:105-24. doi: 10.1007/978-1-62703-607-8_8.
genomicElementDistribution, genomicElementUpSetR, binOverFeature, binOverGene, binOverRegions
if (interactive() || Sys.getenv("USER")=="jou"){ ##Display the list of genomes available at UCSC: #library(rtracklayer) #ucscGenomes()[, "db"] ## Display the list of Tracks supported by makeTxDbFromUCSC() #supportedUCSCtables() ##Retrieving a full transcript dataset for Human from UCSC ##TranscriptDb <- ## makeTxDbFromUCSC(genome="hg19", tablename="ensGene") if(require(TxDb.Hsapiens.UCSC.hg19.knownGene)){ TxDb <- TxDb.Hsapiens.UCSC.hg19.knownGene exons <- exons(TxDb, columns=NULL) fiveUTRs <- unique(unlist(fiveUTRsByTranscript(TxDb))) Feature.distribution <- assignChromosomeRegion(exons, nucleotideLevel=TRUE, TxDb=TxDb) barplot(Feature.distribution$percentage) assignChromosomeRegion(fiveUTRs, nucleotideLevel=FALSE, TxDb=TxDb) data(myPeakList) assignChromosomeRegion(myPeakList, nucleotideLevel=TRUE, precedence=c("Promoters", "immediateDownstream", "fiveUTRs", "threeUTRs", "Exons", "Introns"), TxDb=TxDb) } }if (interactive() || Sys.getenv("USER")=="jou"){ ##Display the list of genomes available at UCSC: #library(rtracklayer) #ucscGenomes()[, "db"] ## Display the list of Tracks supported by makeTxDbFromUCSC() #supportedUCSCtables() ##Retrieving a full transcript dataset for Human from UCSC ##TranscriptDb <- ## makeTxDbFromUCSC(genome="hg19", tablename="ensGene") if(require(TxDb.Hsapiens.UCSC.hg19.knownGene)){ TxDb <- TxDb.Hsapiens.UCSC.hg19.knownGene exons <- exons(TxDb, columns=NULL) fiveUTRs <- unique(unlist(fiveUTRsByTranscript(TxDb))) Feature.distribution <- assignChromosomeRegion(exons, nucleotideLevel=TRUE, TxDb=TxDb) barplot(Feature.distribution$percentage) assignChromosomeRegion(fiveUTRs, nucleotideLevel=FALSE, TxDb=TxDb) data(myPeakList) assignChromosomeRegion(myPeakList, nucleotideLevel=TRUE, precedence=c("Promoters", "immediateDownstream", "fiveUTRs", "threeUTRs", "Exons", "Introns"), TxDb=TxDb) } }
Obtain the peaks near bi-directional promoters. Also output percent of peaks near bi-directional promoters.
bdp(peaks, annoData, maxgap = 2000L, ...)bdp(peaks, annoData, maxgap = 2000L, ...)
peaks |
peak list, GRanges object |
annoData |
annotation data, annoGR object |
maxgap |
maxgap between peak and TSS |
... |
Not used. |
Output is a list of GRanges object of the peaks near bi-directional promoters.
Jianhong Ou
if(interactive() || Sys.getenv("USER")=="jou"){ library(ensembldb) library(EnsDb.Hsapiens.v75) data("myPeakList") annoGR <- annoGR(EnsDb.Hsapiens.v75) seqlevelsStyle(myPeakList) <- seqlevelsStyle(annoGR) ChIPpeakAnno:::bdp(myPeakList, annoGR) }if(interactive() || Sys.getenv("USER")=="jou"){ library(ensembldb) library(EnsDb.Hsapiens.v75) data("myPeakList") annoGR <- annoGR(EnsDb.Hsapiens.v75) seqlevelsStyle(myPeakList) <- seqlevelsStyle(annoGR) ChIPpeakAnno:::bdp(myPeakList, annoGR) }
"bindist"
An object of class "bindist" represents the relevant fixed-width
range of binding site from the feature and number of possible binding site
in each range.
Objects can be created by calls of the form
new("bindist", counts="integer", mids="integer",
halfBinSize="integer", bindingType="character", featureType="character").
Aggregate peaks over bins from the feature sites.
binOverFeature( ..., annotationData = GRanges(), select = c("all", "nearest"), radius = 5000L, nbins = 50L, minGeneLen = 1L, aroundGene = FALSE, mbins = nbins, featureSite = c("FeatureStart", "FeatureEnd", "bothEnd"), PeakLocForDistance = c("all", "end", "start", "middle"), FUN = sum, errFun = sd, xlab, ylab, main )binOverFeature( ..., annotationData = GRanges(), select = c("all", "nearest"), radius = 5000L, nbins = 50L, minGeneLen = 1L, aroundGene = FALSE, mbins = nbins, featureSite = c("FeatureStart", "FeatureEnd", "bothEnd"), PeakLocForDistance = c("all", "end", "start", "middle"), FUN = sum, errFun = sd, xlab, ylab, main )
... |
Objects of GRanges to be analyzed |
annotationData |
|
select |
Logical: annotate the peaks to all features or the nearest one |
radius |
The radius of the longest distance to feature site |
nbins |
The number of bins |
minGeneLen |
The minimal gene length |
aroundGene |
Logical: count peaks around features or a given site of the features. Default = FALSE |
mbins |
if aroundGene set as TRUE, the number of bins intra-feature. The value will be normalized by value * (radius/genelen) * (mbins/nbins) |
featureSite |
which site of features should be used for distance calculation |
PeakLocForDistance |
which site of peaks should be used for distance calculation |
FUN |
the function to be used for score calculation |
errFun |
the function to be used for errorbar calculation or values for the errorbar. |
xlab |
titles for each x axis |
ylab |
titles for each y axis |
main |
overall titles for each plot |
A data.frame with bin values.
Jianhong Ou
bed <- system.file("extdata", "MACS_output.bed", package="ChIPpeakAnno") gr1 <- toGRanges(bed, format="BED", header=FALSE) data(TSS.human.GRCh37) binOverFeature(gr1, annotationData=TSS.human.GRCh37, radius=5000, nbins=10, FUN=length, errFun=0)bed <- system.file("extdata", "MACS_output.bed", package="ChIPpeakAnno") gr1 <- toGRanges(bed, format="BED", header=FALSE) data(TSS.human.GRCh37) binOverFeature(gr1, annotationData=TSS.human.GRCh37, radius=5000, nbins=10, FUN=length, errFun=0)
calculate the coverage of gene body per gene per bin.
binOverGene( cvglists, TxDb, upstream.cutoff = 0L, downstream.cutoff = upstream.cutoff, nbinsGene = 100L, nbinsUpstream = 20L, nbinsDownstream = nbinsUpstream, includeIntron = FALSE, minGeneLen = nbinsGene, maxGeneLen = Inf )binOverGene( cvglists, TxDb, upstream.cutoff = 0L, downstream.cutoff = upstream.cutoff, nbinsGene = 100L, nbinsUpstream = 20L, nbinsDownstream = nbinsUpstream, includeIntron = FALSE, minGeneLen = nbinsGene, maxGeneLen = Inf )
cvglists |
A list of SimpleRleList or RleList. It represents the coverage for samples. |
TxDb |
An object of |
upstream.cutoff, downstream.cutoff
|
cutoff length for upstream or downstream of transcript. |
nbinsGene, nbinsUpstream, nbinsDownstream
|
The number of bins for gene, upstream and downstream. |
includeIntron |
A logical value which indicates including intron or not. |
minGeneLen, maxGeneLen
|
minimal or maximal length of gene. |
Jianhong Ou
binOverRegions, plotBinOverRegions
if(Sys.getenv("USER")=="jou"){ path <- system.file("extdata", package="ChIPpeakAnno") library(TxDb.Hsapiens.UCSC.hg19.knownGene) library(rtracklayer) files <- dir(path, "bigWig") if(.Platform$OS.type != "windows"){ cvglists <- lapply(file.path(path, files), import, format="BigWig", as="RleList") names(cvglists) <- sub(".bigWig", "", files) d <- binOverGene(cvglists, TxDb.Hsapiens.UCSC.hg19.knownGene) plotBinOverRegions(d) } }if(Sys.getenv("USER")=="jou"){ path <- system.file("extdata", package="ChIPpeakAnno") library(TxDb.Hsapiens.UCSC.hg19.knownGene) library(rtracklayer) files <- dir(path, "bigWig") if(.Platform$OS.type != "windows"){ cvglists <- lapply(file.path(path, files), import, format="BigWig", as="RleList") names(cvglists) <- sub(".bigWig", "", files) d <- binOverGene(cvglists, TxDb.Hsapiens.UCSC.hg19.knownGene) plotBinOverRegions(d) } }
calculate the coverage of 5'UTR, CDS and 3'UTR per transcript per bin.
binOverRegions( cvglists, TxDb, upstream.cutoff = 1000L, downstream.cutoff = upstream.cutoff, nbinsCDS = 100L, nbinsUTR = 20L, nbinsUpstream = 20L, nbinsDownstream = nbinsUpstream, includeIntron = FALSE, minCDSLen = nbinsCDS, minUTRLen = nbinsUTR, maxCDSLen = Inf, maxUTRLen = Inf )binOverRegions( cvglists, TxDb, upstream.cutoff = 1000L, downstream.cutoff = upstream.cutoff, nbinsCDS = 100L, nbinsUTR = 20L, nbinsUpstream = 20L, nbinsDownstream = nbinsUpstream, includeIntron = FALSE, minCDSLen = nbinsCDS, minUTRLen = nbinsUTR, maxCDSLen = Inf, maxUTRLen = Inf )
cvglists |
A list of SimpleRleList or RleList. It represents the coverage for samples. |
TxDb |
An object of |
upstream.cutoff, downstream.cutoff
|
cutoff length for upstream or downstream of transcript. |
nbinsCDS, nbinsUTR, nbinsUpstream, nbinsDownstream
|
The number of bins for CDS, UTR, upstream and downstream. |
includeIntron |
A logical value which indicates including intron or not. |
minCDSLen, minUTRLen
|
minimal length of CDS or UTR of transcript. |
maxCDSLen, maxUTRLen
|
maximal length of CDS or UTR of transctipt. |
Jianhong Ou
binOverGene, plotBinOverRegions
if(Sys.getenv("USER")=="jou"){ path <- system.file("extdata", package="ChIPpeakAnno") library(TxDb.Hsapiens.UCSC.hg19.knownGene) library(rtracklayer) files <- dir(path, "bigWig") if(.Platform$OS.type != "windows"){ cvglists <- lapply(file.path(path, files), import, format="BigWig", as="RleList") names(cvglists) <- sub(".bigWig", "", files) d <- binOverRegions(cvglists, TxDb.Hsapiens.UCSC.hg19.knownGene) plotBinOverRegions(d) } }if(Sys.getenv("USER")=="jou"){ path <- system.file("extdata", package="ChIPpeakAnno") library(TxDb.Hsapiens.UCSC.hg19.knownGene) library(rtracklayer) files <- dir(path, "bigWig") if(.Platform$OS.type != "windows"){ cvglists <- lapply(file.path(path, files), import, format="BigWig", as="RleList") names(cvglists) <- sub(".bigWig", "", files) d <- binOverRegions(cvglists, TxDb.Hsapiens.UCSC.hg19.knownGene) plotBinOverRegions(d) } }
These functions are provided for compatibility with older versions of R only, and may be defunct as soon as the next release.
Peaks1 |
GRanges: See example below. |
Peaks2 |
GRanges: See example below. |
maxgap, minoverlap
|
Used in the internal call to |
multiple |
TRUE or FALSE: TRUE may return multiple overlapping peaks in Peaks2 for one peak in Peaks1; FALSE will return at most one overlapping peaks in Peaks2 for one peak in Peaks1. This parameter is kept for backward compatibility, please use select. |
NameOfPeaks1 |
Name of the Peaks1, used for generating column name. |
NameOfPeaks2 |
Name of the Peaks2, used for generating column name. |
select |
all may return multiple overlapping peaks, first will return the first overlapping peak, last will return the last overlapping peak and arbitrary will return one of the overlapping peaks. |
annotate |
Include overlapFeature and shortestDistance in the OverlappingPeaks or not. 1 means yes and 0 means no. Default to 0. |
ignore.strand |
When set to TRUE, the strand information is ignored in the overlap calculations. |
connectedPeaks |
If multiple peaks involved in overlapping in several groups, set it to "merge" will count it as only 1, while set it to "min" will count it as the minimal involved peaks in any concered groups |
... |
Objects of GRanges: See
also |
findOverlappingPeaks is now deprecated wrappers for
findOverlapsOfPeaks
Deprecated, findOverlapsOfPeaks,
toGRanges
Count overlaps with max gap.
cntOverlaps(A, B, maxgap = 0L, ...)cntOverlaps(A, B, maxgap = 0L, ...)
A, B
|
A GRanges object. |
maxgap |
A single integer >= 0. |
... |
parameters passed to numOverlaps#' |
Condense matrix by colnames
condenseMatrixByColnames(mx, iname, sep = ";", cnt = FALSE)condenseMatrixByColnames(mx, iname, sep = ";", cnt = FALSE)
mx |
a matrix to be condensed |
iname |
the name of the column to be condensed |
sep |
separator for condensed values,default ; |
cnt |
TRUE/FALSE specifying whether adding count column or not? |
dataframe of condensed matrix
Jianhong Ou, Lihua Julie Zhu
a<-matrix(c(rep(rep(1:5,2),2),rep(1:10,2)),ncol=4) colnames(a)<-c("con.1","con.2","index.1","index.2") condenseMatrixByColnames(a,"con.1") condenseMatrixByColnames(a,2)a<-matrix(c(rep(rep(1:5,2),2),rep(1:10,2)),ncol=4) colnames(a)<-c("con.1","con.2","index.1","index.2") condenseMatrixByColnames(a,"con.1") condenseMatrixByColnames(a,2)
Convert other common IDs such as ensemble gene id, gene symbol, refseq id to entrez gene ID leveraging organism annotation dataset. For example, org.Hs.eg.db is the dataset from orgs.Hs.eg.db package for human, while org.Mm.eg.db is the dataset from the org.Mm.eg.db package for mouse.
convert2EntrezID(IDs, orgAnn, ID_type = "ensembl_gene_id")convert2EntrezID(IDs, orgAnn, ID_type = "ensembl_gene_id")
IDs |
a vector of IDs such as ensembl gene ids |
orgAnn |
organism annotation dataset such as org.Hs.eg.db |
ID_type |
type of ID: can be ensemble_gene_id, gene_symbol or refseq_id |
vector of entrez ids
Lihua Julie Zhu
ensemblIDs = c("ENSG00000115956", "ENSG00000071082", "ENSG00000071054", "ENSG00000115594", "ENSG00000115594", "ENSG00000115598", "ENSG00000170417") library(org.Hs.eg.db) entrezIDs = convert2EntrezID(IDs=ensemblIDs, orgAnn="org.Hs.eg.db", ID_type="ensembl_gene_id")ensemblIDs = c("ENSG00000115956", "ENSG00000071082", "ENSG00000071054", "ENSG00000115594", "ENSG00000115594", "ENSG00000115598", "ENSG00000170417") library(org.Hs.eg.db) entrezIDs = convert2EntrezID(IDs=ensemblIDs, orgAnn="org.Hs.eg.db", ID_type="ensembl_gene_id")
Output total number of patterns found in the input sequences
countPatternInSeqs(pattern, sequences)countPatternInSeqs(pattern, sequences)
pattern |
DNAstringSet object |
sequences |
a vector of sequences |
Total number of occurrence of the pattern in the sequences
Lihua Julie Zhu
summarizePatternInPeaks, translatePattern
library(Biostrings) filepath = system.file("extdata", "examplePattern.fa", package="ChIPpeakAnno") dict = readDNAStringSet(filepath = filepath, format="fasta", use.names=TRUE) sequences = c("ACTGGGGGGGGCCTGGGCCCCCAAAT", "AAAAAACCCCTTTTGGCCATCCCGGGACGGGCCCAT", "ATCGAAAATTTCC") countPatternInSeqs(pattern=dict[1], sequences=sequences) countPatternInSeqs(pattern=dict[2], sequences=sequences) pattern = DNAStringSet("ATNGMAA") countPatternInSeqs(pattern=pattern, sequences=sequences)library(Biostrings) filepath = system.file("extdata", "examplePattern.fa", package="ChIPpeakAnno") dict = readDNAStringSet(filepath = filepath, format="fasta", use.names=TRUE) sequences = c("ACTGGGGGGGGCCTGGGCCCCCAAAT", "AAAAAACCCCTTTTGGCCATCCCGGGACGGGCCCAT", "ATCGAAAATTTCC") countPatternInSeqs(pattern=dict[1], sequences=sequences) countPatternInSeqs(pattern=dict[2], sequences=sequences) pattern = DNAStringSet("ATNGMAA") countPatternInSeqs(pattern=pattern, sequences=sequences)
Plot the difference between the cumulative percentage tag allocation in paired samples.
cumulativePercentage(bamfiles, gr, input = 1, binWidth = 1000, ...)cumulativePercentage(bamfiles, gr, input = 1, binWidth = 1000, ...)
bamfiles |
Bam file names. |
gr |
An object of GRanges |
input |
Which file name is input. default 1. |
binWidth |
The width of each bin. |
... |
parameter for summarizeOverlaps. |
A list of data.frame with the cumulative percentages.
Jianhong Ou
Normalization, bias correction, and peak calling for ChIP-seq Aaron Diaz, Kiyoub Park, Daniel A. Lim, Jun S. Song Stat Appl Genet Mol Biol. Author manuscript; available in PMC 2012 May 3.Published in final edited form as: Stat Appl Genet Mol Biol. 2012 Mar 31; 11(3): 10.1515/1544-6115.1750 /j/sagmb.2012.11.issue-3/1544-6115.1750/1544-6115.1750.xml. Published online 2012 Mar 31. doi: 10.1515/1544-6115.1750 PMCID: PMC3342857
## Not run: path <- system.file("extdata", "reads", package="MMDiffBamSubset") files <- dir(path, "bam$", full.names = TRUE) library(BSgenome.Hsapiens.UCSC.hg19) gr <- as(seqinfo(Hsapiens)["chr1"], "GRanges") cumulativePercentage(files, gr) ## End(Not run)## Not run: path <- system.file("extdata", "reads", package="MMDiffBamSubset") files <- dir(path, "bam$", full.names = TRUE) library(BSgenome.Hsapiens.UCSC.hg19) gr <- as(seqinfo(Hsapiens)["chr1"], "GRanges") cumulativePercentage(files, gr) ## End(Not run)
Returns an object of the same type and length as x containing downstream ranges. The output range is defined as
downstreams(gr, upstream, downstream)downstreams(gr, upstream, downstream)
gr |
A GenomicRanges object |
upstream, downstream
|
non-negative interges. |
(end(x) - upstream) to (end(x) + downstream -1)
for ranges on the + and * strand, and as
(start(x) - downstream + 1) to (start(x) + downstream)
for ranges on the - strand.
Note that the returned object might contain out-of-bound ranges.
A GenomicRanges object
gr <- GRanges("chr1", IRanges(rep(10, 3), width=6), c("+", "-", "*")) downstreams(gr, 2, 2)gr <- GRanges("chr1", IRanges(rep(10, 3), width=6), c("+", "-", "*")) downstreams(gr, 2, 2)
Give a species name and return the organism annotation package name or give an organism annotation package name then return the species name.
egOrgMap(name)egOrgMap(name)
name |
The name of the organism annotation package or the species. |
A object of character
Jianhong Ou
egOrgMap("org.Hs.eg.db") egOrgMap("Mus musculus")egOrgMap("org.Hs.eg.db") egOrgMap("Mus musculus")
Enriched Gene Ontology terms used as example
enrichedGOenrichedGO
A list of 3 dataframes.
dataframe described the enriched biological process with 9 columns
go.id:GO biological process id
go.term:GO biological process term
go.Definition:GO biological process description
Ontology: Ontology branch, i.e. BP for biological process
count.InDataset: count of this GO term in this dataset
count.InGenome: count of this GO term in the genome
pvalue: pvalue from the hypergeometric test
totaltermInDataset: count of all GO terms in this dataset
totaltermInGenome: count of all GO terms in the genome
dataframe described the enriched molecular function with the following 9 columns
go.id:GO molecular function id
go.term:GO molecular function term
go.Definition:GO molecular function description
Ontology: Ontology branch, i.e. MF for molecular function
count.InDataset: count of this GO term in this dataset
count.InGenome: count of this GO term in the genome
pvalue: pvalue from the hypergeometric test
totaltermInDataset: count of all GO terms in this dataset
totaltermInGenome: count of all GO terms in the genome
dataframe described the enriched cellular component the following 9 columns
go.id:GO cellular component id
go.term:GO cellular component term
go.Definition:GO cellular component description
Ontology: Ontology type, i.e. CC for cellular component
count.InDataset: count of this GO term in this dataset
count.InGenome: count of this GO term in the genome
pvalue: pvalue from the hypergeometric test
totaltermInDataset: count of all GO terms in this dataset
totaltermInGenome: count of all GO terms in the genome
Lihua Julie Zhu
data(enrichedGO) dim(enrichedGO$mf) dim(enrichedGO$cc) dim(enrichedGO$bp)data(enrichedGO) dim(enrichedGO$mf) dim(enrichedGO$cc) dim(enrichedGO$bp)
Plot the GO/KEGG/reactome enrichment results
enrichmentPlot( res, n = 20, strlength = Inf, style = c("v", "h"), label_wrap = 40, label_substring_to_remove = NULL, orderBy = c("pvalue", "termId", "none") )enrichmentPlot( res, n = 20, strlength = Inf, style = c("v", "h"), label_wrap = 40, label_substring_to_remove = NULL, orderBy = c("pvalue", "termId", "none") )
res |
output of getEnrichedGO, getEnrichedPATH. |
n |
number of terms to be plot. |
strlength |
shorten the description of term by the number of char. |
style |
plot vertically or horizontally |
label_wrap |
soft wrap the labels (i.e. descriptions of the GO or PATHWAY terms), default to 40 characters. |
label_substring_to_remove |
remove common substring from label, default to NULL. Special characters must be escaped. E.g. if you would like to remove "Homo sapiens (human)" from labels, you must use "Homo sapiens \\( human\\)". |
orderBy |
order the data by pvalue, termId or none. |
an object of ggplot
Jianhong Ou, Kai Hu
data(enrichedGO) enrichmentPlot(enrichedGO) if (interactive()||Sys.getenv("USER")=="jou") { library(org.Hs.eg.db) library(GO.db) bed <- system.file("extdata", "MACS_output.bed", package="ChIPpeakAnno") gr1 <- toGRanges(bed, format="BED", header=FALSE) gff <- system.file("extdata", "GFF_peaks.gff", package="ChIPpeakAnno") gr2 <- toGRanges(gff, format="GFF", header=FALSE, skip=3) library(EnsDb.Hsapiens.v75) ##(hg19) annoData <- toGRanges(EnsDb.Hsapiens.v75) gr1.anno <- annoPeaks(gr1, annoData) gr2.anno <- annoPeaks(gr2, annoData) over <- lapply(GRangesList(gr1=gr1.anno, gr2=gr2.anno), getEnrichedGO, orgAnn="org.Hs.eg.db", maxP=.05, minGOterm=10, condense=TRUE) enrichmentPlot(over$gr1) enrichmentPlot(over$gr2, style = "h") }data(enrichedGO) enrichmentPlot(enrichedGO) if (interactive()||Sys.getenv("USER")=="jou") { library(org.Hs.eg.db) library(GO.db) bed <- system.file("extdata", "MACS_output.bed", package="ChIPpeakAnno") gr1 <- toGRanges(bed, format="BED", header=FALSE) gff <- system.file("extdata", "GFF_peaks.gff", package="ChIPpeakAnno") gr2 <- toGRanges(gff, format="GFF", header=FALSE, skip=3) library(EnsDb.Hsapiens.v75) ##(hg19) annoData <- toGRanges(EnsDb.Hsapiens.v75) gr1.anno <- annoPeaks(gr1, annoData) gr2.anno <- annoPeaks(gr2, annoData) over <- lapply(GRangesList(gr1=gr1.anno, gr2=gr2.anno), getEnrichedGO, orgAnn="org.Hs.eg.db", maxP=.05, minGOterm=10, condense=TRUE) enrichmentPlot(over$gr1) enrichmentPlot(over$gr2, style = "h") }
convert EnsDb object to GRanges
EnsDb2GR(ranges, feature)EnsDb2GR(ranges, feature)
ranges |
an EnsDb object |
feature |
feature type, could be disjointExons, gene, exon and transcript |
estimate the fragment length for bam files
estFragmentLength( bamfiles, index = bamfiles, plot = TRUE, lag.max = 1000, minFragmentSize = 100, ... )estFragmentLength( bamfiles, index = bamfiles, plot = TRUE, lag.max = 1000, minFragmentSize = 100, ... )
bamfiles |
The file names of the 'BAM' ('SAM' for asBam) files to be processed. |
index |
The names of the index file of the 'BAM' file being processed; this is given without the '.bai' extension. |
plot |
logical. If TRUE (the default) the acf is plotted. |
lag.max |
maximum lag at which to calculate the acf. See
|
minFragmentSize |
minimal fragment size to avoid the phantom peak. |
... |
Not used. |
numberic vector
Jianhong Ou
if(interactive() || Sys.getenv("USER")=="jou"){ path <- system.file("extdata", "reads", package="MMDiffBamSubset") if(file.exists(path)){ WT.AB2 <- file.path(path, "WT_2.bam") Null.AB2 <- file.path(path, "Null_2.bam") Resc.AB2 <- file.path(path, "Resc_2.bam") estFragmentLength(c(WT.AB2, Null.AB2, Resc.AB2)) } }if(interactive() || Sys.getenv("USER")=="jou"){ path <- system.file("extdata", "reads", package="MMDiffBamSubset") if(file.exists(path)){ WT.AB2 <- file.path(path, "WT_2.bam") Null.AB2 <- file.path(path, "Null_2.bam") Resc.AB2 <- file.path(path, "Resc_2.bam") estFragmentLength(c(WT.AB2, Null.AB2, Resc.AB2)) } }
estimate the library size of bam files
estLibSize(bamfiles, index = bamfiles, ...)estLibSize(bamfiles, index = bamfiles, ...)
bamfiles |
The file names of the 'BAM' ('SAM' for asBam) files to be processed. |
index |
The names of the index file of the 'BAM' file being processed; this is given without the '.bai' extension. |
... |
Not used. |
numberic vector
Jianhong Ou
if(interactive() || Sys.getenv("USER")=="jou"){ path <- system.file("extdata", "reads", package="MMDiffBamSubset") if(file.exists(path)){ WT.AB2 <- file.path(path, "WT_2.bam") Null.AB2 <- file.path(path, "Null_2.bam") Resc.AB2 <- file.path(path, "Resc_2.bam") estLibSize(c(WT.AB2, Null.AB2, Resc.AB2)) } }if(interactive() || Sys.getenv("USER")=="jou"){ path <- system.file("extdata", "reads", package="MMDiffBamSubset") if(file.exists(path)){ WT.AB2 <- file.path(path, "WT_2.bam") Null.AB2 <- file.path(path, "Null_2.bam") Resc.AB2 <- file.path(path, "Resc_2.bam") estLibSize(c(WT.AB2, Null.AB2, Resc.AB2)) } }
Gene model with exon, 5' UTR and 3' UTR information for human sapiens (GRCh37) obtained from biomaRt
ExonPlusUtr.human.GRCh37ExonPlusUtr.human.GRCh37
GRanges with slot start holding the start position of the exon, slot end holding the end position of the exon, slot rownames holding ensembl transcript id and slot space holding the chromosome location where the gene is located. In addition, the following variables are included.
1 for positive strand and -1 for negative strand
description of the transcript
gene id
5' UTR start
5' UTR end
3' UTR start
3' UTR end
used in the examples Annotation data obtained by: mart = useMart(biomart = "ensembl", dataset = "hsapiens_gene_ensembl") ExonPlusUtr.human.GRCh37 = getAnnotation(mart=human, featureType="ExonPlusUtr")
data(ExonPlusUtr.human.GRCh37) slotNames(ExonPlusUtr.human.GRCh37)data(ExonPlusUtr.human.GRCh37) slotNames(ExonPlusUtr.human.GRCh37)
plot distribution in the given feature ranges
featureAlignedDistribution( cvglists, feature.gr, upstream, downstream, n.tile = 100, zeroAt, ... )featureAlignedDistribution( cvglists, feature.gr, upstream, downstream, n.tile = 100, zeroAt, ... )
cvglists |
Output of featureAlignedSignal or a list of SimpleRleList or RleList |
feature.gr |
An object of GRanges with identical width. If the width equal to 1, you can use upstream and downstream to set the range for plot. If the width not equal to 1, you can use zeroAt to set the zero point of the heatmap. |
upstream, downstream
|
upstream or dwonstream from the feature.gr. |
n.tile |
The number of tiles to generate for each element of feature.gr, default is 100 |
zeroAt |
zero point position of feature.gr |
... |
any paramters could be used by matplot |
invisible matrix of the plot.
Jianhong Ou
See Also as featureAlignedSignal, featureAlignedHeatmap
cvglists <- list(A=RleList(chr1=Rle(sample.int(5000, 100), sample.int(300, 100))), B=RleList(chr1=Rle(sample.int(5000, 100), sample.int(300, 100)))) feature.gr <- GRanges("chr1", IRanges(seq(1, 4900, 100), width=100)) featureAlignedDistribution(cvglists, feature.gr, zeroAt=50, type="l")cvglists <- list(A=RleList(chr1=Rle(sample.int(5000, 100), sample.int(300, 100))), B=RleList(chr1=Rle(sample.int(5000, 100), sample.int(300, 100)))) feature.gr <- GRanges("chr1", IRanges(seq(1, 4900, 100), width=100)) featureAlignedDistribution(cvglists, feature.gr, zeroAt=50, type="l")
extract signals in the given feature ranges from bam files (DNAseq only). The reads will be extended to estimated fragement length.
featureAlignedExtendSignal( bamfiles, index = bamfiles, feature.gr, upstream, downstream, n.tile = 100, fragmentLength, librarySize, pe = c("auto", "PE", "SE"), adjustFragmentLength, gal, ... )featureAlignedExtendSignal( bamfiles, index = bamfiles, feature.gr, upstream, downstream, n.tile = 100, fragmentLength, librarySize, pe = c("auto", "PE", "SE"), adjustFragmentLength, gal, ... )
bamfiles |
The file names of the 'BAM' ('SAM' for asBam) files to be processed. |
index |
The names of the index file of the 'BAM' file being processed; this is given without the '.bai' extension. |
feature.gr |
An object of GRanges with identical width. |
upstream, downstream
|
upstream or dwonstream from the feature.gr. |
n.tile |
The number of tiles to generate for each element of feature.gr, default is 100 |
fragmentLength |
Estimated fragment length. |
librarySize |
Estimated library size. |
pe |
Pair-end or not. Default auto. |
adjustFragmentLength |
A numberic vector with length 1. Adjust the fragments/reads length to. |
gal |
A GAlignmentsList object or a list of GAlignmentPairs. If bamfiles is missing, gal is required. |
... |
Not used. |
A list of matrix. In each matrix, each row record the signals for corresponding feature.
Jianhong Ou
See Also as featureAlignedSignal,
estLibSize, estFragmentLength
if(interactive() || Sys.getenv("USER")=="jou"){ path <- system.file("extdata", package="MMDiffBamSubset") if(file.exists(path)){ WT.AB2 <- file.path(path, "reads", "WT_2.bam") Null.AB2 <- file.path(path, "reads", "Null_2.bam") Resc.AB2 <- file.path(path, "reads", "Resc_2.bam") peaks <- file.path(path, "peaks", "WT_2_Macs_peaks.xls") estLibSize(c(WT.AB2, Null.AB2, Resc.AB2)) feature.gr <- toGRanges(peaks, format="MACS") feature.gr <- feature.gr[seqnames(feature.gr)=="chr1" & start(feature.gr)>3000000 & end(feature.gr)<75000000] sig <- featureAlignedExtendSignal(c(WT.AB2, Null.AB2, Resc.AB2), feature.gr=reCenterPeaks(feature.gr, width=1), upstream = 505, downstream = 505, n.tile=101, fragmentLength=250, librarySize=1e9) featureAlignedHeatmap(sig, reCenterPeaks(feature.gr, width=1010), zeroAt=.5, n.tile=101) } }if(interactive() || Sys.getenv("USER")=="jou"){ path <- system.file("extdata", package="MMDiffBamSubset") if(file.exists(path)){ WT.AB2 <- file.path(path, "reads", "WT_2.bam") Null.AB2 <- file.path(path, "reads", "Null_2.bam") Resc.AB2 <- file.path(path, "reads", "Resc_2.bam") peaks <- file.path(path, "peaks", "WT_2_Macs_peaks.xls") estLibSize(c(WT.AB2, Null.AB2, Resc.AB2)) feature.gr <- toGRanges(peaks, format="MACS") feature.gr <- feature.gr[seqnames(feature.gr)=="chr1" & start(feature.gr)>3000000 & end(feature.gr)<75000000] sig <- featureAlignedExtendSignal(c(WT.AB2, Null.AB2, Resc.AB2), feature.gr=reCenterPeaks(feature.gr, width=1), upstream = 505, downstream = 505, n.tile=101, fragmentLength=250, librarySize=1e9) featureAlignedHeatmap(sig, reCenterPeaks(feature.gr, width=1010), zeroAt=.5, n.tile=101) } }
plot heatmap in the given feature ranges
featureAlignedHeatmap( cvglists, feature.gr, upstream, downstream, zeroAt, n.tile = 100, annoMcols = c(), sortBy = names(cvglists)[1], color = colorRampPalette(c("yellow", "red"))(50), lower.extreme, upper.extreme, margin = c(0.1, 0.01, 0.15, 0.1), gap = 0.01, newpage = TRUE, gp = gpar(fontsize = 10), ... )featureAlignedHeatmap( cvglists, feature.gr, upstream, downstream, zeroAt, n.tile = 100, annoMcols = c(), sortBy = names(cvglists)[1], color = colorRampPalette(c("yellow", "red"))(50), lower.extreme, upper.extreme, margin = c(0.1, 0.01, 0.15, 0.1), gap = 0.01, newpage = TRUE, gp = gpar(fontsize = 10), ... )
cvglists |
Output of featureAlignedSignal or a list of SimpleRleList or RleList |
feature.gr |
An object of GRanges with identical width. If the width equal to 1, you can use upstream and downstream to set the range for plot. If the width not equal to 1, you can use zeroAt to set the zero point of the heatmap. |
upstream, downstream
|
upstream or dwonstream from the feature.gr. It must keep same as featureAlignedSignal. It is used for x-axis label. |
zeroAt |
zero point position of feature.gr |
n.tile |
The number of tiles to generate for each element of feature.gr, default is 100 |
annoMcols |
The columns of metadata of feature.gr that specifies the annotations shown of the right side of the heatmap. |
sortBy |
Sort the feature.gr by columns by annoMcols and then the signals of the given samples. Default is the first sample. Set to NULL to disable sort. |
color |
vector of colors used in heatmap |
lower.extreme, upper.extreme
|
The lower and upper boundary value of each samples |
margin |
Margin for of the plot region. |
gap |
Gap between each heatmap columns. |
newpage |
Call grid.newpage or not. Default, TRUE |
gp |
A gpar object can be used for text. |
... |
Not used. |
invisible gList object.
Jianhong Ou
See Also as featureAlignedSignal, featureAlignedDistribution
cvglists <- list(A=RleList(chr1=Rle(sample.int(5000, 100), sample.int(300, 100))), B=RleList(chr1=Rle(sample.int(5000, 100), sample.int(300, 100)))) feature.gr <- GRanges("chr1", IRanges(seq(1, 4900, 100), width=100)) feature.gr$anno <- rep(c("type1", "type2"), c(25, 24)) featureAlignedHeatmap(cvglists, feature.gr, zeroAt=50, annoMcols="anno")cvglists <- list(A=RleList(chr1=Rle(sample.int(5000, 100), sample.int(300, 100))), B=RleList(chr1=Rle(sample.int(5000, 100), sample.int(300, 100)))) feature.gr <- GRanges("chr1", IRanges(seq(1, 4900, 100), width=100)) feature.gr$anno <- rep(c("type1", "type2"), c(25, 24)) featureAlignedHeatmap(cvglists, feature.gr, zeroAt=50, annoMcols="anno")
extract signals in the given feature ranges
featureAlignedSignal( cvglists, feature.gr, upstream, downstream, n.tile = 100, ... )featureAlignedSignal( cvglists, feature.gr, upstream, downstream, n.tile = 100, ... )
cvglists |
List of SimpleRleList or RleList |
feature.gr |
An object of GRanges with identical width. |
upstream, downstream
|
Set the feature.gr to upstream and dwonstream from the center of the feature.gr if they are set. |
n.tile |
The number of tiles to generate for each element of feature.gr, default is 100 |
... |
Not used. |
A list of matrix. In each matrix, each row record the signals for corresponding feature. rownames of the matrix show the seqnames and coordinates.
Jianhong Ou
See Also as featureAlignedHeatmap, featureAlignedDistribution
cvglists <- list(A=RleList(chr1=Rle(sample.int(5000, 100), sample.int(300, 100))), B=RleList(chr1=Rle(sample.int(5000, 100), sample.int(300, 100)))) feature.gr <- GRanges("chr1", IRanges(seq(1, 4900, 100), width=100)) featureAlignedSignal(cvglists, feature.gr)cvglists <- list(A=RleList(chr1=Rle(sample.int(5000, 100), sample.int(300, 100))), B=RleList(chr1=Rle(sample.int(5000, 100), sample.int(300, 100)))) feature.gr <- GRanges("chr1", IRanges(seq(1, 4900, 100), width=100)) featureAlignedSignal(cvglists, feature.gr)
Find possible enhancers by data from chromosome conformation capture techniques such as 3C, 5C or HiC.
findEnhancers( peaks, annoData, DNAinteractiveData, bindingType = c("nearestBiDirectionalPromoters", "startSite", "endSite"), bindingRegion = c(-5000, 5000), ignore.peak.strand = TRUE, ... )findEnhancers( peaks, annoData, DNAinteractiveData, bindingType = c("nearestBiDirectionalPromoters", "startSite", "endSite"), bindingRegion = c(-5000, 5000), ignore.peak.strand = TRUE, ... )
peaks |
peak list, GRanges object |
annoData |
annotation data, GRanges object |
DNAinteractiveData |
DNA interaction data, GRanges object with interaction blocks informations, GInteractions object, or BEDPE file which could be imported by importGInteractions or BiocIO::import or assembly in following list: hg38, hg19, mm10, danRer10, danRer11. |
bindingType |
Specifying the criteria to associate peaks with annotation. Here is how to use it together with the parameter bindingRegion. The annotation will be shift to a new position depend on the DNA interaction region.
|
bindingRegion |
Annotation range used together with bindingType, which is a vector with two integer values, default to c (-5000, 5000). The first one must be no bigger than 0. And the sec ond one must be no less than 1. For details, see bindingType. |
ignore.peak.strand |
ignore the peaks strand or not. |
... |
Not used. |
Output is a GRanges object of the annotated peaks.
Jianhong Ou
See Also as annotatePeakInBatch
bed <- system.file("extdata", "wgEncodeUmassDekker5CGm12878PkV2.bed.gz", package="ChIPpeakAnno") DNAinteractiveData <- toGRanges(gzfile(bed)) library(EnsDb.Hsapiens.v75) annoData <- toGRanges(EnsDb.Hsapiens.v75, feature="gene") data("myPeakList") findEnhancers(myPeakList[500:1000], annoData, DNAinteractiveData)bed <- system.file("extdata", "wgEncodeUmassDekker5CGm12878PkV2.bed.gz", package="ChIPpeakAnno") DNAinteractiveData <- toGRanges(gzfile(bed)) library(EnsDb.Hsapiens.v75) annoData <- toGRanges(EnsDb.Hsapiens.v75, feature="gene") data("myPeakList") findEnhancers(myPeakList[500:1000], annoData, DNAinteractiveData)
Find occurence of input motifs in the promoter regions of the input gene list
findMotifsInPromoterSeqs( patternFilePath1, patternFilePath2, findPairedMotif = FALSE, BSgenomeName, txdb, geneIDs, upstream = 5000L, downstream = 5000L, name.motif1 = "motif1", name.motif2 = "motif2", max.distance = 100L, min.distance = 1L, motif.orientation = c("both", "motif1UpstreamOfMotif2", "motif2UpstreamOfMoif1"), ignore.strand = FALSE, format = "fasta", skip = 0L, motif1LocForDistance = "end", motif2LocForDistance = "start", outfile, append = FALSE )findMotifsInPromoterSeqs( patternFilePath1, patternFilePath2, findPairedMotif = FALSE, BSgenomeName, txdb, geneIDs, upstream = 5000L, downstream = 5000L, name.motif1 = "motif1", name.motif2 = "motif2", max.distance = 100L, min.distance = 1L, motif.orientation = c("both", "motif1UpstreamOfMotif2", "motif2UpstreamOfMoif1"), ignore.strand = FALSE, format = "fasta", skip = 0L, motif1LocForDistance = "end", motif2LocForDistance = "start", outfile, append = FALSE )
patternFilePath1 |
File path containing a list of known motifs. Required |
patternFilePath2 |
File path containing a motif requried to be in the flanking regions of the motif(s) in the first file, i.e, patternFilePath1. Requried if findPairedMotif is set to TRUE |
findPairedMotif |
Find motifs in paired configuration only or not. Default FALSE |
BSgenomeName |
A BSgenome object. For a list of existing Bsgenomes, please refer use the function available.genomes in BSgenome package. For example,BSgenome.Hsapiens.UCSC.hg38 is for hg38, BSgenome.Hsapiens.UCSC.hg19 is for hg19, BSgenome.Mmusculus.UCSC.mm10 is for mm10, BSgenome.Celegans.UCSC.ce6 is for ce6 BSgenome.Rnorvegicus.UCSC.rn5 is for rn5, BSgenome.Drerio.UCSC.danRer7 is for Zv9, and BSgenome.Dmelanogaster.UCSC.dm3 is for dm3. Required |
txdb |
A TxDb object. For creating and using TxDb object, please refer to GenomicFeatures package. For a list of existing TxDb object, please search for annotation package starting with Txdb at http://www.bioconductor.org/packages/release/BiocViews.html#___AnnotationData, such as TxDb.Rnorvegicus.UCSC.rn5.refGene for rat, TxDb.Mmusculus.UCSC.mm10.knownGene for mouse, TxDb.Hsapiens.UCSC.hg19.knownGene and TxDb.Hsapiens.UCSC.hg38.knownGene for human, TxDb.Dmelanogaster.UCSC.dm3.ensGene for Drosophila and TxDb.Celegans.UCSC.ce6.ensGene for C.elegans |
geneIDs |
One or more gene entrez IDs. For example the entrez ID for EWSIR is 2130 https://www.genecards.org/cgi-bin/carddisp.pl?gene=EWSR1 You can use the addGeneIDs function in ChIPpeakAnno to convert other types of Gene IDs to entrez ID |
upstream |
Number of bases upstream of the TSS to search for the motifs. Default 5000L |
downstream |
Number of bases downstream of the TSS to search for the motifs. Default 5000L |
name.motif1 |
Name of the motif in inputfilePath2 for labeling the output file column. Default motif1. used only when searching for motifs in paired configuration |
name.motif2 |
Name of the motif in inputfilePath2 for labeling the output file column. Default motif2 used only when searching for motifs in paired configuration |
max.distance |
maximum required gap between a paired motifs to be included in the output file. Default 100L |
min.distance |
Minimum required gap between a paired motifs to be included in the output file. Default 1L |
motif.orientation |
Required relative oriention between paired motifs: both means any orientation, motif1UpstreamOfMotif2 means motif1 needs to be located on the upstream of motif2, and motif2UpstreamOfMoif1 means motif2 needs to be located on the upstream of motif1. Default both |
ignore.strand |
Specify whether paired motifs should be located on the same strand. Default FALSE |
format |
The format of the files specified in inputFilePath1 and inputFilePath2. Default fasta |
skip |
Specify number of lines to skip at the beginning of the input file. Default 0L |
motif1LocForDistance |
Specify whether to use the start or end of the motif1 location to calculate distance between paired motifs. Only applicable when findPairedMotif is set to TRUE. Default end |
motif2LocForDistance |
Specify whether to use the start or end of the motif2 location to calculate distance between paired motifs. Only applicable when findPairedMotif is set to TRUE. Default start |
outfile |
File path to save the search results |
append |
Specify whether to append the results to the specified output file, i.e., outfile. Default FALSE |
This function outputs the motif occuring locations in the promoter regions of input gene list and input motifs. It also can find paired motifs within specificed gap threshold
A vector of numeric. It is the background corrected log2-transformed ratios, CPMRatios or OddRatios.
An object of GRanges with metadata "tx_start", "tx_end tx_strand", "tx_id", "tx_name", "Gene ID", and motif specific information such as motif name, motif found, motif strand etc.
Lihua Julie Zhu, Kai Hu
library("BSgenome.Hsapiens.UCSC.hg38") library("TxDb.Hsapiens.UCSC.hg38.knownGene") patternFilePath1 =system.file("extdata", "motifIRF4.fa", package="ChIPpeakAnno") patternFilePath2 =system.file("extdata", "motifAP1.fa", package="ChIPpeakAnno") pairedMotifs <- findMotifsInPromoterSeqs(patternFilePath1 = patternFilePath1, patternFilePath2 = patternFilePath2, findPairedMotif = TRUE, name.motif1 = "IRF4", name.motif2 = "AP1", BSgenomeName = BSgenome.Hsapiens.UCSC.hg38, geneIDs = 7486, txdb = TxDb.Hsapiens.UCSC.hg38.knownGene, outfile = "testPaired.xls") unPairedMotifs <- findMotifsInPromoterSeqs(patternFilePath1 = patternFilePath1, BSgenomeName = BSgenome.Hsapiens.UCSC.hg38, geneIDs = 7486, txdb = TxDb.Hsapiens.UCSC.hg38.knownGene, outfile = "testUnPaired.xls")library("BSgenome.Hsapiens.UCSC.hg38") library("TxDb.Hsapiens.UCSC.hg38.knownGene") patternFilePath1 =system.file("extdata", "motifIRF4.fa", package="ChIPpeakAnno") patternFilePath2 =system.file("extdata", "motifAP1.fa", package="ChIPpeakAnno") pairedMotifs <- findMotifsInPromoterSeqs(patternFilePath1 = patternFilePath1, patternFilePath2 = patternFilePath2, findPairedMotif = TRUE, name.motif1 = "IRF4", name.motif2 = "AP1", BSgenomeName = BSgenome.Hsapiens.UCSC.hg38, geneIDs = 7486, txdb = TxDb.Hsapiens.UCSC.hg38.knownGene, outfile = "testPaired.xls") unPairedMotifs <- findMotifsInPromoterSeqs(patternFilePath1 = patternFilePath1, BSgenomeName = BSgenome.Hsapiens.UCSC.hg38, geneIDs = 7486, txdb = TxDb.Hsapiens.UCSC.hg38.knownGene, outfile = "testUnPaired.xls")
Find the overlapping peaks for two input peak ranges.
findOverlappingPeaks( Peaks1, Peaks2, maxgap = -1L, minoverlap = 0L, multiple = c(TRUE, FALSE), NameOfPeaks1 = "TF1", NameOfPeaks2 = "TF2", select = c("all", "first", "last", "arbitrary"), annotate = 0, ignore.strand = TRUE, connectedPeaks = c("min", "merge"), ... )findOverlappingPeaks( Peaks1, Peaks2, maxgap = -1L, minoverlap = 0L, multiple = c(TRUE, FALSE), NameOfPeaks1 = "TF1", NameOfPeaks2 = "TF2", select = c("all", "first", "last", "arbitrary"), annotate = 0, ignore.strand = TRUE, connectedPeaks = c("min", "merge"), ... )
Peaks1 |
GRanges: See example below. |
Peaks2 |
GRanges: See example below. |
maxgap, minoverlap
|
Used in the internal call to |
multiple |
TRUE or FALSE: TRUE may return multiple overlapping peaks in Peaks2 for one peak in Peaks1; FALSE will return at most one overlapping peaks in Peaks2 for one peak in Peaks1. This parameter is kept for backward compatibility, please use select. |
NameOfPeaks1 |
Name of the Peaks1, used for generating column name. |
NameOfPeaks2 |
Name of the Peaks2, used for generating column name. |
select |
all may return multiple overlapping peaks, first will return the first overlapping peak, last will return the last overlapping peak and arbitrary will return one of the overlapping peaks. |
annotate |
Include overlapFeature and shortestDistance in the OverlappingPeaks or not. 1 means yes and 0 means no. Default to 0. |
ignore.strand |
When set to TRUE, the strand information is ignored in the overlap calculations. |
connectedPeaks |
If multiple peaks involved in overlapping in several groups, set it to "merge" will count it as only 1, while set it to "min" will count it as the minimal involved peaks in any concered groups |
... |
Objects of GRanges: See
also |
The new function findOverlapsOfPeaks is recommended.
Efficiently perform overlap queries with an interval tree implemented in IRanges.
OverlappingPeaks |
a data frame consists of input peaks information with added information: overlapFeature (upstream: peak1 resides upstream of the peak2; downstream: peak1 resides downstream of the peak2; inside: peak1 resides inside the peak2 entirely; overlapStart: peak1 overlaps with the start of the peak2; overlapEnd: peak1 overlaps with the end of the peak2; includeFeature: peak1 include the peak2 entirely) and shortestDistance (shortest distance between the overlapping peaks) |
MergedPeaks |
GRanges contains merged overlapping peaks |
Lihua Julie Zhu
1.Interval tree algorithm from: Cormen, Thomas H.; Leiserson, Charles E.; Rivest, Ronald L.; Stein, Clifford. Introduction to Algorithms, second edition, MIT Press and McGraw-Hill. ISBN 0-262-53196-8
2.Zhu L.J. et al. (2010) ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data. BMC Bioinformatics 2010, 11:237 doi:10.1186/1471-2105-11-237
3. Zhu L (2013). Integrative analysis of ChIP-chip and ChIP-seq dataset. In Lee T and Luk ACS (eds.), Tilling Arrays, volume 1067, chapter 4, pp. -19. Humana Press. http://dx.doi.org/10.1007/978-1-62703-607-8_8
findOverlapsOfPeaks, annotatePeakInBatch, makeVennDiagram
if (interactive()) { peaks1 = GRanges(seqnames=c(6,6,6,6,5), IRanges(start=c(1543200,1557200,1563000,1569800,167889600), end=c(1555199,1560599,1565199,1573799,167893599), names=c("p1","p2","p3","p4","p5")), strand=as.integer(1)) peaks2 = GRanges(seqnames=c(6,6,6,6,5), IRanges(start=c(1549800,1554400,1565000,1569400,167888600), end=c(1550599,1560799,1565399,1571199,167888999), names=c("f1","f2","f3","f4","f5")), strand=as.integer(1)) t1 =findOverlappingPeaks(peaks1, peaks2, maxgap=1000, NameOfPeaks1="TF1", NameOfPeaks2="TF2", select="all", annotate=1) r = t1$OverlappingPeaks pie(table(r$overlapFeature)) as.data.frame(t1$MergedPeaks) }if (interactive()) { peaks1 = GRanges(seqnames=c(6,6,6,6,5), IRanges(start=c(1543200,1557200,1563000,1569800,167889600), end=c(1555199,1560599,1565199,1573799,167893599), names=c("p1","p2","p3","p4","p5")), strand=as.integer(1)) peaks2 = GRanges(seqnames=c(6,6,6,6,5), IRanges(start=c(1549800,1554400,1565000,1569400,167888600), end=c(1550599,1560799,1565399,1571199,167888999), names=c("f1","f2","f3","f4","f5")), strand=as.integer(1)) t1 =findOverlappingPeaks(peaks1, peaks2, maxgap=1000, NameOfPeaks1="TF1", NameOfPeaks2="TF2", select="all", annotate=1) r = t1$OverlappingPeaks pie(table(r$overlapFeature)) as.data.frame(t1$MergedPeaks) }
Find the overlapping peaks for two or more (less than five) set of peak ranges.
findOverlapsOfPeaks( ..., maxgap = -1L, minoverlap = 0L, ignore.strand = TRUE, connectedPeaks = c("keepAll", "min", "merge") )findOverlapsOfPeaks( ..., maxgap = -1L, minoverlap = 0L, ignore.strand = TRUE, connectedPeaks = c("keepAll", "min", "merge") )
... |
Objects of GRanges: See example below. |
maxgap, minoverlap
|
Used in the internal call to |
ignore.strand |
When set to TRUE, the strand information is ignored in the overlap calculations. |
connectedPeaks |
If multiple peaks are involved in any group of connected/overlapping peaks in any input peak list, set it to "merge" will add 1 to the overlapping counts, while set it to "min" will add the minimal involved peaks in each group of connected/overlapped peaks to the overlapping counts. Set it to "keepAll" will add the number of involved peaks for each peak list to the corresponding overlapping counts. In addition, it will output counts as if connectedPeaks were set to "min". For examples (https://support.bioconductor.org/p/133486/#133603), if 5 peaks in group1 overlap with 2 peaks in group 2, setting connectedPeaks to "merge" will add 1 to the overlapping counts; setting it to "keepAll" will add 5 peaks to count.group1, 2 to count.group2, and 2 to counts; setting it to “min” will add 2 to the overlapping counts. |
Efficiently perform overlap queries with an interval tree implemented with GRanges.
return value is An object of overlappingPeaks.
venn_cnt |
an object of VennCounts |
peaklist |
a list consists of all overlapping peaks or unique peaks |
uniquePeaks |
an object of GRanges consists of all unique peaks |
mergedPeaks |
an object of GRanges consists of all merged overlapping peaks |
peaksInMergedPeaks |
an object of GRanges consists of all peaks in each samples involved in the overlapping peaks |
overlappingPeaks |
a list of data frame consists of the annotation of all the overlapped peaks |
all.peaks |
a list of GRanges object which contain the input peaks with formated rownames. |
Jianhong Ou
1.Interval tree algorithm from: Cormen, Thomas H.; Leiserson, Charles E.; Rivest, Ronald L.; Stein, Clifford. Introduction to Algorithms, second edition, MIT Press and McGraw-Hill. ISBN 0-262-53196-8
2.Zhu L.J. et al. (2010) ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data. BMC Bioinformatics 2010, 11:237doi:10.1186/1471-2105-11-237
3. Zhu L (2013). "Integrative analysis of ChIP-chip and ChIP-seq dataset." In Lee T and Luk ACS (eds.), Tilling Arrays, volume 1067, chapter 4, pp. -19. Humana Press. http://dx.doi.org/10.1007/978-1-62703-607-8_8, http://link.springer.com/protocol/10.1007%2F978-1-62703-607-8_8
annotatePeakInBatch, makeVennDiagram, getVennCounts, findOverlappingPeaks
peaks1 <- GRanges(seqnames=c(6,6,6,6,5), IRanges(start=c(1543200,1557200,1563000,1569800,167889600), end=c(1555199,1560599,1565199,1573799,167893599), names=c("p1","p2","p3","p4","p5")), strand="+") peaks2 <- GRanges(seqnames=c(6,6,6,6,5), IRanges(start=c(1549800,1554400,1565000,1569400,167888600), end=c(1550599,1560799,1565399,1571199,167888999), names=c("f1","f2","f3","f4","f5")), strand="+") t1 <- findOverlapsOfPeaks(peaks1, peaks2, maxgap=1000) makeVennDiagram(t1) t1$venn_cnt t1$peaklist t2 <- findOverlapsOfPeaks(peaks1, peaks2, minoverlap = .5) makeVennDiagram(t2) t3 <- findOverlapsOfPeaks(peaks1, peaks2, minoverlap = .90) makeVennDiagram(t3)peaks1 <- GRanges(seqnames=c(6,6,6,6,5), IRanges(start=c(1543200,1557200,1563000,1569800,167889600), end=c(1555199,1560599,1565199,1573799,167893599), names=c("p1","p2","p3","p4","p5")), strand="+") peaks2 <- GRanges(seqnames=c(6,6,6,6,5), IRanges(start=c(1549800,1554400,1565000,1569400,167888600), end=c(1550599,1560799,1565399,1571199,167888999), names=c("f1","f2","f3","f4","f5")), strand="+") t1 <- findOverlapsOfPeaks(peaks1, peaks2, maxgap=1000) makeVennDiagram(t1) t1$venn_cnt t1$peaklist t2 <- findOverlapsOfPeaks(peaks1, peaks2, minoverlap = .5) makeVennDiagram(t2) t3 <- findOverlapsOfPeaks(peaks1, peaks2, minoverlap = .90) makeVennDiagram(t3)
Plot pie chart for genomic element distribution
genomicElementDistribution( peaks, TxDb, seqlev, nucleotideLevel = FALSE, ignore.strand = TRUE, promoterRegion = c(upstream = 2000, downstream = 100), geneDownstream = c(upstream = 0, downstream = 1000), labels = list(geneLevel = c(promoter = "Promoter", geneDownstream = "Downstream", geneBody = "Gene body", distalIntergenic = "Distal Intergenic"), ExonIntron = c(exon = "Exon", intron = "Intron", intergenic = "Intergenic"), Exons = c(utr5 = "5' UTR", utr3 = "3' UTR", CDS = "CDS", otherExon = "Other exon"), group = c(geneLevel = "Transcript Level", promoterLevel = "Promoter Level", Exons = "Exon level", ExonIntron = "Exon/Intron/Intergenic")), labelColors = c(promoter = "#E1F114", geneBody = "#9EFF00", geneDownstream = "#57CB1B", distalIntergenic = "#066A4B", exon = "#6600FF", intron = "#8F00FF", intergenic = "#DA00FF", utr5 = "#00FFDB", utr3 = "#00DFFF", CDS = "#00A0FF", otherExon = "#006FFF"), plot = TRUE, keepExonsInGenesOnly = TRUE, promoterLevel )genomicElementDistribution( peaks, TxDb, seqlev, nucleotideLevel = FALSE, ignore.strand = TRUE, promoterRegion = c(upstream = 2000, downstream = 100), geneDownstream = c(upstream = 0, downstream = 1000), labels = list(geneLevel = c(promoter = "Promoter", geneDownstream = "Downstream", geneBody = "Gene body", distalIntergenic = "Distal Intergenic"), ExonIntron = c(exon = "Exon", intron = "Intron", intergenic = "Intergenic"), Exons = c(utr5 = "5' UTR", utr3 = "3' UTR", CDS = "CDS", otherExon = "Other exon"), group = c(geneLevel = "Transcript Level", promoterLevel = "Promoter Level", Exons = "Exon level", ExonIntron = "Exon/Intron/Intergenic")), labelColors = c(promoter = "#E1F114", geneBody = "#9EFF00", geneDownstream = "#57CB1B", distalIntergenic = "#066A4B", exon = "#6600FF", intron = "#8F00FF", intergenic = "#DA00FF", utr5 = "#00FFDB", utr3 = "#00DFFF", CDS = "#00A0FF", otherExon = "#006FFF"), plot = TRUE, keepExonsInGenesOnly = TRUE, promoterLevel )
peaks |
peak list, GRanges object or a GRangesList. |
TxDb |
an object of |
seqlev |
sequence level should be involved. Default is all the sequence levels in intersect of peaks and TxDb. |
nucleotideLevel |
Logical. Choose between peak centric and nucleotide centric view. Default=FALSE |
ignore.strand |
logical. Whether the strand of the input ranges should be ignored or not. Default=TRUE |
promoterRegion |
numeric. The upstream and downstream of genes to define promoter region. |
geneDownstream |
numeric. The upstream and downstream of genes to define gene downstream region. |
labels |
list. A list for labels for the genomic elements. |
labelColors |
named character vector. The colors for each labels. |
plot |
logic. Plot the pie chart for the genomic elements or not. |
keepExonsInGenesOnly |
logic. Keep the exons within annotated gene only. |
promoterLevel |
list. The breaks, labels, and colors for divided range of promoters. The breaks must be from 5' -> 3' and the percentage will use the fixed precedence 3' -> 5' |
The distribution will be calculated by geneLevel, ExonIntron, and Exons The geneLevel will be categorized as promoter region, gene body, gene downstream and distal intergenic region. The ExonIntron will be categorized as exon, intron and intergenic. The Exons will be categorized as 5' UTR, 3'UTR and CDS. The precedence will follow the order of labels defination. For example, for ExonIntron, if a peak overlap with both exon and intron, and exon is specified before intron, then only exon will be incremented for the same example.
Invisible list of data for plot.
if (interactive() || Sys.getenv("USER")=="jou"){ data(myPeakList) if(require(TxDb.Hsapiens.UCSC.hg19.knownGene)){ seqinfo(myPeakList) <- seqinfo(TxDb.Hsapiens.UCSC.hg19.knownGene)[seqlevels(myPeakList)] myPeakList <- GenomicRanges::trim(myPeakList) myPeakList <- myPeakList[width(myPeakList)>0] genomicElementDistribution(myPeakList, TxDb.Hsapiens.UCSC.hg19.knownGene) genomicElementDistribution(myPeakList, TxDb.Hsapiens.UCSC.hg19.knownGene, nucleotideLevel = TRUE) genomicElementDistribution(myPeakList, TxDb.Hsapiens.UCSC.hg19.knownGene, promoterLevel=list( #from 5' -> 3', fixed precedence 3' -> 5' breaks = c(-2000, -1000, -500, 0, 100), labels = c("upstream 1-2Kb", "upstream 0.5-1Kb", "upstream <500b", "TSS - 100b"), colors = c("#FFE5CC", "#FFCA99", "#FFAD65", "#FF8E32"))) } }if (interactive() || Sys.getenv("USER")=="jou"){ data(myPeakList) if(require(TxDb.Hsapiens.UCSC.hg19.knownGene)){ seqinfo(myPeakList) <- seqinfo(TxDb.Hsapiens.UCSC.hg19.knownGene)[seqlevels(myPeakList)] myPeakList <- GenomicRanges::trim(myPeakList) myPeakList <- myPeakList[width(myPeakList)>0] genomicElementDistribution(myPeakList, TxDb.Hsapiens.UCSC.hg19.knownGene) genomicElementDistribution(myPeakList, TxDb.Hsapiens.UCSC.hg19.knownGene, nucleotideLevel = TRUE) genomicElementDistribution(myPeakList, TxDb.Hsapiens.UCSC.hg19.knownGene, promoterLevel=list( #from 5' -> 3', fixed precedence 3' -> 5' breaks = c(-2000, -1000, -500, 0, 100), labels = c("upstream 1-2Kb", "upstream 0.5-1Kb", "upstream <500b", "TSS - 100b"), colors = c("#FFE5CC", "#FFCA99", "#FFAD65", "#FF8E32"))) } }
Prepare data for upset plot for genomic element distribution
genomicElementUpSetR( peaks, TxDb, seqlev, ignore.strand = TRUE, breaks = list(distal_upstream = c(-1e+05, -10000, -1, 1), proximal_upstream = c(-10000, -5000, -1, 1), distal_promoter = c(-5000, -2000, -1, 1), proximal_promoter = c(-2000, 200, -1, 0), `5'UTR` = fiveUTRsByTranscript, `3'UTR` = threeUTRsByTranscript, CDS = cds, exon = exons, intron = intronsByTranscript, gene_body = genes, immediate_downstream = c(0, 2000, 1, 1), proximal_downstream = c(2000, 5000, 1, 1), distal_downstream = c(5000, 1e+05, 1, 1)) )genomicElementUpSetR( peaks, TxDb, seqlev, ignore.strand = TRUE, breaks = list(distal_upstream = c(-1e+05, -10000, -1, 1), proximal_upstream = c(-10000, -5000, -1, 1), distal_promoter = c(-5000, -2000, -1, 1), proximal_promoter = c(-2000, 200, -1, 0), `5'UTR` = fiveUTRsByTranscript, `3'UTR` = threeUTRsByTranscript, CDS = cds, exon = exons, intron = intronsByTranscript, gene_body = genes, immediate_downstream = c(0, 2000, 1, 1), proximal_downstream = c(2000, 5000, 1, 1), distal_downstream = c(5000, 1e+05, 1, 1)) )
peaks |
peak list, GRanges object or a GRangesList. |
TxDb |
an object of |
seqlev |
sequence level should be involved. Default is all the sequence levels in intersect of peaks and TxDb. |
ignore.strand |
logical. Whether the strand of the input ranges should be ignored or not. Default=TRUE |
breaks |
list. A list for labels and sets for the genomic elements. The element could be an S4 method for signature 'TxDb' or a numeric vector with length of 4. The three numbers are c(upstream point, downstream point, promoter (-1) or downstream (1), remove gene body or not (1: remove, 0: keep)). |
The data will be calculated by for each breaks. No precedence will be considered.
list of data for plot.
if (interactive() || Sys.getenv("USER")=="jou"){ data(myPeakList) if(require(TxDb.Hsapiens.UCSC.hg19.knownGene)){ seqinfo(myPeakList) <- seqinfo(TxDb.Hsapiens.UCSC.hg19.knownGene)[seqlevels(myPeakList)] myPeakList <- GenomicRanges::trim(myPeakList) myPeakList <- myPeakList[width(myPeakList)>0] x <- genomicElementUpSetR(myPeakList, TxDb.Hsapiens.UCSC.hg19.knownGene) library(UpSetR) upset(x$plotData, nsets=13, nintersects=NA) } }if (interactive() || Sys.getenv("USER")=="jou"){ data(myPeakList) if(require(TxDb.Hsapiens.UCSC.hg19.knownGene)){ seqinfo(myPeakList) <- seqinfo(TxDb.Hsapiens.UCSC.hg19.knownGene)[seqlevels(myPeakList)] myPeakList <- GenomicRanges::trim(myPeakList) myPeakList <- myPeakList[width(myPeakList)>0] x <- genomicElementUpSetR(myPeakList, TxDb.Hsapiens.UCSC.hg19.knownGene) library(UpSetR) upset(x$plotData, nsets=13, nintersects=NA) } }
Obtain genomic sequences around the peaks leveraging the BSgenome and biomaRt package
getAllPeakSequence( myPeakList, upstream = 200L, downstream = upstream, genome, AnnotationData )getAllPeakSequence( myPeakList, upstream = 200L, downstream = upstream, genome, AnnotationData )
myPeakList |
An object of GRanges: See example below |
upstream |
upstream offset from the peak start, e.g., 200 |
downstream |
downstream offset from the peak end, e.g., 200 |
genome |
BSgenome object or mart object. Please refer to available.genomes in BSgenome package and useMart in bioMaRt package for details |
AnnotationData |
GRanges object with annotation information. |
GRanges with slot start holding the start position of the peak, slot end holding the end position of the peak, slot rownames holding the id of the peak and slot seqnames holding the chromosome where the peak is located. In addition, the following variables are included:
upstream |
upstream offset from the peak start |
downstream |
downstream offset from the peak end |
sequence |
the sequence obtained |
Lihua Julie Zhu, Jianhong Ou
Durinck S. et al. (2005) BioMart and Bioconductor: a powerful link between biological biomarts and microarray data analysis. Bioinformatics, 21, 3439-3440.
#### use Annotation data from BSgenome peaks <- GRanges(seqnames=c("NC_008253", "NC_010468"), IRanges(start=c(100, 500), end=c(300, 600), names=c("peak1", "peak2"))) library(BSgenome.Ecoli.NCBI.20080805) seq <- getAllPeakSequence(peaks, upstream=20, downstream=20, genome=Ecoli) write2FASTA(seq, file="test.fa")#### use Annotation data from BSgenome peaks <- GRanges(seqnames=c("NC_008253", "NC_010468"), IRanges(start=c(100, 500), end=c(300, 600), names=c("peak1", "peak2"))) library(BSgenome.Ecoli.NCBI.20080805) seq <- getAllPeakSequence(peaks, upstream=20, downstream=20, genome=Ecoli) write2FASTA(seq, file="test.fa")
Obtain the TSS, exon or miRNA annotation for the specified species using the biomaRt package
getAnnotation( mart, featureType = c("TSS", "miRNA", "Exon", "5utr", "3utr", "ExonPlusUtr", "transcript") )getAnnotation( mart, featureType = c("TSS", "miRNA", "Exon", "5utr", "3utr", "ExonPlusUtr", "transcript") )
mart |
A mart object, see useMart of biomaRt package for details. |
featureType |
TSS, miRNA, Exon, 5'UTR, 3'UTR, transcript or Exon plus UTR. The default is TSS. |
GRanges with slot start holding the start position of the feature, slot end holding the end position of the feature, slot names holding the id of the feature, slot space holding the chromosome location where the feature is located. In addition, the following variables are included.
list("strand") |
1 for positive strand and -1 for negative strand where the feature is located |
list("description") |
description of the feeature such as gene |
For featureType of TSS, start is the transcription start site if
strand is 1 (plus strand), otherwise, end is the transcription start site.
Note that the version of the annotation db must match with the genome used
for mapping because the coordinates may differ for different genome releases.
For example, if you are using Mus_musculus.v103 for mapping,
you'd best also use EnsDb.Mmusculus.v103 for annotation.
See Examples for more info.
Lihua Julie Zhu, Jianhong Ou, Kai Hu
Durinck S. et al. (2005) BioMart and Bioconductor: a powerful link between biological biomarts and microarray data analysis. Bioinformatics, 21, 3439-3440.
if (interactive() || Sys.getenv("USER")=="jou" ) { library(biomaRt) mart <- useMart(biomart="ensembl", dataset="hsapiens_gene_ensembl") Annotation <- getAnnotation(mart, featureType="TSS") } ########################################################## # Below are 3 options to fetch the annotation file. # ########################################################## if (interactive() || Sys.getenv("USER")=="jou" ){ ## Option1: with the AnnotationHub package library(AnnotationHub) ah <- AnnotationHub() EnsDb.Mmusculus <- query(ah, pattern = c("Mus musculus", "EnsDb")) EnsDb.Mmusculus.v101 <- EnsDb.Mmusculus[[length(EnsDb.Mmusculus)]] class(EnsDb.Mmusculus.v101) ## Option2: with the getAnnotation() function library(ChIPpeakAnno) library(biomaRt) listMarts() mart <- useMart(biomart="ENSEMBL_MART_ENSEMBL", dataset="mmusculus_gene_ensembl") Annotation <- getAnnotation(mart) # Note that getAnnotation() queries biomart, which is always up-to-date. ## Option3: build your own EnsDb package ## This may need extra effort, and the ?makeEnsembldbPackage ## is a good starting point. }if (interactive() || Sys.getenv("USER")=="jou" ) { library(biomaRt) mart <- useMart(biomart="ensembl", dataset="hsapiens_gene_ensembl") Annotation <- getAnnotation(mart, featureType="TSS") } ########################################################## # Below are 3 options to fetch the annotation file. # ########################################################## if (interactive() || Sys.getenv("USER")=="jou" ){ ## Option1: with the AnnotationHub package library(AnnotationHub) ah <- AnnotationHub() EnsDb.Mmusculus <- query(ah, pattern = c("Mus musculus", "EnsDb")) EnsDb.Mmusculus.v101 <- EnsDb.Mmusculus[[length(EnsDb.Mmusculus)]] class(EnsDb.Mmusculus.v101) ## Option2: with the getAnnotation() function library(ChIPpeakAnno) library(biomaRt) listMarts() mart <- useMart(biomart="ENSEMBL_MART_ENSEMBL", dataset="mmusculus_gene_ensembl") Annotation <- getAnnotation(mart) # Note that getAnnotation() queries biomart, which is always up-to-date. ## Option3: build your own EnsDb package ## This may need extra effort, and the ?makeEnsembldbPackage ## is a good starting point. }
Obtain enriched gene ontology (GO) terms based on the features near the enriched peaks using GO.db package and GO gene mapping package such as org.Hs.db.eg to obtain the GO annotation and using hypergeometric test (phyper) and multtest package for adjusting p-values
getEnrichedGO( annotatedPeak, orgAnn, feature_id_type = "ensembl_gene_id", maxP = 0.01, minGOterm = 10, multiAdjMethod = NULL, condense = FALSE, removeAncestorByPval = NULL, keepByLevel = NULL, subGroupComparison = NULL )getEnrichedGO( annotatedPeak, orgAnn, feature_id_type = "ensembl_gene_id", maxP = 0.01, minGOterm = 10, multiAdjMethod = NULL, condense = FALSE, removeAncestorByPval = NULL, keepByLevel = NULL, subGroupComparison = NULL )
annotatedPeak |
A GRanges object or a vector of feature IDs |
orgAnn |
Organism annotation package such as org.Hs.eg.db for human and org.Mm.eg.db for mouse, org.Dm.eg.db for fly, org.Rn.eg.db for rat, org.Sc.eg.db for yeast and org.Dr.eg.db for zebrafish |
feature_id_type |
The feature type in annotatedPeak such as ensembl_gene_id, refseq_id, gene_symbol or entrez_id |
maxP |
The maximum p-value to be considered to be significant |
minGOterm |
The minimum count in a genome for a GO term to be included |
multiAdjMethod |
The multiple testing procedures, for details, see mt.rawp2adjp in multtest package |
condense |
Condense the results or not. |
removeAncestorByPval |
Remove ancestor by p-value. P-value is calculated by fisher exact test. If gene number in all of the children is significant greater than it in parent term, the parent term will be removed from the list. |
keepByLevel |
If the shortest path from the go term to 'all' is greater than the given level, the term will be removed. |
subGroupComparison |
A logical vector to split the peaks into two groups. The enrichment analysis will compare the over-present GO terms in TRUE group and FALSE group separately. The analysis will split into two steps: 1. enrichment analysis for TRUE group by hypergeometric test; 2. enrichment analysis for TRUE over FALSE group by Fisher's Exact test for the enriched GO terms. To keep the output same format, if you want to compare FALSE vs TRUE, please repeat the analysis by inverting the parameter. Default is NULL. |
A list with 3 elements
list("bp") |
enriched biological process with the following 9 variables go.id:GO biological process id go.term:GO biological process term go.Definition:GO biological process description Ontology: Ontology branch, i.e. BP for biological process count.InDataset: count of this GO term in this dataset count.InGenome: count of this GO term in the genome pvalue: pvalue from the hypergeometric test totaltermInDataset: count of all GO terms in this dataset totaltermInGenome: count of all GO terms in the genome |
list("mf") |
enriched molecular function with the following 9 variables go.id:GO molecular function id go.term:GO molecular function term go.Definition:GO molecular function description Ontology: Ontology branch, i.e. MF for molecular function count.InDataset: count of this GO term in this dataset count.InGenome: count of this GO term in the genome pvalue: pvalue from the hypergeometric test totaltermInDataset: count of all GO terms in this dataset totaltermInGenome: count of all GO terms in the genome |
list("cc") |
enriched cellular component the following 9 variables go.id:GO cellular component id go.term:GO cellular component term go.Definition:GO cellular component description Ontology: Ontology type, i.e. CC for cellular component count.InDataset: count of this GO term in this dataset count.InGenome: count of this GO term in the genome pvalue: pvalue from the hypergeometric test totaltermInDataset: count of all GO terms in this dataset totaltermInGenome: count of all GO terms in the genome |
Lihua Julie Zhu. Jianhong Ou for subGroupComparison
Johnson, N. L., Kotz, S., and Kemp, A. W. (1992) Univariate Discrete Distributions, Second Edition. New York: Wiley
phyper, hyperGtest
data(enrichedGO) enrichedGO$mf[1:10,] enrichedGO$bp[1:10,] enrichedGO$cc if (interactive()) { data(annotatedPeak) library(org.Hs.eg.db) library(GO.db) enriched.GO = getEnrichedGO(annotatedPeak[1:6,], orgAnn="org.Hs.eg.db", maxP=0.01, minGOterm=10, multiAdjMethod= NULL) dim(enriched.GO$mf) colnames(enriched.GO$mf) dim(enriched.GO$bp) enriched.GO$cc }data(enrichedGO) enrichedGO$mf[1:10,] enrichedGO$bp[1:10,] enrichedGO$cc if (interactive()) { data(annotatedPeak) library(org.Hs.eg.db) library(GO.db) enriched.GO = getEnrichedGO(annotatedPeak[1:6,], orgAnn="org.Hs.eg.db", maxP=0.01, minGOterm=10, multiAdjMethod= NULL) dim(enriched.GO$mf) colnames(enriched.GO$mf) dim(enriched.GO$bp) enriched.GO$cc }
Obtain enriched PATH that are near the peaks using path package such as reactome.db and path mapping package such as org.Hs.db.eg to obtain the path annotation and using hypergeometric test (phyper) and multtest package for adjusting p-values
getEnrichedPATH( annotatedPeak, orgAnn, pathAnn, feature_id_type = "ensembl_gene_id", maxP = 0.01, minPATHterm = 10, multiAdjMethod = NULL, subGroupComparison = NULL )getEnrichedPATH( annotatedPeak, orgAnn, pathAnn, feature_id_type = "ensembl_gene_id", maxP = 0.01, minPATHterm = 10, multiAdjMethod = NULL, subGroupComparison = NULL )
annotatedPeak |
GRanges such as data(annotatedPeak) or a vector of feature IDs |
orgAnn |
organism annotation package such as org.Hs.eg.db for human and org.Mm.eg.db for mouse, org.Dm.eg.db for fly, org.Rn.eg.db for rat, org.Sc.eg.db for yeast and org.Dr.eg.db for zebrafish |
pathAnn |
pathway annotation package such as KEGG.db (deprecated), reactome.db, KEGGREST |
feature_id_type |
the feature type in annotatedPeakRanges such as ensembl_gene_id, refseq_id, gene_symbol or entrez_id |
maxP |
maximum p-value to be considered to be significant |
minPATHterm |
minimum count in a genome for a path to be included |
multiAdjMethod |
multiple testing procedures, for details, see mt.rawp2adjp in multtest package |
subGroupComparison |
A logical vector to split the peaks into two groups. The enrichment analysis will compare the over-present GO terms in TRUE group and FALSE group separately. The analysis will split into two steps: 1. enrichment analysis for TRUE group by hypergeometric test; 2. enrichment analysis for TRUE over FALSE group by Fisher's Exact test for the enriched GO terms. To keep the output same format, if you want to compare FALSE vs TRUE, please repeat the analysis by inverting the parameter. Default is NULL. |
A dataframe of enriched path with the following variables.
path.id |
KEGG PATH ID |
EntrezID |
Entrez ID |
count.InDataset |
count of this PATH in this dataset |
count.InGenome |
count of this PATH in the genome |
pvalue |
pvalue from the hypergeometric test |
totaltermInDataset |
count of all PATH in this dataset |
totaltermInGenome |
count of all PATH in the genome |
PATH |
PATH name |
Jianhong Ou, Kai Hu
Johnson, N. L., Kotz, S., and Kemp, A. W. (1992) Univariate Discrete Distributions, Second Edition. New York: Wiley
phyper, hyperGtest
if (interactive()||Sys.getenv("USER")=="jou") { data(annotatedPeak) library(org.Hs.eg.db) library(reactome.db) enriched.PATH = getEnrichedPATH(annotatedPeak, orgAnn="org.Hs.eg.db", feature_id_type="ensembl_gene_id", pathAnn="reactome.db", maxP=0.01, minPATHterm=10, multiAdjMethod=NULL) head(enriched.PATH) enrichedKEGG = getEnrichedPATH(annotatedPeak, orgAnn="org.Hs.eg.db", feature_id_type="ensembl_gene_id", pathAnn="KEGGREST", maxP=0.01, minPATHterm=10, multiAdjMethod=NULL) enrichmentPlot(enrichedKEGG) }if (interactive()||Sys.getenv("USER")=="jou") { data(annotatedPeak) library(org.Hs.eg.db) library(reactome.db) enriched.PATH = getEnrichedPATH(annotatedPeak, orgAnn="org.Hs.eg.db", feature_id_type="ensembl_gene_id", pathAnn="reactome.db", maxP=0.01, minPATHterm=10, multiAdjMethod=NULL) head(enriched.PATH) enrichedKEGG = getEnrichedPATH(annotatedPeak, orgAnn="org.Hs.eg.db", feature_id_type="ensembl_gene_id", pathAnn="KEGGREST", maxP=0.01, minPATHterm=10, multiAdjMethod=NULL) enrichmentPlot(enrichedKEGG) }
Obtain gene ontology (GO) terms useing GO gene mapping package such as org.Hs.db.eg to obtain the GO annotation.
getGO(all.genes, orgAnn = "org.Hs.eg.db", writeTo, ID_type = "gene_symbol")getGO(all.genes, orgAnn = "org.Hs.eg.db", writeTo, ID_type = "gene_symbol")
all.genes |
A character vector of feature IDs |
orgAnn |
Organism annotation package such as org.Hs.eg.db for human and org.Mm.eg.db for mouse, org.Dm.eg.db for fly, org.Rn.eg.db for rat, org.Sc.eg.db for yeast and org.Dr.eg.db for zebrafish |
writeTo |
File path for output table |
ID_type |
The feature type in annotatedPeak such as ensembl_gene_id, refseq_id, gene_symbol |
An invisible table with genes and GO terms.
Lihua Julie Zhu
getEnrichedGO
if (interactive()) { data(annotatedPeak) library(org.Hs.eg.db) getGO(annotatedPeak[1:6]$feature, orgAnn="org.Hs.eg.db", ID_type="ensembl_gene_id") }if (interactive()) { data(annotatedPeak) library(org.Hs.eg.db) getGO(annotatedPeak[1:6]$feature, orgAnn="org.Hs.eg.db", ID_type="ensembl_gene_id") }
Obtain Venn Counts for peak ranges using chromosome ranges or feature field, internal function for makeVennDigram
getVennCounts( ..., maxgap = -1L, minoverlap = 0L, by = c("region", "feature", "base"), ignore.strand = TRUE, connectedPeaks = c("min", "merge", "keepAll") )getVennCounts( ..., maxgap = -1L, minoverlap = 0L, by = c("region", "feature", "base"), ignore.strand = TRUE, connectedPeaks = c("min", "merge", "keepAll") )
... |
Objects of GRanges. See example below. |
maxgap, minoverlap
|
Used in the internal call to |
by |
region, feature or base, default region. feature means using feature field in the GRanges for calculating overlap, region means using chromosome range for calculating overlap, and base means using calculating overlap in nucleotide level. |
ignore.strand |
When set to TRUE, the strand information is ignored in the overlap calculations. |
connectedPeaks |
If multiple peaks involved in overlapping in several groups, set it to "merge" will count it as only 1, while set it to "min" will count it as the minimal involved peaks in any concered groups |
vennCounts |
vennCounts objects containing counts for Venn Diagram generation, see details in limma package vennCounts |
Jianhong Ou
makeVennDiagram, findOverlappingPeaks
if(interactive() || Sys.getenv("USER")=="jou"){ peaks1 = GRanges(seqnames=c("1", "2", "3"), IRanges(start = c(967654, 2010897, 2496704), end = c(967754, 2010997, 2496804), names = c("Site1", "Site2", "Site3")), strand=as.integer(1), feature=c("a","b", "c")) peaks2 = GRanges(seqnames= c("1", "2", "3", "1", "2"), IRanges(start=c(967659, 2010898, 2496700, 3075866, 3123260), end=c(967869, 2011108, 2496920, 3076166, 3123470), names = c("t1", "t2", "t3", "t4", "t5")), strand = c(1L, 1L, -1L,-1L,1L), feature=c("a","c","d","e", "a")) getVennCounts(peaks1,peaks2) getVennCounts(peaks1,peaks2, by="feature") getVennCounts(peaks1, peaks2, by="base") }if(interactive() || Sys.getenv("USER")=="jou"){ peaks1 = GRanges(seqnames=c("1", "2", "3"), IRanges(start = c(967654, 2010897, 2496704), end = c(967754, 2010997, 2496804), names = c("Site1", "Site2", "Site3")), strand=as.integer(1), feature=c("a","b", "c")) peaks2 = GRanges(seqnames= c("1", "2", "3", "1", "2"), IRanges(start=c(967659, 2010898, 2496700, 3075866, 3123260), end=c(967869, 2011108, 2496920, 3076166, 3123470), names = c("t1", "t2", "t3", "t4", "t5")), strand = c(1L, 1L, -1L,-1L,1L), feature=c("a","c","d","e", "a")) getVennCounts(peaks1,peaks2) getVennCounts(peaks1,peaks2, by="feature") getVennCounts(peaks1, peaks2, by="base") }
High Occupancy of Transcription Related Factors regions of human (hg19)
HOT.spotsHOT.spots
An object of GRangesList
How to generated the data:
temp <- tempfile()
url <- "http://metatracks.encodenets.gersteinlab.org"
download.file(file.path(url, "HOT_All_merged.tar.gz"), temp)
temp2 <- tempfile()
download.file(file.path(url, "HOT_intergenic_All_merged.tar.gz"), temp2)
untar(temp, exdir=dirname(temp))
untar(temp2, exdir=dirname(temp))
f <- dir(dirname(temp), "bed$")
HOT.spots <- sapply(file.path(dirname(temp), f), toGRanges, format="BED")
names(HOT.spots) <- gsub("_merged.bed", "", f)
HOT.spots <- sapply(HOT.spots, unname)
HOT.spots <- GRangesList(HOT.spots)
save(list="HOT.spots",
file="data/HOT.spots.rda",
compress="xz", compression_level=9)
http://metatracks.encodenets.gersteinlab.org/
Yip KY, Cheng C, Bhardwaj N, Brown JB, Leng J, Kundaje A, Rozowsky J, Birney E, Bickel P, Snyder M, Gerstein M. Classification of human genomic regions based on experimentally determined binding sites of more than 100 transcription-related factors. Genome Biol. 2012 Sep 26;13(9):R48. doi: 10.1186/gb-2012-13-9-r48. PubMed PMID: 22950945; PubMed Central PMCID: PMC3491392.
data(HOT.spots) elementNROWS(HOT.spots)data(HOT.spots) elementNROWS(HOT.spots)
Using IDR to assess the consistency of replicate experiments and obtain a high-confidence single set of peaks
IDRfilter( peaksA, peaksB, bamfileA, bamfileB, maxgap = -1L, minoverlap = 0L, singleEnd = TRUE, IDRcutoff = 0.01, ... )IDRfilter( peaksA, peaksB, bamfileA, bamfileB, maxgap = -1L, minoverlap = 0L, singleEnd = TRUE, IDRcutoff = 0.01, ... )
peaksA, peaksB
|
peaklist, GRanges object. |
bamfileA, bamfileB
|
file path of bam files. |
maxgap, minoverlap
|
Used in the internal call to |
singleEnd |
(Default TRUE) A logical indicating if reads are single or paired-end. |
IDRcutoff |
If the IDR no less than IDRcutoff, the peak will be removed. |
... |
Not used. |
An object GRanges
Jianhong Ou
Li, Qunhua, et al. "Measuring reproducibility of high-throughput experiments." The annals of applied statistics (2011): 1752-1779.
if(interactive()){ path <- system.file("extdata", "reads", package="MMDiffBamSubset") if(file.exists(path)){ bamfileA <- file.path(path, "reads", "WT_2.bam") bamfileB <- file.path(path, "reads", "Resc_2.bam") WT.AB2.Peaks <- file.path(path, "peaks", "WT_2_Macs_peaks.xls") Resc.AB2.Peaks <- file.path(path, "peaks", "Resc_2_Macs_peaks.xls") peaksA=toGRanges(WT.AB2.Peaks, format="MACS") peaksB=toGRanges(Resc.AB2.Peaks, format="MACS") library(idr) library(DelayedArray) IDRfilter(peaksA, peaksB, bamfileA, bamfileB) } }if(interactive()){ path <- system.file("extdata", "reads", package="MMDiffBamSubset") if(file.exists(path)){ bamfileA <- file.path(path, "reads", "WT_2.bam") bamfileB <- file.path(path, "reads", "Resc_2.bam") WT.AB2.Peaks <- file.path(path, "peaks", "WT_2_Macs_peaks.xls") Resc.AB2.Peaks <- file.path(path, "peaks", "Resc_2_Macs_peaks.xls") peaksA=toGRanges(WT.AB2.Peaks, format="MACS") peaksB=toGRanges(Resc.AB2.Peaks, format="MACS") library(idr) library(DelayedArray) IDRfilter(peaksA, peaksB, bamfileA, bamfileB) } }
Make Venn Diagram from two or more peak ranges, Also calculate p-value to determine whether those peaks overlap significantly.
makeVennDiagram( Peaks, NameOfPeaks, maxgap = -1L, minoverlap = 0L, totalTest, by = c("region", "feature", "base"), ignore.strand = TRUE, connectedPeaks = c("min", "merge", "keepAll", "keepFirstListConsistent"), method = c("hyperG", "permutation"), TxDb, plot = TRUE, ... )makeVennDiagram( Peaks, NameOfPeaks, maxgap = -1L, minoverlap = 0L, totalTest, by = c("region", "feature", "base"), ignore.strand = TRUE, connectedPeaks = c("min", "merge", "keepAll", "keepFirstListConsistent"), method = c("hyperG", "permutation"), TxDb, plot = TRUE, ... )
Peaks |
A list of peaks in GRanges format: See example below. |
NameOfPeaks |
Character vector to specify the name of Peaks, e.g., c("TF1", "TF2"). This will be used as label in the Venn Diagram. |
maxgap, minoverlap
|
Used in the internal call to
|
totalTest |
Numeric value to specify the total number of tests performed to obtain the list of peaks. It should be much larger than the number of peaks in the largest peak set. |
by |
"region", "feature" or "base", default = "region". "feature" means using feature field in the GRanges for calculating overlap, "region" means using chromosome range for calculating overlap, and "base" means calculating overlap in nucleotide level. |
ignore.strand |
Logical: when set to TRUE, the strand information is ignored in the overlap calculations. |
connectedPeaks |
If multiple peaks involved in overlapping in several groups, set it to "merge" will count it as only 1, while set it to "min" will count it as the minimal involved peaks in any connected peak group. "keepAll" will show all the orginal counts for each list while the final counts will be same as "min". "keepFirstListConsistent" will keep the counts consistent with first list. |
method |
method to be used for p value calculation. hyperG means hypergeometric test and permutation means peakPermTest. |
TxDb |
An object of TxDb. |
plot |
logical. If TRUE (default), a venn diagram is plotted. |
... |
Additional arguments to be passed to venn.diagram. |
For customized graph options, please see venn.diagram in VennDiagram package.
A p.value is calculated by hypergeometric test or permutation test to determine whether the overlaps of peaks or features are significant.
Lihua Julie Zhu, Jianhong Ou
findOverlapsOfPeaks, venn.diagram, peakPermTest
if (interactive()){ peaks1 <- GRanges(seqnames=c("1", "2", "3"), IRanges(start=c(967654, 2010897, 2496704), end=c(967754, 2010997, 2496804), names=c("Site1", "Site2", "Site3")), strand="+", feature=c("a","b","f")) peaks2 = GRanges(seqnames=c("1", "2", "3", "1", "2"), IRanges(start = c(967659, 2010898,2496700, 3075866,3123260), end = c(967869, 2011108, 2496920, 3076166, 3123470), names = c("t1", "t2", "t3", "t4", "t5")), strand = c("+", "+", "-", "-", "+"), feature=c("a","b","c","d","a")) makeVennDiagram(list(peaks1, peaks2), NameOfPeaks=c("TF1", "TF2"), totalTest=100,scaled=FALSE, euler.d=FALSE, fill=c("#009E73", "#F0E442"), # circle fill color col=c("#D55E00", "#0072B2"), #circle border color cat.col=c("#D55E00", "#0072B2")) makeVennDiagram(list(peaks1, peaks2), NameOfPeaks=c("TF1", "TF2"), totalTest=100, fill=c("#009E73", "#F0E442"), # circle fill color col=c("#D55E00", "#0072B2"), #circle border color cat.col=c("#D55E00", "#0072B2")) ###### 4-way diagram using annotated feature instead of chromosome ranges makeVennDiagram(list(peaks1, peaks2, peaks1, peaks2), NameOfPeaks=c("TF1", "TF2","TF3", "TF4"), totalTest=100, by="feature", main = "Venn Diagram for 4 peak lists", fill=c(1,2,3,4)) }if (interactive()){ peaks1 <- GRanges(seqnames=c("1", "2", "3"), IRanges(start=c(967654, 2010897, 2496704), end=c(967754, 2010997, 2496804), names=c("Site1", "Site2", "Site3")), strand="+", feature=c("a","b","f")) peaks2 = GRanges(seqnames=c("1", "2", "3", "1", "2"), IRanges(start = c(967659, 2010898,2496700, 3075866,3123260), end = c(967869, 2011108, 2496920, 3076166, 3123470), names = c("t1", "t2", "t3", "t4", "t5")), strand = c("+", "+", "-", "-", "+"), feature=c("a","b","c","d","a")) makeVennDiagram(list(peaks1, peaks2), NameOfPeaks=c("TF1", "TF2"), totalTest=100,scaled=FALSE, euler.d=FALSE, fill=c("#009E73", "#F0E442"), # circle fill color col=c("#D55E00", "#0072B2"), #circle border color cat.col=c("#D55E00", "#0072B2")) makeVennDiagram(list(peaks1, peaks2), NameOfPeaks=c("TF1", "TF2"), totalTest=100, fill=c("#009E73", "#F0E442"), # circle fill color col=c("#D55E00", "#0072B2"), #circle border color cat.col=c("#D55E00", "#0072B2")) ###### 4-way diagram using annotated feature instead of chromosome ranges makeVennDiagram(list(peaks1, peaks2, peaks1, peaks2), NameOfPeaks=c("TF1", "TF2","TF3", "TF4"), totalTest=100, by="feature", main = "Venn Diagram for 4 peak lists", fill=c(1,2,3,4)) }
Merge peaks from plus strand and minus strand within certain distance apart, and output merged peaks as bed format.
mergePlusMinusPeaks( peaks.file, columns = c("name", "chromosome", "start", "end", "strand", "count", "count", "count", "count"), sep = "\t", header = TRUE, distance.threshold = 100, plus.strand.start.gt.minus.strand.end = TRUE, output.bedfile )mergePlusMinusPeaks( peaks.file, columns = c("name", "chromosome", "start", "end", "strand", "count", "count", "count", "count"), sep = "\t", header = TRUE, distance.threshold = 100, plus.strand.start.gt.minus.strand.end = TRUE, output.bedfile )
peaks.file |
Specify the peak file. The peak file should contain peaks from both plus and minus strand |
columns |
Specify the column names in the peak file |
sep |
Specify column delimiter, default tab-delimited |
header |
Specify whether the file has a header row, default TRUE |
distance.threshold |
Specify the maximum gap allowed between the plus stranded and the nagative stranded peak |
plus.strand.start.gt.minus.strand.end |
Specify whether plus strand peak start greater than the paired negative strand peak end. Default to TRUE |
output.bedfile |
Specify the bed output file name |
output the merged peaks in bed file and a data frame of the bed format
Lihua Julie Zhu
Zhu L.J. et al. (2010) ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data. BMC Bioinformatics 2010, 11:237doi:10.1186/1471-2105-11-237
annotatePeakInBatch, findOverlappingPeaks, makeVennDiagram
if (interactive()) { data(myPeakList) data(TSS.human.NCBI36) library(matrixStats) peaks <- system.file("extdata", "guide-seq-peaks.txt", package = "ChIPpeakAnno") merged.bed <- mergePlusMinusPeaks(peaks.file = peaks, columns=c("name", "chromosome", "start", "end", "strand", "count", "count"), sep = "\t", header = TRUE, distance.threshold = 100, plus.strand.start.gt.minus.strand.end = TRUE, output.bedfile = "T2test100bp.bed") }if (interactive()) { data(myPeakList) data(TSS.human.NCBI36) library(matrixStats) peaks <- system.file("extdata", "guide-seq-peaks.txt", package = "ChIPpeakAnno") merged.bed <- mergePlusMinusPeaks(peaks.file = peaks, columns=c("name", "chromosome", "start", "end", "strand", "count", "count"), sep = "\t", header = TRUE, distance.threshold = 100, plus.strand.start.gt.minus.strand.end = TRUE, output.bedfile = "T2test100bp.bed") }
Bar plot for distance to features
metagenePlot( peaks, AnnotationData, PeakLocForDistance = c("middle", "start", "end"), FeatureLocForDistance = c("TSS", "middle", "geneEnd"), upstream = 1e+05, downstream = 1e+05 )metagenePlot( peaks, AnnotationData, PeakLocForDistance = c("middle", "start", "end"), FeatureLocForDistance = c("TSS", "middle", "geneEnd"), upstream = 1e+05, downstream = 1e+05 )
peaks |
peak list, GRanges object or a GRangesList. |
AnnotationData |
|
PeakLocForDistance |
Specify the location of peak for calculating distance,i.e., middle means using middle of the peak to calculate distance to feature, start means using start of the peak to calculate the distance to feature. To be compatible with previous version, by default using start |
FeatureLocForDistance |
Specify the location of feature for calculating distance,i.e., middle means using middle of the feature to calculate distance of peak to feature, TSS means using start of feature when feature is on plus strand and using end of feature when feature is on minus strand, geneEnd means using end of feature when feature is on plus strand and using start of feature when feature is on minus strand. |
upstream, downstream
|
numeric(1). Upstream or downstream region of features to plot. |
the bar heatmap is indicates the peaks around features.
path <- system.file("extdata", package="ChIPpeakAnno") files <- dir(path, "broadPeak") peaks <- sapply(file.path(path, files), toGRanges, format="broadPeak") peaks <- GRangesList(peaks) names(peaks) <- sub(".broadPeak", "", basename(names(peaks))) library(TxDb.Hsapiens.UCSC.hg19.knownGene) metagenePlot(peaks, TxDb.Hsapiens.UCSC.hg19.knownGene)path <- system.file("extdata", package="ChIPpeakAnno") files <- dir(path, "broadPeak") peaks <- sapply(file.path(path, files), toGRanges, format="broadPeak") peaks <- GRangesList(peaks) names(peaks) <- sub(".broadPeak", "", basename(names(peaks))) library(TxDb.Hsapiens.UCSC.hg19.knownGene) metagenePlot(peaks, TxDb.Hsapiens.UCSC.hg19.knownGene)
the putative STAT1-binding regions identified in un-stimulated cells using ChIP-seq technology (Robertson et al., 2007)
myPeakListmyPeakList
GRanges with slot rownames containing the ID of peak as character, slot start containing the start position of the peak, slot end containing the end position of the peak and seqnames containing the chromosome where the peak is located.
Robertson G, Hirst M, Bainbridge M, Bilenky M, Zhao Y, et al. (2007) Genome-wide profiles of STAT1 DNA association using chromatin immunoprecipitation and massively parallel sequencing. Nat Methods 4:651-7
data(myPeakList) slotNames(myPeakList)data(myPeakList) slotNames(myPeakList)
Prepare the oligonucleotide frequency for given Markov order.
oligoFrequency(sequence, MarkovOrder = 3L)oligoFrequency(sequence, MarkovOrder = 3L)
sequence |
The sequences packaged in DNAStringSet, DNAString object or output of function getAllPeakSequence. |
MarkovOrder |
Markov order. |
A numeric vector.
Jianhong Ou
See Also as oligoSummary
library(seqinr) library(Biostrings) oligoFrequency(DNAString("AATTCGACGTACAGATGACTAGACT"))library(seqinr) library(Biostrings) oligoFrequency(DNAString("AATTCGACGTACAGATGACTAGACT"))
Calculate the z-scores of all combinations of oligonucleotide in a given length by Markove chain.
oligoSummary( sequence, oligoLength = 6L, freqs = NULL, MarkovOrder = 3L, quickMotif = FALSE, revcomp = FALSE, maxsize = 1e+05 )oligoSummary( sequence, oligoLength = 6L, freqs = NULL, MarkovOrder = 3L, quickMotif = FALSE, revcomp = FALSE, maxsize = 1e+05 )
sequence |
The sequences packaged in DNAStringSet, DNAString object or output of function getAllPeakSequence. |
oligoLength |
The length of oligonucleotide. |
freqs |
Output of function frequency. |
MarkovOrder |
The order of Markov chain. |
quickMotif |
Generate the motif by z-score of not. |
revcomp |
Consider both the given strand and the reverse complement strand when searching for motifs in a complementable alphabet (ie DNA). Default, FALSE. |
maxsize |
Maximum allowed dataset size (in length of sequences). |
A list is returned.
zscore |
A numeric vector. The z-scores of each oligonucleotide. |
counts |
A numeric vector. The counts number of each oligonucleotide. |
motifs |
a list of motif matrix. |
Jianhong Ou
van Helden, Jacques, Marcel li del Olmo, and Jose E. Perez-Ortin. "Statistical analysis of yeast genomic downstream sequences reveals putative polyadenylation signals." Nucleic Acids Research 28.4 (2000): 1000-1010.
See Also as frequency
if(interactive() || Sys.getenv("USER")=="jou"){ data(annotatedPeak) library(BSgenome.Hsapiens.UCSC.hg19) library(seqinr) seq <- getAllPeakSequence(annotatedPeak[1:100], upstream=20, downstream=20, genome=Hsapiens) oligoSummary(seq) }if(interactive() || Sys.getenv("USER")=="jou"){ data(annotatedPeak) library(BSgenome.Hsapiens.UCSC.hg19) library(seqinr) seq <- getAllPeakSequence(annotatedPeak[1:100], upstream=20, downstream=20, genome=Hsapiens) oligoSummary(seq) }
Performs a permutation test to seee if there is an association between two given peak lists.
peakPermTest( peaks1, peaks2, ntimes = 100, seed = as.integer(Sys.time()), mc.cores = getOption("mc.cores", 2L), maxgap = -1L, pool, TxDb, bindingDistribution, bindingType = c("TSS", "geneEnd"), featureType = c("transcript", "exon"), seqn = NA, ... )peakPermTest( peaks1, peaks2, ntimes = 100, seed = as.integer(Sys.time()), mc.cores = getOption("mc.cores", 2L), maxgap = -1L, pool, TxDb, bindingDistribution, bindingType = c("TSS", "geneEnd"), featureType = c("transcript", "exon"), seqn = NA, ... )
peaks1, peaks2
|
an object of GRanges |
ntimes |
number of permutations |
seed |
random seed |
mc.cores |
The number of cores to use. see mclapply. |
maxgap |
See findOverlaps in the IRanges package for a description of these arguments. |
pool |
an object of permPool |
TxDb |
an object of TxDb |
bindingDistribution |
an object of bindist |
bindingType |
where the peaks should bind, TSS or geneEnd |
featureType |
what annotation type should be used for detecting the binding distribution. |
seqn |
default is NA, which means not filter the universe pool for sampling. Otherwise the universe pool will be filtered by the seqnames in seqn. |
... |
further arguments to be passed to numOverlaps. |
A list of class permTestResults. See permTest
Jianhong Ou
Davison, A. C. and Hinkley, D. V. (1997) Bootstrap methods and their application, Cambridge University Press, United Kingdom, 156-160
path <- system.file("extdata", package="ChIPpeakAnno") #files <- dir(path, pattern="[12]_WS170.bed", full.names=TRUE) #peaks1 <- toGRanges(files[1], skip=5) #peaks2 <- toGRanges(files[2], skip=5) #peakPermTest(peaks1, peaks2, TxDb=TxDb.Celegans.UCSC.ce6.ensGene) if(interactive()){ peaks1 <- toGRanges(file.path(path, "MACS2_peaks.xls"), format="MACS2") peaks2 <- toGRanges(file.path(path, "peaks.narrowPeak"), format="narrowPeak") library(TxDb.Hsapiens.UCSC.hg19.knownGene) peakPermTest(peaks1, peaks2, TxDb=TxDb.Hsapiens.UCSC.hg19.knownGene, min.pctA=10) }path <- system.file("extdata", package="ChIPpeakAnno") #files <- dir(path, pattern="[12]_WS170.bed", full.names=TRUE) #peaks1 <- toGRanges(files[1], skip=5) #peaks2 <- toGRanges(files[2], skip=5) #peakPermTest(peaks1, peaks2, TxDb=TxDb.Celegans.UCSC.ce6.ensGene) if(interactive()){ peaks1 <- toGRanges(file.path(path, "MACS2_peaks.xls"), format="MACS2") peaks2 <- toGRanges(file.path(path, "peaks.narrowPeak"), format="narrowPeak") library(TxDb.Hsapiens.UCSC.hg19.knownGene) peakPermTest(peaks1, peaks2, TxDb=TxDb.Hsapiens.UCSC.hg19.knownGene, min.pctA=10) }
Ste12-binding sites from biological replicate 1 in yeast (see reference)
Peaks.Ste12.Replicate1Peaks.Ste12.Replicate1
GRanges with slot names containing the ID of peak as character, slot start containing the start position of the peak, slot end containing the end position of the peak and space containing the chromosome where the peak is located.
Philippe Lefranois, Ghia M Euskirchen, Raymond K Auerbach, Joel Rozowsky, Theodore Gibson, Christopher M Yellman, Mark Gerstein and Michael Snyder (2009) Efficient yeast ChIP-Seq using multiplex short-read DNA sequencing BMC Genomics 10:37
data(Peaks.Ste12.Replicate1) Peaks.Ste12.Replicate1data(Peaks.Ste12.Replicate1) Peaks.Ste12.Replicate1
Ste12-binding sites from biological replicate 2 in yeast (see reference)
Peaks.Ste12.Replicate2Peaks.Ste12.Replicate2
GRanges with slot names containing the ID of peak as character, slot start containing the start position of the peak, slot end containing the end position of the peak and space containing the chromosome where the peak is located.
http://www.biomedcentral.com/1471-2164/10/37
Philippe Lefranois, Ghia M Euskirchen, Raymond K Auerbach, Joel Rozowsky, Theodore Gibson, Christopher M Yellman, Mark Gerstein and Michael Snyder (2009) Efficient yeast ChIP-Seq using multiplex short-read DNA sequencing BMC Genomics 10:37doi:10.1186/1471-2164-10-37
data(Peaks.Ste12.Replicate2) Peaks.Ste12.Replicate2data(Peaks.Ste12.Replicate2) Peaks.Ste12.Replicate2
Ste12-binding sites from biological replicate 3 in yeast (see reference)
Peaks.Ste12.Replicate3Peaks.Ste12.Replicate3
GRanges with slot names containing the ID of peak as character, slot start containing the start position of the peak, slot end containing the end position of the peak and space containing the chromosome where the peak is located.
http://www.biomedcentral.com/1471-2164/10/37
Philippe Lefranois, Ghia M Euskirchen, Raymond K Auerbach, Joel Rozowsky, Theodore Gibson, Christopher M Yellman, Mark Gerstein and Michael Snyder (2009) Efficient yeast ChIP-Seq using multiplex short-read DNA sequencing BMC Genomics 10:37doi:10.1186/1471-2164-10-37
data(Peaks.Ste12.Replicate3) Peaks.Ste12.Replicate3data(Peaks.Ste12.Replicate3) Peaks.Ste12.Replicate3
An example GRanges object representing a ChIP-seq peak dataset
peaks1peaks1
GRanges
data(peaks1) head(peaks1, n = 2)data(peaks1) head(peaks1, n = 2)
An example GRanges object representing a ChIP-seq peak dataset
peaks2peaks2
GRanges
data(peaks2) head(peaks2, n = 2)data(peaks2) head(peaks2, n = 2)
An example GRanges object representing a ChIP-seq peak dataset
peaks3peaks3
GRanges
data(peaks3) head(peaks3, n = 2)data(peaks3) head(peaks3, n = 2)
Obtain the peaks near bi-directional promoters. Also output percent of peaks near bi-directional promoters.
peaksNearBDP(myPeakList, AnnotationData, MaxDistance = 5000L, ...)peaksNearBDP(myPeakList, AnnotationData, MaxDistance = 5000L, ...)
myPeakList |
GRanges: See example below |
AnnotationData |
annotation data obtained from getAnnotation or customized annotation of class GRanges containing additional variable: strand (1 or + for plus strand and -1 or - for minus strand). For example, data(TSS.human.NCBI36), data(TSS.mouse.NCBIM37), data(TSS.rat.RGSC3.4) and data(TSS.zebrafish.Zv8). |
MaxDistance |
Specify the maximum gap allowed between the peak and nearest gene |
... |
Not used |
A list of 4
list("peaksWithBDP") |
annotated Peaks containing bi-directional promoters. GRangesList with slot start holding the start position of the peak, slot end holding the end position of the peak, slot space holding the chromosome location where the peak is located, slot rownames holding the id of the peak. In addition, the following variables are included. feature: id of the feature such as ensembl gene ID insideFeature: upstream: peak resides upstream of the feature; downstream: peak resides downstream of the feature; inside: peak resides inside the feature; overlapStart: peak overlaps with the start of the feature; overlapEnd: peak overlaps with the end of the feature; includeFeature: peak include the feature entirely. distancetoFeature: distance to the nearest feature such as transcription start site. By default, the distance is calculated as the distance between the start of the binding site and the TSS that is the gene start for genes located on the forward strand and the gene end for genes located on the reverse strand. The user can specify the location of peak and location of feature for calculating this feature_range: start and end position of the feature such as gene feature_strand: 1 or + for positive strand and -1 or - for negative strand where the feature is located |
list("percentPeaksWithBDP") |
The percent of input peaks containing bi-directional promoters |
list("n.peaks") |
The total number of input peaks |
list("n.peaksWithBDP") |
The # of input peaks containing bi-directional promoters |
Lihua Julie Zhu, Jianhong Ou
Zhu L.J. et al. (2010) ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data. BMC Bioinformatics 2010, 11:237doi:10.1186/1471-2105-11-237
annotatePeakInBatch, findOverlappingPeaks, makeVennDiagram
if (interactive() || Sys.getenv("USER")=="jou") { library(GenomeInfoDb) data(myPeakList) data(TSS.human.NCBI36) seqlevelsStyle(TSS.human.NCBI36) <- seqlevelsStyle(myPeakList) annotatedBDP = peaksNearBDP(myPeakList[1:6,], AnnotationData=TSS.human.NCBI36, MaxDistance=5000, PeakLocForDistance = "middle", FeatureLocForDistance = "TSS") c(annotatedBDP$percentPeaksWithBDP, annotatedBDP$n.peaks, annotatedBDP$n.peaksWithBDP) }if (interactive() || Sys.getenv("USER")=="jou") { library(GenomeInfoDb) data(myPeakList) data(TSS.human.NCBI36) seqlevelsStyle(TSS.human.NCBI36) <- seqlevelsStyle(myPeakList) annotatedBDP = peaksNearBDP(myPeakList[1:6,], AnnotationData=TSS.human.NCBI36, MaxDistance=5000, PeakLocForDistance = "middle", FeatureLocForDistance = "TSS") c(annotatedBDP$percentPeaksWithBDP, annotatedBDP$n.peaks, annotatedBDP$n.peaksWithBDP) }
"permPool"
An object of class "permPool" represents the possible locations to do
permutation test.
grsobject of "GRangesList" The list of binding ranges
Nvector of "integer", permutation number for each ranges
Objects can be created by calls of the form
new("permPool", grs="GRangesList", N="integer").
Draw a pie chart with percentage
pie1( x, labels = names(x), edges = 200, radius = 0.8, clockwise = FALSE, init.angle = if (clockwise) 90 else 0, density = NULL, angle = 45, col = NULL, border = NULL, lty = NULL, main = NULL, percentage = TRUE, rawNumber = FALSE, digits = 3, cutoff = 0.01, legend = FALSE, legendpos = "topright", legendcol = 2, radius.innerlabel = radius, ... )pie1( x, labels = names(x), edges = 200, radius = 0.8, clockwise = FALSE, init.angle = if (clockwise) 90 else 0, density = NULL, angle = 45, col = NULL, border = NULL, lty = NULL, main = NULL, percentage = TRUE, rawNumber = FALSE, digits = 3, cutoff = 0.01, legend = FALSE, legendpos = "topright", legendcol = 2, radius.innerlabel = radius, ... )
x |
a vector of non-negative numerical quantities. The values in x are displayed as the areas of pie slices. |
labels |
one or more expressions or character strings giving names for the slices. Other objects are coerced by as.graphicsAnnot. For empty or NA (after coercion to character) labels, no label nor pointing line is drawn. |
edges |
the circular outline of the pie is approximated by a polygon with this many edges. |
radius |
the pie is drawn centered in a square box whose sides range from -1 to 1. If the character strings labeling the slices are long it may be necessary to use a smaller radius. |
clockwise |
logical indicating if slices are drawn clockwise or counter clockwise (i.e., mathematically positive direction), the latter is default. |
init.angle |
number specifying the starting angle (in degrees) for the slices. Defaults to 0 (i.e., "3 o'clock") unless clockwise is true where init.angle defaults to 90 (degrees), (i.e., "12 o'clock"). |
density |
the density of shading lines, in lines per inch. The default value of NULL means that no shading lines are drawn. Non-positive values of density also inhibit the drawing of shading lines. |
angle |
the slope of shading lines, given as an angle in degrees (counter-clockwise). |
col |
a vector of colors to be used in filling or shading the slices. If missing a set of 6 pastel colours is used, unless density is specified when par("fg") is used. |
border, lty
|
(possibly vectors) arguments passed to polygon which draws each slice. |
main |
an overall title for the plot. |
percentage |
logical. Add percentage in the figure or not. default TRUE. |
rawNumber |
logical. Instead percentage, add raw number in the figure or not. default FALSE. |
digits |
When set percentage as TRUE, how many significant digits are to be used for percentage. see format. default 3. |
cutoff |
When percentage is TRUE, if the percentage is lower than cutoff, it will NOT be shown. default 0.01. |
legend |
logical. Instead of lable, draw legend for the pie. default, FALSE. |
legendpos, legendcol
|
legend position and legend columns. see legend |
radius.innerlabel |
position of percentage or raw number label relative to the circle. |
... |
graphical parameters can be given as arguments to pie. They will affect the main title and labels only. |
Jianhong Ou
pie1(1:5)pie1(1:5)
plot the output of binOverRegions or binOverGene
plotBinOverRegions(dat, ...)plotBinOverRegions(dat, ...)
dat |
A list of matrix which indicate the coverage of regions per bin |
... |
Parameters could be used by matplot |
Jianhong Ou
if(interactive()){ path <- system.file("extdata", package="ChIPpeakAnno") library(TxDb.Hsapiens.UCSC.hg19.knownGene) library(rtracklayer) files <- dir(path, "bigWig") if(.Platform$OS.type != "windows"){ cvglists <- lapply(file.path(path, files), import, format="BigWig", as="RleList") names(cvglists) <- sub(".bigWig", "", files) d <- binOverGene(cvglists, TxDb.Hsapiens.UCSC.hg19.knownGene) plotBinOverRegions(d) } }if(interactive()){ path <- system.file("extdata", package="ChIPpeakAnno") library(TxDb.Hsapiens.UCSC.hg19.knownGene) library(rtracklayer) files <- dir(path, "bigWig") if(.Platform$OS.type != "windows"){ cvglists <- lapply(file.path(path, files), import, format="BigWig", as="RleList") names(cvglists) <- sub(".bigWig", "", files) d <- binOverGene(cvglists, TxDb.Hsapiens.UCSC.hg19.knownGene) plotBinOverRegions(d) } }
prepare data for permutation test peakPermTest
preparePool( TxDb, template, bindingDistribution, bindingType = c("TSS", "geneEnd"), featureType = c("transcript", "exon"), seqn = NA )preparePool( TxDb, template, bindingDistribution, bindingType = c("TSS", "geneEnd"), featureType = c("transcript", "exon"), seqn = NA )
TxDb |
an object of TxDb |
template |
an object of GRanges |
bindingDistribution |
an object of bindist |
bindingType |
the relevant position to features |
featureType |
feature type, transcript or exon. |
seqn |
seqnames. If given, the pool for permutation will be restrict in the given chromosomes. |
a list with two elements, grs, a list of GRanges. N, the numbers of elements should be drawn from in each GRanges.
Jianhong Ou
if(interactive() || Sys.getenv("USER")=="jou"){ path <- system.file("extdata", package="ChIPpeakAnno") peaksA <- toGRanges(file.path(path, "peaks.narrowPeak"), format="narrowPeak") peaksB <- toGRanges(file.path(path, "MACS2_peaks.xls"), format="MACS2") library(TxDb.Hsapiens.UCSC.hg19.knownGene) ppp <- preparePool(TxDb.Hsapiens.UCSC.hg19.knownGene, peaksA, bindingType="TSS", featureType="transcript") }if(interactive() || Sys.getenv("USER")=="jou"){ path <- system.file("extdata", package="ChIPpeakAnno") peaksA <- toGRanges(file.path(path, "peaks.narrowPeak"), format="narrowPeak") peaksB <- toGRanges(file.path(path, "MACS2_peaks.xls"), format="MACS2") library(TxDb.Hsapiens.UCSC.hg19.knownGene) ppp <- preparePool(TxDb.Hsapiens.UCSC.hg19.knownGene, peaksA, bindingType="TSS", featureType="transcript") }
Create a new list of peaks based on the peak centers of given list.
reCenterPeaks(peaks, width = 2000L, ...)reCenterPeaks(peaks, width = 2000L, ...)
peaks |
|
width |
The width of new peaks |
... |
Not used. |
An object of GRanges.
Jianhong Ou
reCenterPeaks(GRanges("chr1", IRanges(1, 10)), width=2)reCenterPeaks(GRanges("chr1", IRanges(1, 10)), width=2)
summarizeOverlapsByBins extends summarizeOverlaps by providing fixed window size and step to split each feature into bins and then do queries. It will return counts by signalSummaryFUN, which applied to bins in one feature, for each feature.
summarizeOverlapsByBins( targetRegions, reads, windowSize = 50, step = 10, signalSummaryFUN = max, mode = countByOverlaps, ... )summarizeOverlapsByBins( targetRegions, reads, windowSize = 50, step = 10, signalSummaryFUN = max, mode = countByOverlaps, ... )
targetRegions |
A GRanges object of genomic regions of interest. |
reads |
A GRanges,
GRangesList
GAlignments,
GAlignmentsList,
GAlignmentPairs or
BamFileList object that represents the data
to be counted by
|
windowSize |
Size of windows |
step |
Step of windows |
signalSummaryFUN |
function, which will be applied to the bins in each feature. |
mode |
mode can be one of the pre-defined count methods. see summarizeOverlaps. default is countByOverlaps, alia of countOverlaps(features, reads, ignore.strand=ignore.strand) |
... |
Additional arguments passed to
|
A RangedSummarizedExperiment object. The assays slot holds the counts, rowRanges holds the annotation from features.
Jianhong Ou
fls <- list.files(system.file("extdata", package="GenomicAlignments"), recursive=TRUE, pattern="*bam$", full=TRUE) names(fls) <- basename(fls) genes <- GRanges( seqnames = c(rep("chr2L", 4), rep("chr2R", 5), rep("chr3L", 2)), ranges = IRanges(c(1000, 3000, 4000, 7000, 2000, 3000, 3600, 4000, 7500, 5000, 5400), width=c(rep(500, 3), 600, 900, 500, 300, 900, 300, 500, 500), names=letters[1:11])) se <- summarizeOverlapsByBins(genes, fls, windowSize=50, step=10)fls <- list.files(system.file("extdata", package="GenomicAlignments"), recursive=TRUE, pattern="*bam$", full=TRUE) names(fls) <- basename(fls) genes <- GRanges( seqnames = c(rep("chr2L", 4), rep("chr2R", 5), rep("chr3L", 2)), ranges = IRanges(c(1000, 3000, 4000, 7000, 2000, 3000, 3600, 4000, 7500, 5000, 5400), width=c(rep(500, 3), 600, 900, 500, 300, 900, 300, 500, 500), names=letters[1:11])) se <- summarizeOverlapsByBins(genes, fls, windowSize=50, step=10)
Output a summary of the occurrence and enrichment of each pattern in the sequences.
summarizePatternInPeaks( patternFilePath, format = "fasta", BSgenomeName, peaks, revcomp = TRUE, method = c("binom.test", "permutation.test"), expectFrequencyMethod = c("Markov", "Naive"), MarkovOrder = 3L, bgdForPerm = c("shuffle", "chromosome"), chromosome = c("asPeak", "random"), nperm = 1000, alpha = 0.05, ... )summarizePatternInPeaks( patternFilePath, format = "fasta", BSgenomeName, peaks, revcomp = TRUE, method = c("binom.test", "permutation.test"), expectFrequencyMethod = c("Markov", "Naive"), MarkovOrder = 3L, bgdForPerm = c("shuffle", "chromosome"), chromosome = c("asPeak", "random"), nperm = 1000, alpha = 0.05, ... )
patternFilePath |
Character value. The path to the file that contains the pattern. |
format |
Character value. The format of file containing the oligonucleotide pattern, either "fasta" (default) or "fastq". |
BSgenomeName |
Character value. BSgenome object. Please refer to available.genomes in BSgenome package for details. |
peaks |
Character value. GRanges containing the peaks. |
revcomp |
Boolean value, if TURE, also search the reverse compliment of pattern. Default is TRUE. |
method |
Character value. Method for pattern enrichment test, 'binom.test' (default) or 'permutation.test'. |
expectFrequencyMethod |
Character value. Method for calculating the expected probability of pattern occurrence, 'Markov' (default) or 'Naive'. |
MarkovOrder |
Integer value. The order of Markov chain. Default is 3. |
bgdForPerm |
Character value. The method for obtaining the background sequence. 'chromosome' (default) selects background chromosome from chromosomes, refer to 'chromosome' parameter; 'shuffle' will obtain the backgroud sequence by shufflubg any k-mers in peak sequences, refer to '...'. |
chromosome |
Character value. Relevant if "bgdForPerm='chromosome'". 'asPeak' means to use the same chromosomes in peaks; 'random' means to use all chromosomes randomly. Default is 'asPeak'. |
nperm |
Integer value. The number of permutation test, default is 1000. |
alpha |
Numeric value. The significant level for permutation test, default is 0.05. |
... |
Aditional parameter passed to function shuffle_sequences |
Please see shuffle_sequences for the more information bout 'shuffle' method.
A list including two data frames named 'motif_enrichment' and 'motif_occurrence'. The 'motif_enrichment' has four columns:
"patternNum": number of matched pattern
"totalNumPatternWithSameLen": total number of pattern with the same length
"expectedRate": expected rate of pattern for 'binom.test' method
"patternRate": real rate of pattern for 'permutation.test' method
"pValueBinomTest": p value of bimom test for 'binom.test' method
"cutOffPermutationTest": cut off of permutation test for 'permutation.test' method
The 'motif_occurrence' has 14 columns:
"motifChr": Chromosome of motif
"motifStartInChr": motif start position in chromosome
"motifEndInChr": motif end position in chromosome
"motifName": motif name
"motifPattern": motif pattern
"motifStartInPeak": motif start position in peak
"motifEndInPeak": motif end position in peak
"motifFound": specific motif Found in peak
"motifFoundStrand": strand of specific motif Found in peak, "-" means reverse complement of motif found in peaks
"peakChr": Chromosome of peak
"peakStart": peak start position
"peakEnd": peak end position
"peakWidth": peak width
"peakStrand": peak strand
Lihua Julie Zhu, Junhui Li, Kai Hu
library(BSgenome.Hsapiens.UCSC.hg19) filepath <- system.file("extdata", "examplePattern.fa", package = "ChIPpeakAnno") peaks <- GRanges(seqnames = c("chr17", "chr3", "chr12", "chr8"), IRanges(start = c(41275784, 10076141, 4654135, 31024288), end = c(41276382, 10076732, 4654728, 31024996), names = paste0("peak", 1:4))) result <- summarizePatternInPeaks(patternFilePath = filepath, peaks = peaks, BSgenomeName = Hsapiens)library(BSgenome.Hsapiens.UCSC.hg19) filepath <- system.file("extdata", "examplePattern.fa", package = "ChIPpeakAnno") peaks <- GRanges(seqnames = c("chr17", "chr3", "chr12", "chr8"), IRanges(start = c(41275784, 10076141, 4654135, 31024288), end = c(41276382, 10076732, 4654728, 31024996), names = paste0("peak", 1:4))) result <- summarizePatternInPeaks(patternFilePath = filepath, peaks = peaks, BSgenomeName = Hsapiens)
tileCount extends summarizeOverlaps by providing fixed window size and step to split whole genome into windows and then do queries. It will return counts in each windows.
tileCount( reads, genome, windowSize = 1e+06, step = 1e+06, keepPartialWindow = FALSE, mode = countByOverlaps, ... )tileCount( reads, genome, windowSize = 1e+06, step = 1e+06, keepPartialWindow = FALSE, mode = countByOverlaps, ... )
reads |
A GRanges,
GRangesList
GAlignments,
GAlignmentsList,
GAlignmentPairs or
BamFileList object that represents the data
to be counted by
|
genome |
The object from/on which to get/set the sequence information. |
windowSize |
Size of windows |
step |
Step of windows |
keepPartialWindow |
Keep last partial window or not. |
mode |
mode can be one of the pre-defined count methods. see summarizeOverlaps. default is countByOverlaps, alia of countOverlaps(features, reads, ignore.strand=ignore.strand) |
... |
Additional arguments passed to
|
A RangedSummarizedExperiment object. The assays slot holds the counts, rowRanges holds the annotation from genome.
Jianhong Ou
fls <- list.files(system.file("extdata", package="GenomicAlignments"), recursive=TRUE, pattern="*bam$", full=TRUE) names(fls) <- basename(fls) genes <- GRanges(seqlengths = c(chr2L=7000, chr2R=10000)) se <- tileCount(fls, genes, windowSize=1000, step=500)fls <- list.files(system.file("extdata", package="GenomicAlignments"), recursive=TRUE, pattern="*bam$", full=TRUE) names(fls) <- basename(fls) genes <- GRanges(seqlengths = c(chr2L=7000, chr2R=10000)) se <- tileCount(fls, genes, windowSize=1000, step=500)
tileGRanges returns a set of genomic regions by sliding the windows in a given step. Each window is called a "tile".
tileGRanges(targetRegions, windowSize, step, keepPartialWindow = FALSE, ...)tileGRanges(targetRegions, windowSize, step, keepPartialWindow = FALSE, ...)
targetRegions |
A GRanges object of genomic regions of interest. |
windowSize |
Size of windows |
step |
Step of windows |
keepPartialWindow |
Keep last partial window or not. |
... |
Not used. |
A GRanges object.
Jianhong Ou
genes <- GRanges( seqnames = c(rep("chr2L", 4), rep("chr2R", 5), rep("chr3L", 2)), ranges = IRanges(c(1000, 3000, 4000, 7000, 2000, 3000, 3600, 4000, 7500, 5000, 5400), width=c(rep(500, 3), 600, 900, 500, 300, 900, 300, 500, 500), names=letters[1:11])) se <- tileGRanges(genes, windowSize=50, step=10)genes <- GRanges( seqnames = c(rep("chr2L", 4), rep("chr2R", 5), rep("chr3L", 2)), ranges = IRanges(c(1000, 3000, 4000, 7000, 2000, 3000, 3600, 4000, 7500, 5000, 5400), width=c(rep(500, 3), 600, 900, 500, 300, 900, 300, 500, 500), names=letters[1:11])) se <- tileGRanges(genes, windowSize=50, step=10)
Convert UCSC BED format and its variants, such as GFF, or any user defined dataset such as MACS output file to GRanges
toGRanges(data, ...) ## S4 method for signature 'connection' toGRanges( data, format = c("BED", "GFF", "GTF", "MACS", "MACS2", "MACS2.broad", "narrowPeak", "broadPeak", "CSV", "others"), header = FALSE, comment.char = "#", colNames = NULL, ... ) ## S4 method for signature 'TxDb' toGRanges( data, feature = c("gene", "transcript", "exon", "CDS", "fiveUTR", "threeUTR", "tRNAs", "geneModel"), OrganismDb, ... ) ## S4 method for signature 'EnsDb' toGRanges( data, feature = c("gene", "transcript", "exon", "disjointExons"), ... ) ## S4 method for signature 'character' toGRanges( data, format = c("BED", "GFF", "GTF", "MACS", "MACS2", "MACS2.broad", "narrowPeak", "broadPeak", "CSV", "others"), header = FALSE, comment.char = "#", colNames = NULL, ... )toGRanges(data, ...) ## S4 method for signature 'connection' toGRanges( data, format = c("BED", "GFF", "GTF", "MACS", "MACS2", "MACS2.broad", "narrowPeak", "broadPeak", "CSV", "others"), header = FALSE, comment.char = "#", colNames = NULL, ... ) ## S4 method for signature 'TxDb' toGRanges( data, feature = c("gene", "transcript", "exon", "CDS", "fiveUTR", "threeUTR", "tRNAs", "geneModel"), OrganismDb, ... ) ## S4 method for signature 'EnsDb' toGRanges( data, feature = c("gene", "transcript", "exon", "disjointExons"), ... ) ## S4 method for signature 'character' toGRanges( data, format = c("BED", "GFF", "GTF", "MACS", "MACS2", "MACS2.broad", "narrowPeak", "broadPeak", "CSV", "others"), header = FALSE, comment.char = "#", colNames = NULL, ... )
data |
an object of data.frame, TxDb or EnsDb, or the file name of data to be imported. Alternatively, data can be a readable txt-mode connection (See ?read.table). |
... |
parameters passed to read.table |
format |
data format. If the data format is set to BED, GFF, narrowPeak or broadPeak, please refer to http://genome.ucsc.edu/FAQ/FAQformat#format1 for column order. "MACS" is for converting the excel output file from MACS1. "MACS2" is for converting the output file from MACS2. If set to CSV, must have columns: seqnames, start, end, strand. |
header |
A logical value indicating whether the file contains the names of the variables as its first line. If missing, the value is determined from the file format: header is set to TRUE if the first row contains one fewer field than the number of columns or the format is set to 'CSV'. |
comment.char |
character: a character vector of length one containing a single character or an empty string. Use "" to turn off the interpretation of comments altogether. |
colNames |
If the data format is set to "others", colname must be defined. And the colname must contain space, start and end. The column name for the chromosome # should be named as space. |
feature |
annotation type |
OrganismDb |
an object of OrganismDb. It is used for extracting gene symbol for geneModel group for TxDb |
An object of GRanges
Jianhong Ou
macs <- system.file("extdata", "MACS_peaks.xls", package="ChIPpeakAnno") macsOutput <- toGRanges(macs, format="MACS") if(interactive() || Sys.getenv("USER")=="jou"){ ## MACS connection macs <- readLines(macs) macs <- textConnection(macs) macsOutput <- toGRanges(macs, format="MACS") close(macs) ## bed toGRanges(system.file("extdata", "MACS_output.bed", package="ChIPpeakAnno"), format="BED") ## narrowPeak toGRanges(system.file("extdata", "peaks.narrowPeak", package="ChIPpeakAnno"), format="narrowPeak") ## broadPeak toGRanges(system.file("extdata", "TAF.broadPeak", package="ChIPpeakAnno"), format="broadPeak") ## CSV toGRanges(system.file("extdata", "peaks.csv", package="ChIPpeakAnno"), format="CSV") ## MACS2 toGRanges(system.file("extdata", "MACS2_peaks.xls", package="ChIPpeakAnno"), format="MACS2") ## GFF toGRanges(system.file("extdata", "GFF_peaks.gff", package="ChIPpeakAnno"), format="GFF") ## EnsDb library(EnsDb.Hsapiens.v75) toGRanges(EnsDb.Hsapiens.v75, feature="gene") ## TxDb library(TxDb.Hsapiens.UCSC.hg19.knownGene) toGRanges(TxDb.Hsapiens.UCSC.hg19.knownGene, feature="gene") ## data.frame macs <- system.file("extdata", "MACS_peaks.xls", package="ChIPpeakAnno") macs <- read.delim(macs, comment.char="#") toGRanges(macs) }macs <- system.file("extdata", "MACS_peaks.xls", package="ChIPpeakAnno") macsOutput <- toGRanges(macs, format="MACS") if(interactive() || Sys.getenv("USER")=="jou"){ ## MACS connection macs <- readLines(macs) macs <- textConnection(macs) macsOutput <- toGRanges(macs, format="MACS") close(macs) ## bed toGRanges(system.file("extdata", "MACS_output.bed", package="ChIPpeakAnno"), format="BED") ## narrowPeak toGRanges(system.file("extdata", "peaks.narrowPeak", package="ChIPpeakAnno"), format="narrowPeak") ## broadPeak toGRanges(system.file("extdata", "TAF.broadPeak", package="ChIPpeakAnno"), format="broadPeak") ## CSV toGRanges(system.file("extdata", "peaks.csv", package="ChIPpeakAnno"), format="CSV") ## MACS2 toGRanges(system.file("extdata", "MACS2_peaks.xls", package="ChIPpeakAnno"), format="MACS2") ## GFF toGRanges(system.file("extdata", "GFF_peaks.gff", package="ChIPpeakAnno"), format="GFF") ## EnsDb library(EnsDb.Hsapiens.v75) toGRanges(EnsDb.Hsapiens.v75, feature="gene") ## TxDb library(TxDb.Hsapiens.UCSC.hg19.knownGene) toGRanges(TxDb.Hsapiens.UCSC.hg19.knownGene, feature="gene") ## data.frame macs <- system.file("extdata", "MACS_peaks.xls", package="ChIPpeakAnno") macs <- read.delim(macs, comment.char="#") toGRanges(macs) }
translate pattern containing the IUPAC nucleotide ambiguity codes to regular expression. For example,Y->[C|T], R-> [A|G], S-> [G|C], W-> [A|T], K-> [T|U|G], M-> [A|C], B-> [C|G|T], D-> [A|G|T], H-> [A|C|T], V-> [A|C|G] and N-> [A|C|T|G].
translatePattern(pattern)translatePattern(pattern)
pattern |
a character vector with the IUPAC nucleotide ambiguity codes |
a character vector with the pattern represented as regular expression
Lihua Julie Zhu
countPatternInSeqs, summarizePatternInPeaks
pattern1 = "AACCNWMK" translatePattern(pattern1)pattern1 = "AACCNWMK" translatePattern(pattern1)
TSS annotation for human sapiens (GRCh37) obtained from biomaRt
TSS.human.GRCh37TSS.human.GRCh37
A GRanges object with slot start holding the start position of the gene, slot end holding the end position of the gene, slot names holding ensembl gene id, slot seqnames holding the chromosome location where the gene is located and slot strand holding the strinad information. In addition, the following variables are included.
description of the gene
The dataset TSS.human.GRCh37 was obtained by:
mart = useMart(biomart = "ENSEMBL_MART_ENSEMBL", host="grch37.ensembl.org", path="/biomart/martservice", dataset = "hsapiens_gene_ensembl")
getAnnotation(mart, featureType = "TSS")
data(TSS.human.GRCh37) slotNames(TSS.human.GRCh37)data(TSS.human.GRCh37) slotNames(TSS.human.GRCh37)
TSS annotation for human sapiens (GRCh38) obtained from biomaRt
TSS.human.GRCh38TSS.human.GRCh38
A 'GRanges' [package "GenomicRanges"] object with ensembl id as names.
used in the examples Annotation data obtained by:
mart = useMart(biomart = "ensembl", dataset = "hsapiens_gene_ensembl")
getAnnotation(mart, featureType = "TSS")
data(TSS.human.GRCh38) slotNames(TSS.human.GRCh38)data(TSS.human.GRCh38) slotNames(TSS.human.GRCh38)
TSS annotation for human sapiens (NCBI36) obtained from biomaRt
TSS.human.NCBI36TSS.human.NCBI36
GRanges with slot start holding the start position of the gene, slot end holding the end position of the gene, slot names holding ensembl gene id, slot seqnames holding the chromosome location where the gene is located and slot strand holding the strinad information. In addition, the following variables are included.
description of the gene
used in the examples Annotation data obtained by:
mart = useMart(biomart = "ensembl_mart_47", dataset = "hsapiens_gene_ensembl", archive=TRUE)
getAnnotation(mart, featureType = "TSS")
data(TSS.human.NCBI36) slotNames(TSS.human.NCBI36)data(TSS.human.NCBI36) slotNames(TSS.human.NCBI36)
TSS annotation data for Mus musculus (GRCm38.p1) obtained from biomaRt
TSS.mouse.GRCm38TSS.mouse.GRCm38
GRanges with slot start holding the start position of the gene, slot end holding the end position of the gene, slot names holding ensembl gene id, slot seqnames holding the chromosome location where the gene is located and slot strand holding the strinad information. In addition, the following variables are included.
description of the gene
Annotation data obtained by:
mart = useMart(biomart = "ensembl", dataset = "mmusculus_gene_ensembl")
getAnnotation(mart, featureType = "TSS")
data(TSS.mouse.GRCm38) slotNames(TSS.mouse.GRCm38)data(TSS.mouse.GRCm38) slotNames(TSS.mouse.GRCm38)
TSS annotation data for mouse (NCBIM37) obtained from biomaRt
TSS.mouse.NCBIM37TSS.mouse.NCBIM37
GRanges with slot start holding the start position of the gene, slot end holding the end position of the gene, slot names holding ensembl gene id, slot seqnames holding the chromosome location where the gene is located and slot strand holding the strinad information. In addition, the following variables are included.
description of the gene
Annotation data obtained by:
mart = useMart(biomart = "ensembl", dataset = "mmusculus_gene_ensembl")
getAnnotation(mart, featureType = "TSS")
data(TSS.mouse.NCBIM37) slotNames(TSS.mouse.NCBIM37)data(TSS.mouse.NCBIM37) slotNames(TSS.mouse.NCBIM37)
TSS annotation data for rat (RGSC3.4) obtained from biomaRt
TSS.rat.RGSC3.4TSS.rat.RGSC3.4
GRanges with slot start holding the start position of the gene, slot end holding the end position of the gene, slot names holding ensembl gene id, slot seqnames holding the chromosome location where the gene is located and slot strand holding the strinad information. In addition, the following variables are included.
description of the gene
Annotation data obtained by:
mart = useMart(biomart = "ensembl", dataset = "rnorvegicus_gene_ensembl")
getAnnotation(mart, featureType = "TSS")
data(TSS.rat.RGSC3.4) slotNames(TSS.rat.RGSC3.4)data(TSS.rat.RGSC3.4) slotNames(TSS.rat.RGSC3.4)
TSS annotation data for Rattus norvegicus (Rnor_5.0) obtained from biomaRt
TSS.rat.Rnor_5.0TSS.rat.Rnor_5.0
GRanges with slot start holding the start position of the gene, slot end holding the end position of the gene, slot names holding ensembl gene id, slot seqnames holding the chromosome location where the gene is located and slot strand holding the strinad information. In addition, the following variables are included.
description of the gene
Annotation data obtained by:
mart = useMart(biomart = "ensembl", dataset = "rnorvegicus_gene_ensembl")
getAnnotation(mart, featureType = "TSS")
data(TSS.rat.Rnor_5.0) slotNames(TSS.rat.Rnor_5.0)data(TSS.rat.Rnor_5.0) slotNames(TSS.rat.Rnor_5.0)
A GRanges object to annotate TSS for zebrafish (Zv8) obtained from biomaRt
TSS.zebrafish.Zv8TSS.zebrafish.Zv8
GRanges with slot start holding the start position of the gene, slot end holding the end position of the gene, slot names holding ensembl gene id, slot seqnames holding the chromosome location where the gene is located and slot strand holding the strinad information. In addition, the following variables are included.
description of the gene
Annotation data obtained by: mart <- useMart(biomart="ENSEMBL_MART_ENSEMBL", host="may2009.archive.ensembl.org", path="/biomart/martservice", dataset="drerio_gene_ensembl")
getAnnotation(mart, featureType = "TSS")
data(TSS.zebrafish.Zv8) slotNames(TSS.zebrafish.Zv8)data(TSS.zebrafish.Zv8) slotNames(TSS.zebrafish.Zv8)
TSS annotation for Danio rerio (Zv9) obtained from biomaRt
TSS.zebrafish.Zv9TSS.zebrafish.Zv9
GRanges with slot start holding the start position of the gene, slot end holding the end position of the gene, slot names holding ensembl gene id, slot seqnames holding the chromosome location where the gene is located and slot strand holding the strinad information. In addition, the following variables are included.
description of the gene
Annotation data obtained by:
mart <- useMart(biomart="ENSEMBL_MART_ENSEMBL", host="mar2015.archive.ensembl.org", path="/biomart/martservice", dataset="drerio_gene_ensembl")
getAnnotation(mart, featureType = "TSS")
data(TSS.zebrafish.Zv9) slotNames(TSS.zebrafish.Zv9)data(TSS.zebrafish.Zv9) slotNames(TSS.zebrafish.Zv9)
convert TxDb object to GRanges
TxDb2GR(ranges, feature, OrganismDb)TxDb2GR(ranges, feature, OrganismDb)
ranges |
an Txdb object |
feature |
feature type, could be geneModel, gene, exon, transcript, CDS, fiveUTR, threeUTR, microRNA, and tRNA |
OrganismDb |
org db object |
possible binding pool for human (hg19) from transcription factor binding site clusters (V3) from ENCODE data and removed the HOT spots
wgEncodeTfbsV3wgEncodeTfbsV3
An object of GRanges.
How to generate the data:
temp <- tempfile()
download.file(file.path("http://hgdownload.cse.ucsc.edu", "goldenPath",
"hg19", "encodeDCC",
"wgEncodeRegTfbsClustered",
"wgEncodeRegTfbsClusteredV3.bed.gz"), temp)
data <- read.delim(gzfile(temp, "r"), header=FALSE)
unlink(temp)
colnames(data)[1:4] <- c("seqnames", "start", "end", "TF")
wgEncodeRegTfbsClusteredV3 <- GRanges(as.character(data$seqnames),
IRanges(data$start, data$end),
TF=data$TF)
data(HOT.spots)
hot <- reduce(unlist(HOT.spots))
ol <- findOverlaps(wgEncodeRegTfbsClusteredV3, hot)
wgEncodeTfbsV3 <- wgEncodeRegTfbsClusteredV3[-unique(queryHits(ol))]
wgEncodeTfbsV3 <- reduce(wgEncodeTfbsV3)
save(list="wgEncodeTfbsV3",
file="data/wgEncodeTfbsV3.rda",
compress="xz", compression_level=9)
http://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/ wgEncodeRegTfbsClustered/wgEncodeRegTfbsClusteredV3.bed.gz
data(wgEncodeTfbsV3) head(wgEncodeTfbsV3)data(wgEncodeTfbsV3) head(wgEncodeTfbsV3)
Write the sequences obtained from getAllPeakSequence to a file in fasta format leveraging writeFASTA in Biostrings package. FASTA is a simple file format for biological sequence data. A FASTA format file contains one or more sequences and there is a header line which begins with a > proceeding each sequence.
write2FASTA(mySeq, file = "", width = 80)write2FASTA(mySeq, file = "", width = 80)
mySeq |
GRanges with varibles name and sequence ,e.g., results obtained from getAllPeakSequence |
file |
Either a character string naming a file or a connection open for reading or writing. If "" (the default for write2FASTA), then the function writes to the standard output connection (the console) unless redirected by sink |
width |
The maximum number of letters per line of sequence |
Output as FASTA file format to the naming file or the console.
Lihua Julie Zhu
peaksWithSequences = GRanges(seqnames=c("1", "2"), IRanges(start=c(1000, 2000), end=c(1010, 2010), names=c("id1", "id2")), sequence= c("CCCCCCCCGGGGG", "TTTTTTTAAAAAA")) write2FASTA(peaksWithSequences, file="testseq.fasta", width=50)peaksWithSequences = GRanges(seqnames=c("1", "2"), IRanges(start=c(1000, 2000), end=c(1010, 2010), names=c("id1", "id2")), sequence= c("CCCCCCCCGGGGG", "TTTTTTTAAAAAA")) write2FASTA(peaksWithSequences, file="testseq.fasta", width=50)
Search by name for an Bimap object.
xget( x, envir, mode, ifnotfound = NA, inherits, output = c("all", "first", "last") )xget( x, envir, mode, ifnotfound = NA, inherits, output = c("all", "first", "last") )
x, envir, mode, ifnotfound, inherits
|
see mget |
output |
return the all or first item for each query |
a character vector
Jianhong Ou
library(org.Hs.eg.db) xget(as.character(1:10), org.Hs.egSYMBOL)library(org.Hs.eg.db) xget(as.character(1:10), org.Hs.egSYMBOL)