Most nucleic acids, regardless of their being DNA or RNA, contain modified nucleotides, which enhances the normal function of encoding genetic information. They have usually a regulatory function and/or modify folding behavior and molecular interactions.
RNA are nearly always post-transcriptionally modified. Most prominent examples are of course ribsomal RNA (rRNA) and transfer RNA (tRNA), but in recent years mRNA was also discovered to be post-transcriptionally modified. In addition, many small and long non-coding RNAs are also modified.
In many resources, like the tRNAdb (Jühling et al. 2009) or the modomics database (Boccaletto et al. 2018), modified nucleotides are repertoried. However in the Bioconductor context these information were not accessible, since they rely extensively on special characters in the RNA modification alphabet.
Therefore, the ModRNAString class was implemented
extending the BString class from the
Biostrings (H. Pagès, P. Aboyoun, R.
Gentleman, and S. DebRoy 2017) package. It can store RNA
sequences containing special characters of the RNA modification alphabet
and thus can store location and identity of modifications. Functions for
conversion to a tabular format are implemented as well.
The implemented classes inherit most of the functions from the
parental BString class and it derivatives, which allows
them to behave like the normal XString classes within the
Bioconductor context. Most of the functionality is directly inherited
and derived from the Biostrings package.
Since a DNA modification alphabet also exists, a
ModDNAString class was implemented as well. For details on
the available letters have a look at the RNA modification and [DNA
modification](ModDNAString-alphabet.html alphabet vignettes.
ModRNAString objectIn principle ModRNAString and ModDNAString
objects can be created as any other XString object. However
encoding issue will most certainly come into play, depending on the
modification, the operation system and probably the R version. This is
not a problem of how the data is internally used, but how the letter is
transfered from the console to R and back.
# This works
mr <- ModRNAString("ACGU7")
# This might work on Linux, but does not on Windows
ModRNAString("ACGU≈")## 5-letter ModRNAString object
## seq: ACGU≈
# This cause a misinterpretation on Windows. Omega gets added as O.
# This modifys the information from yW-72 (7-aminocarboxypropylwyosine) to
# m1I (1-methylinosine)
ModRNAString("ACGUΩ")## 5-letter ModRNAString object
## seq: ACGUΩ
To eliminate this issue the function modifyNucleotide()
is implemented, which can use short names or the nomenclature of a
modification to add it at the desired position.
## [1] "m1Am" "m1Gm" "m1Im" "m1acp3Y" "m1A" "m1G"
## [1] "01A" "01G" "019A" "1309U" "1A" "1G"
## 5-letter ModRNAString object
## seq: ACGU7
## 5-letter ModRNAString object
## seq: ACGU7
In addition, one can also use the alphabet() function
and subset to the desired modifications.
## 5-letter ModRNAString object
## seq: ACGUB
To offer a more streamlined functionality, which can take more
information as input, the function combineIntoModstrings()
is implemented. It takes a XString object and a
GRanges object with a mod column and returns a
ModString object. The information in the mod
column must match the short name or nomenclature of the particular
modification of interest as returned by the shortName() or
nomenclature() functions as seen above.
## 5-letter ModRNAString object
## seq: ACGU7
combineIntoModstrings() is also implemented for
ModStringSet objects.
rs <- RNAStringSet(list(r,r,r,r,r))
names(rs) <- paste0("Sequence", seq_along(rs))
gr2 <- GRanges(seqnames = names(rs)[c(1L,1L,2L,3L,3L,4L,5L,5L)],
ranges = IRanges(start = c(4L,5L,5L,4L,5L,5L,4L,5L),
width = 1L),
mod = c("D","m7G","m7G","D","m7G","m7G","D","m7G"))
gr2## GRanges object with 8 ranges and 1 metadata column:
## seqnames ranges strand | mod
## <Rle> <IRanges> <Rle> | <character>
## [1] Sequence1 4 * | D
## [2] Sequence1 5 * | m7G
## [3] Sequence2 5 * | m7G
## [4] Sequence3 4 * | D
## [5] Sequence3 5 * | m7G
## [6] Sequence4 5 * | m7G
## [7] Sequence5 4 * | D
## [8] Sequence5 5 * | m7G
## -------
## seqinfo: 5 sequences from an unspecified genome; no seqlengths
## A ModRNAStringSet instance of length 5
## width seq names
## [1] 5 ACGD7 Sequence1
## [2] 5 ACGU7 Sequence2
## [3] 5 ACGD7 Sequence3
## [4] 5 ACGU7 Sequence4
## [5] 5 ACGD7 Sequence5
The reverse operation is also available via the function
separate(), which allows the positions of modifications to
be transfered into a tabular format.
## GRanges object with 8 ranges and 1 metadata column:
## seqnames ranges strand | mod
## <Rle> <IRanges> <Rle> | <character>
## [1] Sequence1 4 + | D
## [2] Sequence1 5 + | m7G
## [3] Sequence2 5 + | m7G
## [4] Sequence3 4 + | D
## [5] Sequence3 5 + | m7G
## [6] Sequence4 5 + | m7G
## [7] Sequence5 4 + | D
## [8] Sequence5 5 + | m7G
## -------
## seqinfo: 5 sequences from an unspecified genome; no seqlengths
## RNAStringSet object of length 5:
## width seq names
## [1] 5 ACGUG Sequence1
## [2] 5 ACGUG Sequence2
## [3] 5 ACGUG Sequence3
## [4] 5 ACGUG Sequence4
## [5] 5 ACGUG Sequence5
modifyNucleotides() and therefore also
combineIntoModstrings() requires, that the nucleotides to
be modified match the originating base for the modification. The next
chunk fails, since the originating base for m7G is of course G.
## Error:
## ! Modification type does not match the originating base:
## U != G for m7G
Calls for both functions check the sanity for this operation, so that
the next bit is always TRUE.
## [1] TRUE
ModString objectsModString objects can be directly compared to
RNAString or DNAString objects depending on
the type (ModRNA to RNA and
ModDNA to DNA).
## [1] TRUE
## [1] FALSE
## [1] TRUE TRUE TRUE TRUE TRUE
## [1] FALSE FALSE FALSE TRUE TRUE
ModString objectsModString objects can be converted into each other.
However any conversion will remove any information on modifications and
revert each nucleotide back to its originating nucleotide.
## 5-letter RNAString object
## seq: ACGUG
ModStringQuality information can be encoded alongside ModString
objects by combining it with a XStringQuality object inside
a QualityScaledModStringSet object. Two class are
implemented: QualityScaledModRNAStringSet and
QualityScaledModDNAStringSet. They are usable as expected
from a QualityScaledXStringSet object.
qmrs <- QualityScaledModRNAStringSet(mrs,
PhredQuality(c("!!!!h","!!!!h","!!!!h",
"!!!!h","!!!!h")))
qmrs## A QualityScaledModRNAStringSet instance containing:
##
## A ModRNAStringSet instance of length 5
## width seq names
## [1] 5 ACGD7 Sequence1
## [2] 5 ACGU7 Sequence2
## [3] 5 ACGD7 Sequence3
## [4] 5 ACGU7 Sequence4
## [5] 5 ACGD7 Sequence5
##
## PhredQuality object of length 5:
## width seq
## [1] 5 !!!!h
## [2] 5 !!!!h
## [3] 5 !!!!h
## [4] 5 !!!!h
## [5] 5 !!!!h
They can also be constructed/deconstructed using the functions
combineIntoModstrings() and separate() and use
an additional metadata column named quality. For quality
information to persist during construction, set the argument
with.qualities = TRUE. If a
QualityScaledModStringSet is used as an input to separate,
the quality information are returned in the quality column.
We choose to avoid clashes with the score column and not to
recycle it.
## GRanges object with 8 ranges and 2 metadata columns:
## seqnames ranges strand | mod quality
## <Rle> <IRanges> <Rle> | <character> <integer>
## [1] Sequence1 4 + | D 71
## [2] Sequence1 5 + | m7G 0
## [3] Sequence2 5 + | m7G 71
## [4] Sequence3 4 + | D 0
## [5] Sequence3 5 + | m7G 71
## [6] Sequence4 5 + | m7G 0
## [7] Sequence5 4 + | D 71
## [8] Sequence5 5 + | m7G 71
## -------
## seqinfo: 5 sequences from an unspecified genome; no seqlengths
## A QualityScaledModRNAStringSet instance containing:
##
## A ModRNAStringSet instance of length 5
## width seq names
## [1] 5 ACGD7 Sequence1
## [2] 5 ACGU7 Sequence2
## [3] 5 ACGD7 Sequence3
## [4] 5 ACGU7 Sequence4
## [5] 5 ACGD7 Sequence5
##
## PhredQuality object of length 5:
## width seq
## [1] 5 !!!h!
## [2] 5 !!!!h
## [3] 5 !!!!h
## [4] 5 !!!!!
## [5] 5 !!!hh
ModString objects to/from fileThe nucleotide sequences with modifications can be saved to a
fasta or fastq file using the functions
writeModStringSet(). Reading of these files is achieved
using readModRNAStringSet() or
readModDNAStringSet(). In case of fastq files,
the sequences can be automatically read as a
QualityScaledModRNAStringSet using
readQualityScaledModRNAStringSet() function.
writeModStringSet(mrs, file = "test.fasta")
# note the different function name. Otherwise empty qualities will be written
writeQualityScaledModStringSet(qmrs, file = "test.fastq")
mrs2 <- readModRNAStringSet("test.fasta", format = "fasta")
mrs2## A ModRNAStringSet instance of length 5
## width seq names
## [1] 5 ACGD7 Sequence1
## [2] 5 ACGU7 Sequence2
## [3] 5 ACGD7 Sequence3
## [4] 5 ACGU7 Sequence4
## [5] 5 ACGD7 Sequence5
## A QualityScaledModRNAStringSet instance containing:
##
## A ModRNAStringSet instance of length 5
## width seq names
## [1] 5 ACGD7 Sequence1
## [2] 5 ACGU7 Sequence2
## [3] 5 ACGD7 Sequence3
## [4] 5 ACGU7 Sequence4
## [5] 5 ACGD7 Sequence5
##
## PhredQuality object of length 5:
## width seq
## [1] 5 !!!!h
## [2] 5 !!!!h
## [3] 5 !!!!h
## [4] 5 !!!!h
## [5] 5 !!!!h
Since these functions are specifically designed to work with the
modified nucleotides within the sequence, they are slower than the
analogous functions from the Biostrings package. This is
the result of a purely R based implementation, whereas
Biostrings functions are spead up through a C backend. This
is a potential improvement for future developments, but currently
special sequence files are limited, so it is not a priority.
Pattern matching is implemented as well as expected for
XString objects.
## Views on a 5-letter ModRNAString subject
## subject: ACGU7
## views:
## start end width
## [1] 4 5 2 [U7]
## MIndex object of length 5
## $Sequence1
## IRanges object with 1 range and 0 metadata columns:
## start end width
## <integer> <integer> <integer>
## [1] 4 5 2
##
## $Sequence2
## IRanges object with 0 ranges and 0 metadata columns:
## start end width
## <integer> <integer> <integer>
##
## $Sequence3
## IRanges object with 1 range and 0 metadata columns:
## start end width
## <integer> <integer> <integer>
## [1] 4 5 2
##
## $Sequence4
## IRanges object with 0 ranges and 0 metadata columns:
## start end width
## <integer> <integer> <integer>
##
## $Sequence5
## IRanges object with 1 range and 0 metadata columns:
## start end width
## <integer> <integer> <integer>
## [1] 4 5 2
## Views on a 25-letter ModRNAString subject
## subject: ACGD7ACGU7ACGD7ACGU7ACGD7
## views:
## start end width
## [1] 5 23 19 [7ACGU7ACGD7ACGU7ACG]
In principle post-translational modifications of proteins could also be implemented. However, a one letter alphabet of post-translational modifications must be developed first. If you are already aware of such an alphabet and want to use it in a Bioconductor context, let us know.
This is a quick example showing how sequence information containing
modified nucleotides can be imported into an R session using the
Modstrings package. The file needs to be UTF-8 encoded.
# read the lines
test <- readLines(system.file("extdata","test.fasta",package = "Modstrings"),
encoding = "UTF-8")
head(test,2L)## [1] "> tRNA | Ala | AGC | Saccharomyces cerevisiae | cytosolic"
## [2] "-GGGCGUGUKGCGUAGDC-GGD--AGCGCRCUCCCUUIGCOPGGGAGAG-------------------GDCUCCGGTPCGAUUCCGGACUCGUCCACCA"
# keep every second line as sequence, the other one as name
names <- test[seq.int(from = 1L, to = 104L, by = 2L)]
seq <- test[seq.int(from = 2L, to = 104L, by = 2L)]
# sanitize input. This needs to be adapt to the individual case
names <- gsub(" ","_",
gsub("> ","",
gsub(" \\| ","-",
names)))
seq <- gsub("-","",gsub("_","",seq))
names(seq) <- names# sanitize special characters to Modstrings equivalent
seq <- sanitizeFromModomics(seq)
seq <- ModRNAStringSet(seq)
seq## A ModRNAStringSet instance of length 52
## width seq names
## [1] 76 GGGCGUGUKGCGUAGDCGGDAGC...PCGAUUCCGGACUCGUCCACCA tRNA-Ala-AGC-Saccha...
## [2] 75 GCUCGCGUKLCGUAADGGCAACG...PCG"CCCCCAUCGUGAGUGCCA tRNA-Arg-UCU-Saccha...
## [3] 76 PUCCUCGUKLCCCAADGGDCACG...PCA"GUCCUGGCGGGGAAGCCA tRNA-Arg-ICG-Saccha...
## [4] 77 GACUCCAUGLCCAAGDDGGDDAA...PCA"CCCUCACUGGGGUCGCCA tRNA-Asn-GUU-Saccha...
## [5] 75 UCCGUGAUAGUUPAADGGDCAGA...PCAAUUCCCCGUCGCGGAGCCA tRNA-Asp-GUC-Saccha...
## ... ... ...
## [48] 76 GCUCUCUUAGCUUAADGGDUAAA...PCAAAUCAUGGAGAGAGUACCA tRNA-Arg-NCU-Saccha...
## [49] 90 GGAUGGUUGACUGAGDGGDUUAA...PCAAAUCCUACAUCAUCCGCCA tRNA-Ser-UGA-Saccha...
## [50] 90 GGAUGGUUGACUGAGDGGDUUAA...PCAAAUCCUACAUCAUCCGCCA tRNA-Ser-UGA-Saccha...
## [51] 73 GUAAAUAUAAUUUAADGGDAAAA...PCAAAUCUUAGUAUUUACACCA tRNA-Thr-UAG-Saccha...
## [52] 74 AAGGAUAUAGUUUAADGGDAAAA...PCGAAUCUCUUUAUCCUUGCCA tRNA-Trp-!CA-Saccha...
## GRanges object with 567 ranges and 1 metadata column:
## seqnames ranges strand | mod
## <Rle> <IRanges> <Rle> | <character>
## [1] tRNA-Ala-AGC-Sacchar.. 9 + | m1G
## [2] tRNA-Ala-AGC-Sacchar.. 16 + | D
## [3] tRNA-Ala-AGC-Sacchar.. 20 + | D
## [4] tRNA-Ala-AGC-Sacchar.. 26 + | m2,2G
## [5] tRNA-Ala-AGC-Sacchar.. 34 + | I
## ... ... ... ... . ...
## [563] tRNA-Trp-!CA-Sacchar.. 33 + | cmnm5U
## [564] tRNA-Trp-!CA-Sacchar.. 36 + | xA
## [565] tRNA-Trp-!CA-Sacchar.. 38 + | Y
## [566] tRNA-Trp-!CA-Sacchar.. 52 + | m5U
## [567] tRNA-Trp-!CA-Sacchar.. 53 + | Y
## -------
## seqinfo: 47 sequences from an unspecified genome; no seqlengths
## R version 4.6.1 (2026-06-24)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 26.04 LTS
##
## Matrix products: default
## BLAS: /usr/lib/x86_64-linux-gnu/openblas-pthread/libblas.so.3
## LAPACK: /usr/lib/x86_64-linux-gnu/openblas-pthread/libopenblasp-r0.3.32.so; LAPACK version 3.12.0
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=C
## [9] LC_ADDRESS=C LC_TELEPHONE=C
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
##
## time zone: Etc/UTC
## tzcode source: system (glibc)
##
## attached base packages:
## [1] stats4 stats graphics grDevices utils datasets methods
## [8] base
##
## other attached packages:
## [1] GenomicRanges_1.64.0 Modstrings_1.28.0 Biostrings_2.80.1
## [4] Seqinfo_1.2.0 XVector_0.52.0 IRanges_2.46.0
## [7] S4Vectors_0.50.1 BiocGenerics_0.58.1 generics_0.1.4
## [10] BiocStyle_2.40.0
##
## loaded via a namespace (and not attached):
## [1] vctrs_0.7.3 crayon_1.5.3 cli_3.6.6
## [4] knitr_1.51 rlang_1.2.0 xfun_0.59
## [7] stringi_1.8.7 otel_0.2.0 jsonlite_2.0.0
## [10] glue_1.8.1 buildtools_1.0.0 htmltools_0.5.9
## [13] maketools_1.3.2 sys_3.4.3 sass_0.4.10
## [16] rmarkdown_2.31 evaluate_1.0.5 jquerylib_0.1.4
## [19] fastmap_1.2.0 yaml_2.3.12 lifecycle_1.0.5
## [22] stringr_1.6.0 BiocManager_1.30.27 compiler_4.6.1
## [25] digest_0.6.39 R6_2.6.1 magrittr_2.0.5
## [28] bslib_0.11.0 tools_4.6.1 cachem_1.1.0