| Title: | A package for importing and analyzing data from Roche's Genome Sequencer System |
|---|---|
| Description: | The R453Plus1 Toolbox comprises useful functions for the analysis of data generated by Roche's 454 sequencing platform. It adds functions for quality assurance as well as for annotation and visualization of detected variants, complementing the software tools shipped by Roche with their product. Further, a pipeline for the detection of structural variants is provided. |
| Authors: | Hans-Ulrich Klein, Christoph Bartenhagen, Christian Ruckert |
| Maintainer: | Hans-Ulrich Klein <[email protected]> |
| License: | LGPL-3 |
| Version: | 1.62.0 |
| Built: | 2026-05-30 09:35:30 UTC |
| Source: | https://github.com/bioc/R453Plus1Toolbox |
This method aligns given sequences against a given reference
genome using the matchPDict method. Only exact (no errors) and unique
matches are returned.
alignShortReads(object, bsGenome, seqNames, ensemblNotation)alignShortReads(object, bsGenome, seqNames, ensemblNotation)
object |
The reads that should be aligned agiven either as a
|
bsGenome |
A |
seqNames |
The names of the sequences in |
ensemblNotation |
If set to TRUE, “chr” is removed from the reference sequences' names in the returned alignment. Default value is FALSE. |
All reads are aligned against the reference and its reverse
complement. If the reads are not in 5' to 3' orientation, they should
be reversed before. Note that only exact and unique alignments are
reported. Use matchPDict directly for more flexibility.
An object of class AlignedRead or a AVASet instance.
Hans-Ulrich Klein
matchPDict, DNAStringSet,
AlignedRead, AVASet
library("BSgenome.Scerevisiae.UCSC.sacCer2") reads = DNAStringSet(c( "CCGTTCAAAGAGCCCTTGGCCCATAATCCACCGGTT", "ATCCTGCCACAGGAGTCCATGGAGGTTTCGCCA")) alignShortReads(reads, Scerevisiae, seqNames="chrIII")library("BSgenome.Scerevisiae.UCSC.sacCer2") reads = DNAStringSet(c( "CCGTTCAAAGAGCCCTTGGCCCATAATCCACCGGTT", "ATCCTGCCACAGGAGTCCATGGAGGTTTCGCCA")) alignShortReads(reads, Scerevisiae, seqNames="chrIII")
A class for storing annotation about variants. An object of this class
is returned by the method annotateVariants. The class has not been designed
to be created by users directly.
The list encapsulated by this class has one element for each variant. Each
element is a nested list with the elements genes, transcripts, exons
and snps. All these elements are data frames listing genes, transcripts, exons or
snps respectively that were affected by the variant. Use the example below to explore
the data frames' contents.
Objects can be created by calls of the form new("AnnotatedVariants"). The
method annotateVariants returns AnnotatedVariants-objects.
annotatedVariants:Object of class "list" with one entry for
each variant.
signature(object = "AnnotatedVariants"): Get the
list with variants.
signature(object = "AnnotatedVariants", value = "list"):
Set a new list with variants.
signature(x = "AnnotatedVariants"): Get the
names of the with variants.
signature(x = "AnnotatedVariants", value = "character"):
Set the names of the variants.
Hans-Ulrich Klein
variants = data.frame( start=c(106157528, 106154991,106156184), end=c(106157528, 106154994,106156185), chromosome=c("4", "4", "4"), strand=c("+", "+", "+"), seqRef=c("A", "ATAG", "---"), seqMut=c("G", "----", "ATA"), seqSur=c("TACAGAA", "TTTATAGATA", "AGC---TCC"), stringsAsFactors=FALSE) rownames(variants) = c("snp", "del", "ins") ## Not run: av = annotateVariants(variants) ## Not run: annotatedVariants(av)[["snp"]]variants = data.frame( start=c(106157528, 106154991,106156184), end=c(106157528, 106154994,106156185), chromosome=c("4", "4", "4"), strand=c("+", "+", "+"), seqRef=c("A", "ATAG", "---"), seqMut=c("G", "----", "ATA"), seqSur=c("TACAGAA", "TTTATAGATA", "AGC---TCC"), stringsAsFactors=FALSE) rownames(variants) = c("snp", "del", "ins") ## Not run: av = annotateVariants(variants) ## Not run: annotatedVariants(av)[["snp"]]
This method annotates given genomic variants (mutations).
Annotation includes affected genes, exons and codons. Resulting amino acid
changes are returned as well as dbSNP identifiers, if the mutation is already
known. All information is fetched from the Ensembl GRCh37 server via biomaRt
using the datasets hsapiens_gene_ensembl and hsapiens_snp.
annotateVariants(object, bsGenome)annotateVariants(object, bsGenome)
object |
A data frame storing variants or an instance of AVASet/MapperSet or a data frame (see details). |
bsGenome |
An object of class |
If a data frame is given, the following columns must be present:
| start | genomic start position in the current Ensembl genome |
| end | genomic end position in the current Ensembl genome |
| chromosome | chromosome in ensembl notation (i.e. "1", "2", ..., "Y") |
| strand | "+" or "-" relative to the nucleotide bases given below |
| seqRef | reference sequence |
| seqMut | sequence of the observed variant |
| seqSur | reference sequence extended for 3 bases in both directions |
The rownames of the data frame are used as mutations' names (IDs). See examples for a properly defined data drame.
An object of class AnnotatedVariants. Affected genes, transcripts
and exon as well as known SNPs are stored in a list-like structure. See the
documentation of class AnnotatedVariants-class for details.
Hans-Ulrich Klein
AnnotatedVariants-class, AVASet-class,
MapperSet-class, htmlReport
variants = data.frame( start=c(106157528, 106154991,106156184), end=c(106157528, 106154994,106156185), chromosome=c("4", "4", "4"), strand=c("+", "+", "+"), seqRef=c("A", "ATAG", "---"), seqMut=c("G", "----", "ATA"), seqSur=c("TACAGAA", "TTTATAGATA", "AGC---TCC"), stringsAsFactors=FALSE) rownames(variants) = c("snp", "del", "ins") ## Not run: annotateVariants(variants)variants = data.frame( start=c(106157528, 106154991,106156184), end=c(106157528, 106154994,106156185), chromosome=c("4", "4", "4"), strand=c("+", "+", "+"), seqRef=c("A", "ATAG", "---"), seqMut=c("G", "----", "ATA"), seqSur=c("TACAGAA", "TTTATAGATA", "AGC---TCC"), stringsAsFactors=FALSE) rownames(variants) = c("snp", "del", "ins") ## Not run: annotateVariants(variants)
Similar to assayData of the Biobase ExpressionSet, this function returns the assay data of the amplicon slot of an instance of
the AVASet.
assayDataAmp(object)assayDataAmp(object)
object |
An |
The assay data of the amplicon slot consists of a list of two data frames with the number of forward and reverse reads of all amplicons for each
sample (see AVASet-class for details).
Christoph Bartenhagen
fDataAmp, featureDataAmp, AVASet-class
# load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) # show contents of amplicon assay data assayDataAmp(avaSetExample)# load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) # show contents of amplicon assay data assayDataAmp(avaSetExample)
Converts all variants in a given AVASet object into a VCF object and writes it to a file in VCF format if filename is given.
ava2vcf(object, filename, annot)ava2vcf(object, filename, annot)
object |
An object of class AVASet. |
filename |
The name of the VCF file to write in, if ommitted no file is written. |
annot |
An object of class |
An object of class VCF-class
Christian Ruckert
AnnotatedVariants-class, AVASet-class, VCF-class, writeVcf
data("avaSetFiltered") vcf <- ava2vcf(avaSetFiltered)data("avaSetFiltered") vcf <- ava2vcf(avaSetFiltered)
This function imports a project of Roche's Amplicon Variant Analyzer (AVA) Software. It stores all information into an extended version of the Biobase eSet.
AVASet(dirname, avaBin, file_sample, file_amp, file_reference, file_variant, file_variantHits)AVASet(dirname, avaBin, file_sample, file_amp, file_reference, file_variant, file_variantHits)
dirname |
The path of the AVA project. |
avaBin |
The directory containing the AVA-CLI binary doAmplicon (usually "bin" in the AVA installation directory) |
file_sample |
Sample information exported with the AVA-CLI. File has to be in CSV format. |
file_amp |
Amplicons exported with the AVA-CLI. File has to be in CSV format. |
file_reference |
Reference sequences exported with the AVA-CLI. File has to be in CSV format. |
file_variant |
Variant information exported with the AVA-CLI. File has to be in CSV format. |
file_variantHits |
Report of variant hits exported with the AVA-CLI. File has to be in CSV format. |
The five arguments for AVA command line interface (AVA-CLI) exports are optional and useful for exported projects, when no AVA software is installed.
For exporting, start the AVA-CLI with the command "doAmplicon" and use the commands "open", then "list sample", "list amplicon", "list reference",
"list variant" and "report variantHits". See AVASet-class for more details.
Giving only a project directory and the path to the AVA-CLI binary doAmplicon, AVASet will
import all information by accessing the AVA-CLI from within R.
An AVASet object consists of three slots to store data about
1. variants
Data frames that contain the number of reads with the respective variant in forward/reverse direction.
Data frames that contain the total coverage for every variant location in forward/reverse direction.
Gives the identifier of the reference sequence.
The bases changed in each variant.
The position of the variant on the reference sequence.
Short identifiers of a variant including the position and the bases changed.
2. amplicons
Data frames that contain the number of reads for every amplicon and each sample in forward/reverse direction.
The primer sequences for every amplicon.
The identifier of the reference sequence.
The coordinates of the target region.
3. reference sequences
alignShortReads, this slot knows about the chromosome, position and
the strand of each reference sequence.The structure of the variant and amplicon data is derived from the Biobase eSet and thus separated into assayData, phenoData and
featureData. All information about the reference sequences is stored into an object of class AlignedRead.
The phenoData of the variants lists the sample-IDs and name, annotation and group of the read data for all samples. If available, the pico titer plate(s) (PTP) or MID(s) of each sample are shown as well (using the AVA-CLI, PTPs and MIDs cannot be importet at the moment).
An instance of the AVASet class.
It is recommended to use the import via AVA-CLI access. Although deprecated, the import for projects created with older version of the AVA software (< v2.6) is still possible.
Christoph Bartenhagen
AVASet-class, MapperSet-class, alignShortReads
# Loading a project from AVA version < 2.6: # Load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) avaSetExample # Loading exported data, that was exported via AVA-CLI # Load an AVA dataset containing 6 samples, 4 amplicons and 222 variants # by specifying each file exported from the AVA-CLI projectDir = system.file("extdata", "AVASet_doAmplicon", package="R453Plus1Toolbox") avaSetExample = AVASet(dirname=projectDir, file_sample="sample.csv", file_amp="amp.csv", file_reference="reference.csv", file_variant="variant.csv", file_variantHits="variantHits.csv") avaSetExample # In case AVA software is installed: # Saying, for example, the AVA software was installed to the directory "/home/User/AVA", # the easiest way to import a project via AVA-CLI would look like: # avaSetExample = AVASet(dirname="myProjectDir", avaBin="/home/User/AVA/bin")# Loading a project from AVA version < 2.6: # Load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) avaSetExample # Loading exported data, that was exported via AVA-CLI # Load an AVA dataset containing 6 samples, 4 amplicons and 222 variants # by specifying each file exported from the AVA-CLI projectDir = system.file("extdata", "AVASet_doAmplicon", package="R453Plus1Toolbox") avaSetExample = AVASet(dirname=projectDir, file_sample="sample.csv", file_amp="amp.csv", file_reference="reference.csv", file_variant="variant.csv", file_variantHits="variantHits.csv") avaSetExample # In case AVA software is installed: # Saying, for example, the AVA software was installed to the directory "/home/User/AVA", # the easiest way to import a project via AVA-CLI would look like: # avaSetExample = AVASet(dirname="myProjectDir", avaBin="/home/User/AVA/bin")
Container to store data imported from a project of Roche's Amplicon Variant Analyzer Software. It stores all information into an extended version of the Biobase ExpressionSet.
Objects can be created by calls of the form AVASet(dirname, avaBin).
dirname is a character giving the proejct directory and avaBin is a
character giving the path to the AVA software installation (i.e. the
directory containing the doAmplicon binary). The constructor will
start the AVA software command line and import all necessary data.
If the AVA software is not installed on the same machine that runs
R, all data must be exported manually using the AVA Command
Line Interface (AVA-CLI). After having exported all text files, the constructor
AVASet(dirname, avaBin, file_sample, file_amp, file_reference, file_variant, file_variantHits)
can be used to import them. See the example below.
Finally, old project folders generated by AVA software < 2.6 can be
imported using AVASet(dirname). Where dirname is the path
to the project folder (i.e. a directory that contains the files
and subdirectories "Amplicons/ProjectDef/ampliconsProject.txt",
"Amplicons/Results/Variants/currentVariantDefs.txt",
"Amplicons/Results/Variants", "Amplicons/Results/Align").
assayData:Object of class AssayData. Contains the number of reads and the total read depth for every variant and each
sample in forward and reverse direction. Its column number equals nrow(phenoData).
featureData:Object of class AnnotatedDataFrame. Contains information about the type, position and reference of each
variant.
phenoData:Object of class AnnotatedDataFrame. Contains the sample-IDs and name, annotation and group of the read data
for all samples. If available, the lane, pico titer plate(s) (PTP) or MID(s) of each sample are shown as well.
assayDataAmp:Object of class AssayData. Contains the number of reads for every amplicon and each sample in forward/reverse
direction. Its column number equals nrow(featureDataAmp).
featureDataAmp:Object of class AnnotatedDataFrame. Contains the primer sequences, reference sequences and the coordinates
of the target regions for every amplicon.
referenceSequences:Object of class
AlignedRead. If additional alignment information were computed via
alignShortReads, this slot knows about the chromosome, position and the strand of each reference sequence.
variantFilterPerc:Object of class numeric. Contains a threshold to display only those variants, whose
coverage (in percent) in forward and reverse direction in at least one sample is higher than this filter value. See
setVariantFilter for details about setting this value.
variantFilter:Object of class character. Contains a vector of variant names whose
coverage (in percent) in forward and reverse direction in at least one sample is higher than the filter value in
variantFilterPerc.
dirs:Object of class character. Based on a directory given at instantiation of the object, it contains a vector of several
directories containing all relevant AVA-project files.
experimentData:Object of class MIAME. Contains details of the experiment.
annotation:Object of class character. Label associated with the annotation package used in the experiment.
protocolData:Object of class annotatedDataFrame. Contains additional information about the samples.
.__classVersion__:Object of class Versions. Remembers the R and R453Toolbox version numbers used to created the
AVASet instance.
Class eSet, directly.
Class VersionedBiobase, by class "eSet", distance 2.
Class Versioned, by class "eSet", distance 3.
Allows subsetting an AVASet object by features (i) and samples (j).
Similar to assayData of the Biobase ExpressionSet, this function
returns/replaces the amplicon assay data.
Similar to fData of the Biobase ExpressionSet, this function returns the amplicon feature data
as a data frame.
Similar to featureData of the Biobase ExpressionSet, this function
returns/replaces the amplicon feature data and feature meta.
Returns/replaces the reference sequence slot.
Retrieve the chromosomal positions of the amplicon sequences.
Sets the filter to display only those variants, whose coverage (in percent) in forward and reverse direction in at least one sample is higher than the given value.
Computes the coverage for every variant over all reads (forward and/or reverse) and for each sample.
Annotates given genomic variants. See annotateVariants for details.
Exports all (filtered) variant data into a html report. See htmlReport for details
Christoph Bartenhagen
MapperSet-class,
annotateVariants,
alignShortReads,
htmlReport,
setVariantFilter,
getVariantPercentages
# sum up class structure showClass("AVASet") # load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) avaSetExample # show contents of assay, feature and pheno data head(assayData(avaSetExample)$variantForwCount) head(assayData(avaSetExample)$totalForwCount) head(assayData(avaSetExample)$variantRevCount) head(assayData(avaSetExample)$totalRevCount) head(fData(avaSetExample)) pData(avaSetExample) assayDataAmp(avaSetExample) fDataAmp(avaSetExample) referenceSequences(avaSetExample) # Use these commands to export a project from within the AVA-CLI (doAmplicon): # > list sample -outputFile sample.csv # > list amplicon -outputFile amp.csv # > list reference -outputFile reference.csv # > list variant -outputFile variant.csv # > report variantHits -outputFile variantHits.csv # Load an AVA dataset containing 6 samples, 4 amplicons and 222 variants # by specifying five files, that were exported with the AVA-CLI: projectDir = system.file("extdata", "AVASet_doAmplicon", package="R453Plus1Toolbox") avaSetExample = AVASet(dirname=projectDir, file_sample="sample.csv", file_amp="amp.csv", file_reference="reference.csv", file_variant="variant.csv", file_variantHits="variantHits.csv")# sum up class structure showClass("AVASet") # load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) avaSetExample # show contents of assay, feature and pheno data head(assayData(avaSetExample)$variantForwCount) head(assayData(avaSetExample)$totalForwCount) head(assayData(avaSetExample)$variantRevCount) head(assayData(avaSetExample)$totalRevCount) head(fData(avaSetExample)) pData(avaSetExample) assayDataAmp(avaSetExample) fDataAmp(avaSetExample) referenceSequences(avaSetExample) # Use these commands to export a project from within the AVA-CLI (doAmplicon): # > list sample -outputFile sample.csv # > list amplicon -outputFile amp.csv # > list reference -outputFile reference.csv # > list variant -outputFile variant.csv # > report variantHits -outputFile variantHits.csv # Load an AVA dataset containing 6 samples, 4 amplicons and 222 variants # by specifying five files, that were exported with the AVA-CLI: projectDir = system.file("extdata", "AVASet_doAmplicon", package="R453Plus1Toolbox") avaSetExample = AVASet(dirname=projectDir, file_sample="sample.csv", file_amp="amp.csv", file_reference="reference.csv", file_variant="variant.csv", file_variantHits="variantHits.csv")
This is an example of an link{AVASet-class} object containing the output of Roche's Amplicon Variant Analyzer Software.
It consists of 6 samples, 4 amplicons and 259 variants.
data(avaSetExample)data(avaSetExample)
Formal class 'AVASet'
‘Next-generation sequencing technology reveals a characteristic pattern of molecular mutations in 72.8 leukemia by detecting frequent alterations in TET2, CBL, RAS, and RUNX1’ (Kohlmann A et al., J Clin Oncol. 2010 Aug 20;28(24):3858-65. Epub 2010 Jul 19)
data(avaSetExample) avaSetExampledata(avaSetExample) avaSetExample
This is an example of an link{AVASet-class} object containing the output of Roche's Amplicon Variant Analyzer Software.
It consists of 6 samples, 4 amplicons and 4 variants. The variants were previously filtered according to the amplicon coverage
(see setVariantFilter for details about filtering an AVASet object).
data(avaSetFiltered)data(avaSetFiltered)
Formal class 'AVASet'
‘Next-generation sequencing technology reveals a characteristic pattern of molecular mutations in 72.8 leukemia by detecting frequent alterations in TET2, CBL, RAS, and RUNX1’ (Kohlmann A et al., J Clin Oncol. 2010 Aug 20;28(24):3858-65. Epub 2010 Jul 19)
data(avaSetFiltered) avaSetFiltereddata(avaSetFiltered) avaSetFiltered
These are example annotations for 4 variants of an AVASet (try data(avaSetFiltered) to retrieve the corresponding link{AVASet-class} object).
The annotations include affected genes, exons and codons as well as resulting amino acid changes and dbSNP identifiers (if the mutation is already known).
data(avaSetFiltered_annot)data(avaSetFiltered_annot)
Formal class 'AnnotatedVariants'
‘Next-generation sequencing technology reveals a characteristic pattern of molecular mutations in 72.8% of chronic myelomonocytic leukemia by detecting frequent alterations in TET2, CBL, RAS, and RUNX1’ (Kohlmann A et al., J Clin Oncol. 2010 Aug 20;28(24):3858-65. Epub 2010 Jul 19)
data(avaSetFiltered_annot)data(avaSetFiltered_annot)
This function returns the absolute and the relative frequency of the four bases (A, C, G, T).
baseFrequency(object)baseFrequency(object)
object |
An object of class DNAStringSet, ShortRead or SFFContainer. |
This function makes use of the alphabetFrequency function from package
Biostrings.
A data.frame with two columns containing the absolute and relative frequencies respectively and six rows, one for each of the four bases (A, C, G, T), one for other symbols contained in the reads and one summarizing the five aforementioned rows.
Christian Ruckert
Create a histogram based on the quality of every single base from all sequences.
baseQualityHist(object, xlab="Quality score", ylab="Number of bases", col="firebrick1", breaks=40, ...)baseQualityHist(object, xlab="Quality score", ylab="Number of bases", col="firebrick1", breaks=40, ...)
object |
An object of class QualityScaledDNAStringSet, ShortReadQ or SFFContainer. |
xlab |
The X axis label. |
ylab |
The Y axis label. |
col |
The plotting color. |
breaks |
The number of breaks in the histogram (see ‘hist’). |
... |
Arguments to be passed to methods, such as graphical parameters (see ‘par’). |
Christian Ruckert
This function returns mean, minimum, maximum and standard deviation of the base quality scores over all sequences.
baseQualityStats(object)baseQualityStats(object)
object |
An object of class QualityScaledDNAStringSet, ShortReadQ or SFFContainer. |
A numeric vector with four slots: mean, min, max, sd.
Christian Ruckert
This example holds two consensus (pathogenic and reciproce) breakpoints of 12 chimeric reads indicating an inversion on chromosome 16. The Breakpoints object gives access to the breakpoint locations as well as alignment information for each of the 12 reads.
data(breakpoints)data(breakpoints)
Formal class 'Breakpoints'
‘Targeted next-generation sequencing detects point mutations, insertions, deletions, and balanced chromosomal rearrangements as well as identifies novel leukemia-specific fusion genes in a single procedure’ (Leukemia, submitted)
data(breakpoints)data(breakpoints)
Container to store chimeric reads that were clustered to putative breakpoints indicating structural variants. Related information like breakpoint position or alignment information about the chimeric reads is stored as well.
Objects can be created by calls of the form new("Breakpoints", ...).
Usually, objects will be created by calling the
detectBreakpoints method. It is not intended that users
create objects of this class manually.
All slots of this class can be found twice. One slot name ends with
“C1” and the other “C2”. The slots labeled with
“C2” are empty until mergeBreakpoints has been
called and contain information about putativly associated breakpoints
detected by mergeBreakpoints.
seqsC1:Object of class "list" with one data
frame for each breakpoint. The data frame stores all chimeric reads
covering the first breakpoint together with the alignment
information.
seqsC2:Object of class "list" with one data
frame for each breakpoint. The data frame stores all chimeric reads
covering the second breakpoint together with the alignment
information.
commonBpsC1:Object of class "list" with one
data frame for each breakpoint. The data frame stores the
consensus breakpoint sequence as well as the breakpoint
coordinates of the first breakpoint.
commonBpsC2:Object of class "list" with one
data frame for each breakpoint. The data frame stores the
consensus breakpoint sequence as well as the breakpoint
coordinates of the second breakpoint.
commonAlignC1:Object of class "list" with one
object of class PairwiseAlignmentsSingleSubject-class
for each breakpoint storing the alignments of the chimeric
reads against the consensus breakpoint sequence for the
first breakpoint.
commonAlignC2:Object of class "list" with one
object of class PairwiseAlignmentsSingleSubject-class
for each breakpoint storing the alignments of the chimeric
reads against the consensus breakpoint sequence for the
second breakpoint.
alignedReadsC1:Object of class "list" with one
object of class AlignedRead-class storing all
chimeric reads covering the first breakpoint and their alignments.
alignedReadsC2:Object of class "list" with one
object of class AlignedRead-class storing all
chimeric reads covering the second breakpoint and their alignments.
signature(object = "Breakpoints",
value = "list"):
Setter-method for the alignedReadsC1 slot.
signature(object = "Breakpoints"):
Getter-method for the alignedReadsC1 slot.
signature(object = "Breakpoints",
value = "list"):
Setter-method for the alignedReadsC2 slot.
signature(object = "Breakpoints"):
Getter-method for the alignedReadsC2 slot.
signature(object = "Breakpoints",
value = "list"):
Setter-method for the commonAlignC1 slot.
signature(object = "Breakpoints"):
Getter-method for the commonAlignC1 slot.
signature(object = "Breakpoints",
value = "list"):
Setter-method for the commonAlignC2 slot.
signature(object = "Breakpoints"):
Getter-method for the commonAlignC2 slot.
signature(object = "Breakpoints",
value = "list"):
Setter-method for the commonBpsC1 slot.
signature(object = "Breakpoints"):
Getter-method for the commonBpsC1 slot.
signature(object = "Breakpoints",
value = "list"):
Setter-method for the commonBpsC2 slot.
signature(object = "Breakpoints"):
Getter-method for the commonBpsC2 slot.
signature(object = "Breakpoints",
value = "list"):
Setter-method for the seqsC1 slot.
signature(object = "Breakpoints"):
Getter-method for the seqsC1 slot.
signature(object = "Breakpoints",
value = "list"):
Setter-method for the seqsC2 slot.
signature(object = "Breakpoints"):
Getter-method for the seqsC2 slot.
signature(x = "Breakpoints", i = "ANY", j = "ANY"):
Subsetting a Breakpoints object.
signature(x = "Breakpoints"):
Returns the number of breakpoints stored.
signature(breakpoints = "Breakpoints",
maxDist = "missing", mergeBPs = "list"):
Merge presumably related breakpoints.
signature(breakpoints = "Breakpoints",
maxDist = "missing", mergeBPs = "missing"):
Merge presumably related breakpoints.
signature(breakpoints = "Breakpoints",
maxDist = "numeric", mergeBPs = "missing"):
Merge presumably related breakpoints.
signature(x = "Breakpoints", value = "ANY"):
Set the names of the breakpoints.
signature(x = "Breakpoints"):
Get the names of the breakpoints.
signature(brpData = "Breakpoints"):
Plot the structural variant and the chimeric reads covering its
breakpoints.
signature(object = "Breakpoints"):
Create a data frame summaring information about all breakpoints.
signature(... = "Breakpoints"):
Create a frequency table of cluster sizes.
Hans-Ulrich Klein, Christoph Bartenhagen
filterChimericReads, detectBreakpoints,
mergeBreakpoints, plotChimericReads
When many point mutations are detected, the ration of transitions to transversions can be used as quality measure to assess the number of false positives.
## S4 method for signature 'AVASet' calculateTiTv(object) ## S4 method for signature 'MapperSet' calculateTiTv(object)## S4 method for signature 'AVASet' calculateTiTv(object) ## S4 method for signature 'MapperSet' calculateTiTv(object)
object |
An instance of AVASet or MapperSet storing the detected variants. |
For more information about the Ti/Tv ratio see http://www.broadinstitute.org/gsa/wiki/index.php/QC_Methods
A list with two elements: A substitution matrix summarizing all
observed substitutions and the transition/transversion ratio.
Hans-Ulrich Klein
data(avaSetExample) ava = setVariantFilter(avaSetExample, c(0.03, 0.03)) calculateTiTv(ava)data(avaSetExample) ava = setVariantFilter(avaSetExample, c(0.03, 0.03)) calculateTiTv(ava)
Design of a custom Roche NimbleGen 385k capture array. The array captures short segments corresponding to all exon regions of 92 distinct target genes (genome build hg19). In addition, contiguous genomic regions were represented for three additional genes, i.e. CBFB, MLL, and RUNX1.
data(captureArray)data(captureArray)
Formal class 'CompressedIRangesList'
‘Targeted next-generation sequencing detects point mutations, insertions, deletions, and balanced chromosomal rearrangements as well as identifies novel leukemia-specific fusion genes in a single procedure’ (Leukemia, submitted)
data(captureArray)data(captureArray)
This function evaluates the sequence complexity using the DUST algorithm.
complexity.dust(object, xlab="Complexity score (0=high, 100=low)", ylab="Number of sequences", xlim=c(0, 100), col="firebrick1", breaks=100, ...)complexity.dust(object, xlab="Complexity score (0=high, 100=low)", ylab="Number of sequences", xlim=c(0, 100), col="firebrick1", breaks=100, ...)
object |
An object of class DNAStringSet, ShortRead or SFFContainer. |
xlab |
The X axis label. |
ylab |
The Y axis label. |
xlim |
The limits of the X axis. |
col |
The plotting color. |
breaks |
The number of breaks in the histogram (see ‘hist’). |
... |
Arguments to be passed to methods, such as graphical parameters (see ‘par’). |
The complexity score is based on how often different trinucleotides occur and is scaled between 0 and 100. A sequence of homopolymer repeats (e.g. TTTTTTTTTT) has a score of 100, of dinucleotide repeats (e.g. TATATATATA) has a score around 49, and of trinucleotide repeats (e.g. TAGTAGTAG) has a score around 32. Scores above seven can be considered low-complexity.
A numeric vector containing the complexity score for each sequence.
Christian Ruckert
Schmieder R. (2011) Quality control and preprocessing of metagenomic datasets. Bioinformatics, 2011 Mar 15;27(6):863-4.
This function evaluates the sequence complexity using the Shannon-Wiener Algorithm.
complexity.entropy(object, xlab="Complexity score (0=low, 100=high)", ylab="Number of sequences", xlim=c(0, 100), col="firebrick1", breaks=100, ...)complexity.entropy(object, xlab="Complexity score (0=low, 100=high)", ylab="Number of sequences", xlim=c(0, 100), col="firebrick1", breaks=100, ...)
object |
An object of class DNAStringSet, ShortRead or SFFContainer. |
xlab |
The X axis label. |
ylab |
The Y axis label. |
xlim |
The limits of the X axis. |
col |
The plotting color. |
breaks |
The number of breaks in the histogram (see ‘hist’). |
... |
Arguments to be passed to methods, such as graphical parameters (see ‘par’). |
The entropy approach evaluates the entropy of trinucleotides in a sequence. The entropy values are scaled from 0 to 100 and lower entropy values imply lower complexity. A sequence of homopolymer repeats (e.g. TTTTTTTTTT) has an entropy value of 0, of dinucleotide repeats (e.g. TATATATATA) has an entropy value around 16, and of trinucleotide repeats (e.g. TAGTAGTAG) has an entropy value around 26. Scores below 70 can be considered low-complexity.
A numeric vector containing the complexity score for each sequence.
Christian Ruckert
Schmieder R. (2011) Quality control and preprocessing of metagenomic datasets. Bioinformatics, 2011 Mar 15;27(6):863-4.
These are temporary methods, that are likely to be replaced by methods from the Rsamtools package in near future.
extendedCIGARToList(cigars) listToExtendedCIGAR(cigarList)extendedCIGARToList(cigars) listToExtendedCIGAR(cigarList)
cigars |
A character vector with CIGAR strings. |
cigarList |
A list of converted CIGAR strings as produced by |
This method computes the approximate coverage of each base in a given region.
coverageOnTarget(alnReads, targetRegion)coverageOnTarget(alnReads, targetRegion)
alnReads |
A list as returned by |
targetRegion |
The target region as a |
The detailed alignment information given by the CIGAR strings in .bam files are ignored by the function. Instead, it is assumed that the whole read alignes to the reference without indels. This is often not true for longer read (e.g. generated with Roche 454 Sequencing), but saves computation time.
A list of the same length as the alnReads argument. Each list
element is an integer vector of the same length as the target region (in
bases) and stores the coverage generated by the reads from the
corresponding list element of alnReads.
Hans-Ulrich Klein
library(Rsamtools) bamFile = system.file("extdata", "SVDetection", "bam", "N01.bam", package="R453Plus1Toolbox") bam = scanBam(bamFile) region = GRanges(IRanges(start=118307205, end=118395936), seqnames=11) cov = coverageOnTarget(bam, region)library(Rsamtools) bamFile = system.file("extdata", "SVDetection", "bam", "N01.bam", package="R453Plus1Toolbox") bam = scanBam(bamFile) region = GRanges(IRanges(start=118307205, end=118395936), seqnames=11) cov = coverageOnTarget(bam, region)
Roche's Genome Sequencer allows to load two or more samples on one region. To allocate sequences to samples, each sample has a unique multiplex sequence. The multiplex sequence should be the prefix of all sequences from that sample. This method demultiplexes a given set of sequences according to the given multiplex sequences (MIDs).
## S4 method for signature 'XStringSet,XStringSet,numeric,logical' demultiplexReads(reads, mids, numMismatches, trim)## S4 method for signature 'XStringSet,XStringSet,numeric,logical' demultiplexReads(reads, mids, numMismatches, trim)
reads |
A |
mids |
A |
numMismatches |
The maximal number of mismatches allowed, default 2. |
trim |
Whether the MIDs should be cutted-out, default TRUE |
All given MIDs must have the same length. The algorithm
computes the number of mismachtes for each MID. The read is assigned
to the MID with the lowest number of mismatches. If two or more MIDs
have the same number of mismachtes, or if the number of mismachtes is
greater than the given argument numMismachtes, the read is not
assigned to any MID. The default number of allowed mismatches is 2.
demultiplexReads returns a list with one DNAStringSet
instance for each MID.
Hans-Ulrich Klein
genomeSequencerMIDs, DNAStringSet
library(Biostrings) mids = genomeSequencerMIDs(c("MID1", "MID2", "MID3")) reads = DNAStringSet(c( paste(as.character(mids[["MID1"]]), "A", sep=""), paste(as.character(mids[["MID1"]]), "AA", sep=""), paste(as.character(mids[["MID2"]]), "AAA", sep=""))) demultiplexReads(reads, mids)library(Biostrings) mids = genomeSequencerMIDs(c("MID1", "MID2", "MID3")) reads = DNAStringSet(c( paste(as.character(mids[["MID1"]]), "A", sep=""), paste(as.character(mids[["MID1"]]), "AA", sep=""), paste(as.character(mids[["MID2"]]), "AAA", sep=""))) demultiplexReads(reads, mids)
Given a set of chimeric reads, this methods computes all putative breakpoints. First, chimeric reads are clustered such that all reads spanning the same breakpoint form a cluster. Then, a consensus breakpoint sequence and breakpoint position is computed for each cluster.
detectBreakpoints(chimericReads, bpDist=100, minClusterSize=4, removeSoftClips=TRUE, bsGenome)detectBreakpoints(chimericReads, bpDist=100, minClusterSize=4, removeSoftClips=TRUE, bsGenome)
chimericReads |
A list storing chimeric reads as returned by
|
bpDist |
The maximum distance in base pairs between the breakpoints of two chimeric reads at which the reads are merge to a cluster. |
minClusterSize |
Cluster whose size is below minClusterSize are be excluded from breakpoint detection. |
removeSoftClips |
If true, soft-clipped bases at the beginning or the end of a sequence are removed (see details below). |
bsGenome |
A |
This method is usually invoked after calling
filterChimericReads and before calling
mergeBreakpoints. It first forms clusters of chimeric
reads (reads with exactly two local alignments) that span the same
breakpoint and than computes a consensus breakpoint sequence for each
cluster.
To carry out a hierarchical clustering, a measure for the distance
between two chimeric reads must be defined. If reads span different
chromosomes, their distance is set to infinity. The strand
information of the local alignments may also indicate that two chimeric
reads do not span the same breakpoint even if they span the same
chromosomes. For example, the first reads has two local alignments on
the positive strand whereas the second read has one local alignment on
the positive strand and the other on the negative strand. In this case,
the distance is set to inifinty, too. Finally, the distance measure
distinguishes between the two breakpoints (sometimes
called the pathogenic and the reciproce breakpoint) that originate from
the same structual variant. The distance between a read from the
pathogenic and a read from the reciproce breakpoint is infinity so that
two different clusters will emerge. These two related breakpoints can be
merge later using the mergeBreakpoints method. We observed
that the breakpoints of these two cases often differ by a few ten or even
a few hundred basepairs.
If the chromosome and strand information between two reads and
are coherent, the Euclidian distance is used:
where gives the coordinates of the breakpoint for the given
read and chromosome. Hierarchical clustering is applied with complete
linkage and the dendrogram is cutted at a height of bpDist to
obtain the final clusters. The bpDist argument does usually not
influence the result, because we observed that reads spanning the same
breakpoint have very little variation (only a few base pairs) in their
local alignments due to sequencing errors or due to ambiguity caused by
same/similar sequence of both chromosome near the breakpoint.
Although the given set of reads may belong to the same chimeric DNA,
their individual breakpoints may differ in a few base pairs.
Furthermore, a single read may have more than one possible breakpoint
if a (small) part of the read was aligned to both parts.
The following step determines a consensus breakpoint for each cluster.
It uses the supplied bsGenome to construct a
chimeric reference sequence for all possible breakpoints over all reads within
each cluster. After the reads were realigned to the chimeric reference
sequences, the one that yields the highest alignment score is taken to
represent best the chimeric DNA and its breakpoints.
As a preprocessing step, detectBreakpoints offers to remove soft
clips occuring after the alignment:
Some reads may contain soft-clipped bases (e.g. linker sequences) at the beginning of the first part
of the read or at the end of the second part. By default,
detectBreakpoints removes these unaligned subsequences
and adjusts the cigar string, the sequence, the sequence width
(qwidth) and the local start/end coordinates.
detectBreakpoints returns an object of class
breakpoints, which is a list of breakpoint clusters, which gives
access to all alignments and consensus breakpoints:
seqs |
This |
commonBps |
A dataframe listing the breakpoints for both parts of the chimeric reference, the associated chromosome, strand and the reference sequence itself, including positions "localStart"/"localEnd" indicating which part of the reference belongs to which breakpoint. |
commonAlign |
An object of class
|
alignedReads |
On the basis of |
Hans-Ulrich Klein, Christoph Bartenhagen
filterChimericReads
mergeBreakpoints
plotChimericReads
# Construct a small example with three chimeric reads # (=6 local alignments) in bam format as given by # aligners such as BWA-SW. # The first two reads originate from the same case but # from different strands. The third read originate from # the reciprocal breakpoint. library("BSgenome.Scerevisiae.UCSC.sacCer2") bamReads = list() bamReads[[1]] = list( qname=c("seq1", "seq1", "seq2", "seq2", "seq3", "seq3"), flag = as.integer(c(0, 0, 16, 16, 0, 0)), rname = factor(c("II", "III", "III", "II", "III", "II")), strand = factor(c("+", "+", "-", "-", "+", "+")), pos = as.integer(c(99951, 200000, 200000, 99951, 199950, 100001)), qwidth = as.integer(c(100, 100, 100, 100, 100, 100)), cigar = c("50M50S","50S50M","50S50M","50M50S","50M50S", "50S50M"), seq = DNAStringSet(c( paste(substr(Scerevisiae$chrII, start=99951, stop=100000), substr(Scerevisiae$chrIII, start=200000, stop=200049), sep=""), paste(substr(Scerevisiae$chrII, start=99951, stop=100000), substr(Scerevisiae$chrIII, start=200000, stop=200049), sep=""), paste(substr(Scerevisiae$chrIII, start=200000, stop=200049), substr(Scerevisiae$chrII, start=99951, stop=100000), sep=""), paste(substr(Scerevisiae$chrIII, start=200000, stop=200049), substr(Scerevisiae$chrII, start=99951, stop=100000), sep=""), paste(substr(Scerevisiae$chrIII, start=199950, stop=199999), substr(Scerevisiae$chrII, start=100001, stop=100050), sep=""), paste(substr(Scerevisiae$chrIII, start=199950, stop=199999), substr(Scerevisiae$chrII, start=100001, stop=100050), sep=""))) ) bps = detectBreakpoints(bamReads, minClusterSize=1, bsGenome=Scerevisiae) summary(bps) table(bps) mergeBreakpoints(bps)# Construct a small example with three chimeric reads # (=6 local alignments) in bam format as given by # aligners such as BWA-SW. # The first two reads originate from the same case but # from different strands. The third read originate from # the reciprocal breakpoint. library("BSgenome.Scerevisiae.UCSC.sacCer2") bamReads = list() bamReads[[1]] = list( qname=c("seq1", "seq1", "seq2", "seq2", "seq3", "seq3"), flag = as.integer(c(0, 0, 16, 16, 0, 0)), rname = factor(c("II", "III", "III", "II", "III", "II")), strand = factor(c("+", "+", "-", "-", "+", "+")), pos = as.integer(c(99951, 200000, 200000, 99951, 199950, 100001)), qwidth = as.integer(c(100, 100, 100, 100, 100, 100)), cigar = c("50M50S","50S50M","50S50M","50M50S","50M50S", "50S50M"), seq = DNAStringSet(c( paste(substr(Scerevisiae$chrII, start=99951, stop=100000), substr(Scerevisiae$chrIII, start=200000, stop=200049), sep=""), paste(substr(Scerevisiae$chrII, start=99951, stop=100000), substr(Scerevisiae$chrIII, start=200000, stop=200049), sep=""), paste(substr(Scerevisiae$chrIII, start=200000, stop=200049), substr(Scerevisiae$chrII, start=99951, stop=100000), sep=""), paste(substr(Scerevisiae$chrIII, start=200000, stop=200049), substr(Scerevisiae$chrII, start=99951, stop=100000), sep=""), paste(substr(Scerevisiae$chrIII, start=199950, stop=199999), substr(Scerevisiae$chrII, start=100001, stop=100050), sep=""), paste(substr(Scerevisiae$chrIII, start=199950, stop=199999), substr(Scerevisiae$chrII, start=100001, stop=100050), sep=""))) ) bps = detectBreakpoints(bamReads, minClusterSize=1, bsGenome=Scerevisiae) summary(bps) table(bps) mergeBreakpoints(bps)
This function calculates the dinucleotide odds ratio for each of the sixtheen possible dinucleotides.
dinucleotideOddsRatio(object, xlab="Under-/over-representation of dinucleotides", col="firebrick1", ...)dinucleotideOddsRatio(object, xlab="Under-/over-representation of dinucleotides", col="firebrick1", ...)
object |
An object of class DNAStringSet, ShortRead or SFFContainer. |
xlab |
The X axis label. |
col |
The plotting color. |
... |
Arguments to be passed to methods, such as graphical parameters (see ‘par’). |
The dinucleotide odds ratio assigns a value between 0 and 2 to each of the sixtheen possible dinucleotides (AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, GT, TA, TC, TG, TT). For values below 1 the dinucleotide is under-represented compared to the randomly expected frequency of this dinucleotide in a sequence of the given length and with the given frequencies of the four nucleotides (A, C, G, T). For values above 1 this dinucleotide is over-represented.
A matrix with sixtheen columns, one for each dinucleotide, containing the dinucleotide odds ratio values for each sequence in a seperate row.
Christian Ruckert
Schmieder R. (2011) Quality control and preprocessing of metagenomic datasets. Bioinformatics, 2011 Mar 15;27(6):863-4.
Similar to fData of the Biobase ExpressionSet, this function returns the feature data of the amplicon slot of an instance of the
AVASet.
fDataAmp(object)fDataAmp(object)
object |
An |
The feature data of the amplicon slot contains the names, primers, start/end positions and reference sequences of all
amplicons (seeAVASet-class for details). It returns a data frame.
Christoph Bartenhagen
featureDataAmp, assayDataAmp,AVASet-class
# load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) avaSetExample # show contents amplicon feature data fDataAmp(avaSetExample)# load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) avaSetExample # show contents amplicon feature data fDataAmp(avaSetExample)
Similar to featureData of the Biobase ExpressionSet, this function returns the feature data and feature meta of the amplicon slot of an
instance of the AVASet.
featureDataAmp(object)featureDataAmp(object)
object |
An |
The feature data of the amplicon slot contains the names, primers, start/end positions and reference sequences of all amplicons (see
AVASet-class for details). The returned object is of class AnnotatedDataFrame.
Christoph Bartenhagen
fDataAmp, assayDataAmp, AVASet-class,
# load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) avaSetExample # show contents amplicon feature data featureDataAmp(avaSetExample)# load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) avaSetExample # show contents amplicon feature data featureDataAmp(avaSetExample)
Chimeric reads may be caused by sequencing a chromosomal aberration or by technical issues during sample preparation. This method implements several filter steps to remove false chimeric reads.
## S4 method for signature 'list,IntegerRangesList,DNAString,numeric,numeric' filterChimericReads(alnReads, targetRegion, linkerSeq, minDist, dupReadDist)## S4 method for signature 'list,IntegerRangesList,DNAString,numeric,numeric' filterChimericReads(alnReads, targetRegion, linkerSeq, minDist, dupReadDist)
alnReads |
A list storing the aligned reads as produced by the function scanBam. |
targetRegion |
A object of class IRangesList containing the target region of e.g. a used capture array. The parameter may be omitted in case of a non targeted sequencing approach. |
linkerSeq |
A linker sequence that was used during sample preparation. It may be omitted. |
minDist |
The minimum distance between two local alignments (see details), default 1000 |
dupReadDist |
The maximum distance between the 5 prime start position of two duplicated reads (see details), default 1. |
The following filter steps are performed:
1. All chimeric reads with exactly two local alignments are extracted. Reads with more than two local alignments are discarded.
2. If the targetRegion argument is given, chimeric reads must have one local alignment at least overlapping the the target region. If both local alignments are outside the target region, the read is discarded.
3. If the linkerSeq argument is given, all chimeric reads that have the linker sequence between their local alignments are removed. When searching the linker sequence, 4 mismatches or indels are allowed and the linker sequence must not start or end within the first or last ten bases of the read. The function searches for the linkerSeq and for it's reverse complement.
4. Two local alignment of a read must have minDist reads between the alignments (if both alignment are on the same chromosome). Otherwise, the read seems to span a deletion and not a chromosomal aberration and is discarded.
5. Duplicated reads are removed. Two reads are duplicated, if the lie on the same strand and have the same 5 prime start position. Due to sequencing and alignment errors, the start position may vary for a maximum of dupReadDist bases. In case of duplicated reads, only the longest read is kept.
Reads passing all filtering steps are returned in the list
structure as given by the alnReads argument (as derived from
the scanBam method). A data frame with information about the
number of reads that passed each filter is added to the list.
A list containing only filtered chimeric reads. The list
has the same structure like the given argument
alnReads. Additionally, one element “log” with logging
information of each filtering step is added.
Hans-Ulrich Klein
detectBreakpoints,
mergeBreakpoints,
Breakpoints-class,
scanBam, sequenceCaptureLinkers
library(Rsamtools) bamFile = system.file("extdata", "SVDetection", "bam", "N01.bam", package="R453Plus1Toolbox") bam = scanBam(bamFile) data(captureArray) linker = sequenceCaptureLinkers("gSel3")[[1]] filterReads = filterChimericReads(bam, targetRegion=captureArray, linkerSeq=linker)library(Rsamtools) bamFile = system.file("extdata", "SVDetection", "bam", "N01.bam", package="R453Plus1Toolbox") bam = scanBam(bamFile) data(captureArray) linker = sequenceCaptureLinkers("gSel3")[[1]] filterReads = filterChimericReads(bam, targetRegion=captureArray, linkerSeq=linker)
This function creates a barplot of the flow intensities with one bar for each nucleotide in the flow. With the height giving the measured intensity.
flowgramBarplot(x, range=c(0, length(flowgram(x))), xlab="Flow sequence", ylab="Flow intensity", col=c(A="black", C="red", G="blue", T="green"), ...)flowgramBarplot(x, range=c(0, length(flowgram(x))), xlab="Flow sequence", ylab="Flow intensity", col=c(A="black", C="red", G="blue", T="green"), ...)
x |
An object of class |
range |
Two positions between which the flows should be plotted. |
xlab |
The X axis label. |
ylab |
The Y axis label. |
col |
The colors in which the four nucleotids should be plotted. |
... |
Arguments to be passed to methods, such as graphical parameters (see ‘par’). |
Christian Ruckert
This function calculates the GC-content summarized over all sequences.
gcContent(object)gcContent(object)
object |
An object of class DNAStringSet, ShortRead or SFFContainer. |
The GC-content is calculated as follows:
(#G + #C / #G + #C + #A + #T) * 100
Where #G is the number of base G in all sequences.
A numeric vector of length one containing the overall GC-content.
Christian Ruckert
This function creates a histogram of the relative GC-content per sequence.
gcContentHist(object, xlab="GC content", ylab="Number of sequences", col="firebrick1", breaks=50, ...)gcContentHist(object, xlab="GC content", ylab="Number of sequences", col="firebrick1", breaks=50, ...)
object |
An object of class DNAStringSet, ShortRead or SFFContainer. |
xlab |
The X axis label. |
ylab |
The Y axis label. |
col |
The plotting color. |
breaks |
The number of breaks in the histogram (see ‘hist’). |
... |
Arguments to be passed to methods, such as graphical parameters (see ‘par’). |
Christian Ruckert
This function plots the GC-content frequency per base position.
gcPerPosition(object, range=0.95, type="l", col="blue", xlab="Position", ylab="Frequency", ...)gcPerPosition(object, range=0.95, type="l", col="blue", xlab="Position", ylab="Frequency", ...)
object |
An object of class DNAStringSet, ShortRead or SFFContainer. |
range |
An integer vector of length one or two. If length one only bases up to the percent quantile of read lengths defined by the given value are shown. A vector of length two gives the start and end base between which the GC-content is plotted. |
type |
The type of the plot (see ‘plot’). |
col |
The plotting color. |
xlab |
The X axis label. |
ylab |
The Y axis label. |
... |
Arguments to be passed to methods, such as graphical parameters (see ‘par’). |
Christian Ruckert
This method returns the standard multiplex sequences used by the Genome Sequence MID library kits.
## S4 method for signature 'missing' genomeSequencerMIDs() ## S4 method for signature 'character' genomeSequencerMIDs(mid)## S4 method for signature 'missing' genomeSequencerMIDs() ## S4 method for signature 'character' genomeSequencerMIDs(mid)
mid |
Character vector with multiplex sequences' IDs (MIDs) |
If the argument mid is omitted, all 14 available
multiplex sequences are returned.
genomeSequencerMIDs returns a DNAStringSet with the
requested multiplex sequences.
Hans-Ulrich Klein
genomeSequencerMIDs() genomeSequencerMIDs(c("MID1", "MID3"))genomeSequencerMIDs() genomeSequencerMIDs(c("MID1", "MID3"))
For a given AVASet, this function imports all aligned reads belonging to all (or some selected) amplicons of all samples.
getAlignedReads(object, amplicons, dir)getAlignedReads(object, amplicons, dir)
object |
An instance of the |
amplicons |
An (optional) character vector of amplicon names as
mentioned in the amplicon feature data (see |
dir |
Usually, the method tries to retrieve the path to the AVA
project from the given |
This function reports all reads for all samples together. If you want to get the reads for some samples individually, try subsetting your AVASet as in the examples below.
One DNAStringSet that contains all aligned reads for all samples (eventually restricted to some given amplicons).
Christoph Bartenhagen
# load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) # import all reads for amplicon "TET2_E11.04" of the first sample avaProjectDir = system.file("extdata", "AVASet", package = "R453Plus1Toolbox") alnReads = getAlignedReads(avaSetExample[, 1], dir=avaProjectDir, amplicons="TET2_E11.04") show(alnReads)# load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) # import all reads for amplicon "TET2_E11.04" of the first sample avaProjectDir = system.file("extdata", "AVASet", package = "R453Plus1Toolbox") alnReads = getAlignedReads(avaSetExample[, 1], dir=avaProjectDir, amplicons="TET2_E11.04") show(alnReads)
This function returns a table with amino acid names as first column and the according abbreviations as row names.
getAminoAbbr()getAminoAbbr()
This function computes the coverage for each variant (in forward and/or reverse direction) for all samples. The coverage is defined as the percentual amount of reads that cover a variant.
getVariantPercentages(object, direction="both")getVariantPercentages(object, direction="both")
object |
An instance of class |
direction |
A character indicating the direction ("forward", "reverse" or "both"). |
If the direction was set to "both", the percentages are computed over the sum of both directions. Otherwise it is computed only over the
occurences in one direction (forward or reverse). The occurences can be accesses via assayData.
getVariantPercentages returns a data frame with all percentages/frequencies for all samples.
Christoph Bartenhagen
# load a (filtered) AVA dataset containing 6 samples, 4 amplicons and 4 variants data(avaSetFiltered) avaSetFiltered # both directions getVariantPercentages(avaSetFiltered, direction="both") # this is equivalent to (assayData(avaSetFiltered)[[1]] + assayData(avaSetFiltered)[[3]]) / (assayData(avaSetFiltered)[[2]] + assayData(avaSetFiltered)[[4]]) # forward direction only getVariantPercentages(avaSetFiltered, direction="forward") # this is equivalent to assayData(avaSetFiltered)[[1]] / assayData(avaSetFiltered)[[2]] # reverse direction only getVariantPercentages(avaSetFiltered, direction="reverse") # this is equivalent to assayData(avaSetFiltered)[[3]] / assayData(avaSetFiltered)[[4]]# load a (filtered) AVA dataset containing 6 samples, 4 amplicons and 4 variants data(avaSetFiltered) avaSetFiltered # both directions getVariantPercentages(avaSetFiltered, direction="both") # this is equivalent to (assayData(avaSetFiltered)[[1]] + assayData(avaSetFiltered)[[3]]) / (assayData(avaSetFiltered)[[2]] + assayData(avaSetFiltered)[[4]]) # forward direction only getVariantPercentages(avaSetFiltered, direction="forward") # this is equivalent to assayData(avaSetFiltered)[[1]] / assayData(avaSetFiltered)[[2]] # reverse direction only getVariantPercentages(avaSetFiltered, direction="reverse") # this is equivalent to assayData(avaSetFiltered)[[3]] / assayData(avaSetFiltered)[[4]]
This function creates a histogram for the different lengths of the homopolymer stretches with one bar for each nucleotide in the flow. With the height giving the number of this homopolymer stretch in the flowgram.
homopolymerHist(x, range=c(0, length(flowgram(x))), xlab="Homopolymer length", ylab="Number of homopolymers", col=c(A="black", C="red", G="blue", T="green"), ...)homopolymerHist(x, range=c(0, length(flowgram(x))), xlab="Homopolymer length", ylab="Number of homopolymers", col=c(A="black", C="red", G="blue", T="green"), ...)
x |
An object of class |
range |
Two positions between which the flows should be plotted. |
xlab |
The X axis label. |
ylab |
The Y axis label. |
col |
The colors in which the four nucleotids should be plotted. |
... |
Arguments to be passed to methods, such as graphical parameters (see ‘par’). |
Christian Ruckert
This function creates a HTML variant and quality report for a given AVASet or MapperSet instance.
htmlReport(object, annot, blocks=c(), transcripts=c(), sampleCols, minMut=3, dir="HTMLReport", title="Summary")htmlReport(object, annot, blocks=c(), transcripts=c(), sampleCols, minMut=3, dir="HTMLReport", title="Summary")
object |
An |
annot |
An instance of class |
blocks |
Character vector of block names for each variant. The variants will then be structured into several blocks. If no such list is supplied, the report consists of just one (big) table for all variants. |
transcripts |
Character vector containing Ensembl transcript-IDs that order the according entries on the transcript pages. Transcripts given in this argument will appear on top of the transcript page. |
sampleCols |
Character vector of column names of the sample data (phenoData) of the AVASet/MapperSet object to filter the sample output on the transcript pages. All columns will be listed if no such argument is given. |
minMut |
If the value of minMut is greater than zero, the report lists only variants, whose coverage for at least one sample is higher than minMut (percentage between 0 and 100). |
dir |
Character with the desired output directory. By defaultm the directory "HTMLReport" will be created in the current directory. |
title |
Heading for the first page with the variant information. |
The report is structured into two (MapperSet) or three (AVASet) parts containing variant and quality information:
The main page sums up given variant information like the name,
type, reference gene, position (see fData,
annotateVariants).
Using the argument blocks, the main page can be individually
structured by assigning a block name to each variant.
The main page can be further structured by samples. For a
given AVASet object, every sample links to another short
quality report showing only the amplicon coverage for this sample.
Every variant on the main page links to a page with further details about the affected genes and transcripts (e.g. Ensembl gene-IDs, transcript-IDs, codon sequences, changes of amino acids (if coding)).
Only in case of AVASet object: A quality report shows the coverage of every amplicon in forward and/or reverse direction. Further plots display the coverage by MID and PTP (if this information is given in the pheno data of the object).
Christoph Bartenhagen, Hans-Ulrich Klein, Christian Ruckert
# note: all examples save the report to the directory "htmlReportExample" in your current R working directory # load a filtered AVA dataset containing 6 samples, 4 amplicons and 4 variants # and its variant annotations data("avaSetFiltered") data("avaSetFiltered_annot") # create a full report showing all (unfiltered) information htmlReport(avaSetFiltered, avaSetFiltered_annot, dir="htmlReportExample", title="htmlReport Example", minMut=0) # create a report that emphasizes on samples with variants covered by at least 50% of the reads htmlReport(avaSetFiltered, avaSetFiltered_annot, dir="htmlReportExample", title="htmlReport Example", minMut=50) # create a report that is structured by the reference genes library("ShortRead") refs = sapply(fData(avaSetFiltered)$referenceSeq, function(x) subset(pData(alignData(referenceSequences(avaSetFiltered))), pData(alignData(referenceSequences(avaSetFiltered)))$refSeqID == x)$name) htmlReport(avaSetFiltered, avaSetFiltered_annot, dir="htmlReportExample", title="htmlReport Example", minMut=0, blocks=refs) # create a report whose sample information only lists the sample ids pData(avaSetFiltered) sampleCols = "SampleID" htmlReport(avaSetFiltered, avaSetFiltered_annot, dir="htmlReportExample", title="htmlReport Example", minMut=0, sampleCols=sampleCols)# note: all examples save the report to the directory "htmlReportExample" in your current R working directory # load a filtered AVA dataset containing 6 samples, 4 amplicons and 4 variants # and its variant annotations data("avaSetFiltered") data("avaSetFiltered_annot") # create a full report showing all (unfiltered) information htmlReport(avaSetFiltered, avaSetFiltered_annot, dir="htmlReportExample", title="htmlReport Example", minMut=0) # create a report that emphasizes on samples with variants covered by at least 50% of the reads htmlReport(avaSetFiltered, avaSetFiltered_annot, dir="htmlReportExample", title="htmlReport Example", minMut=50) # create a report that is structured by the reference genes library("ShortRead") refs = sapply(fData(avaSetFiltered)$referenceSeq, function(x) subset(pData(alignData(referenceSequences(avaSetFiltered))), pData(alignData(referenceSequences(avaSetFiltered)))$refSeqID == x)$name) htmlReport(avaSetFiltered, avaSetFiltered_annot, dir="htmlReportExample", title="htmlReport Example", minMut=0, blocks=refs) # create a report whose sample information only lists the sample ids pData(avaSetFiltered) sampleCols = "SampleID" htmlReport(avaSetFiltered, avaSetFiltered_annot, dir="htmlReportExample", title="htmlReport Example", minMut=0, sampleCols=sampleCols)
This function imports a project of Roche's GS Reference Mapper Software. It stores all information into an instance of the Biobase ExpressionSet.
MapperSet(dirs, samplenames)MapperSet(dirs, samplenames)
dirs |
A character vector containing all sample directories (i.e. directories that contain the files "mapping/454HCDiffs.txt" (required), "mapping/454ReadStatus.txt" (optional), "mapping/454NewblerMetrics.txt"(optional)). |
samplenames |
A character vector containing samplenames. The order and number of samplenames must be consistent with the filenames to ensure the correctness of the MapperSet. If no samplenames are given, the filenames are used for naming. |
An instance of the MapperSet is derived from the Biobase eSet and thus structured into
1. assayData
Contain the number of reads with the respective difference in forward/reverse direction.
Contain the total coverage for every variant in forward/reverse direction.
2. featureData
Give the location of each variant.
Show the bases changed in each variant.
The name of the region (gene) where the variant is located.
Lists Ensembl variant-ids for known SNPs (if any).
3. phenoData
An instance of the MapperSet.
Christoph Bartenhagen
# load a GS Mapper dataset containing 3 samples and 111 variants data(mapperSetExample) mapperSetExample# load a GS Mapper dataset containing 3 samples and 111 variants data(mapperSetExample) mapperSetExample
Container to store data imported from a project of Roche's GS Reference Mapper Software. It stores all information into a Biobase ExpressionSet.
Objects can be created by calls of the form MapperSet(filename).
While filename is a vector containing all sample directories (i.e. directories that contain the files "mapping/454HCDiffs.txt" and
"mapping/454NewblerMetrics.txt").
assayData:Object of class AssayData. Contains the number of reads with the respective difference and the total coverage
for every variant in forward and reverse direction.
featureData:Object of class AnnotatedDataFrame. Contains information about the type, location and reference of each
variant. If available, it shows further Ensembl variant-ids for known SNPs.
phenoData:Object of class AnnotatedDataFrame. By default, the phenoData contains the accession number of every sample.
variantFilterPerc:Object of class numeric. Contains a threshold to display only those variants, whose
coverage (in percent) in forward and reverse direction in at least one sample is higher than this filter value. See
setVariantFilter for details about setting this value.
variantFilter:Object of class character. Contains a vector of variant names whose
coverage (in percent) in forward and reverse direction in at least one sample is higher than the filter value(s) in
variantFilterPerc.
dirs:Object of class character. Based on a directory given at instantiation of the object, it contains a vector of several
directories containing all relevant GS Mapper project files.
experimentData:Object of class MIAME. Contains details of the experiment.
annotation:Object of class character Label associated with the annotation package used in the experiment.
protocolData:Object of class AnnotatedDataFrame. Contains additional information about the samples.
.__classVersion__:Object of class Versions. Remembers the R and R453Toolbox version numbers used to created the
MapperSet instance.
Class eSet, directly.
Class VersionedBiobase, by class "eSet", distance 2.
Class Versioned, by class "eSet", distance 3.
Sets the filter to display only those variants, whose coverage (in percent) in forward and reverse direction in at least one sample is higher than the given value.
Computes the coverage for every variant over all reads (forward and/or reverse) and for each sample.
Annotates given genomic variants. See annotateVariants for details.
Exports all (filtered) variant data into a html report. See htmlReport for details
Reads the file "454ReadStatus.txt" in the GSM project directory which contains information about the alignment of each read (chr, pos, strand, etc.)and returns its content in a dataframe.
Christoph Bartenhagen
AVASet,
annotateVariants,
htmlReport,
setVariantFilter,
getVariantPercentages
# sum up class structure showClass("MapperSet") # load a GS Mapper dataset containing 3 samples and 111 variants data(mapperSetExample) mapperSetExample # show contents of assay, feature and pheno data assayData(mapperSetExample) fData(mapperSetExample) pData(mapperSetExample)# sum up class structure showClass("MapperSet") # load a GS Mapper dataset containing 3 samples and 111 variants data(mapperSetExample) mapperSetExample # show contents of assay, feature and pheno data assayData(mapperSetExample) fData(mapperSetExample) pData(mapperSetExample)
This is an example of an link{MapperSet-class} object containing the output of Roche's GS Reference Mapper Software.
It consists of 3 samples and 111 variants.
data(mapperSetExample)data(mapperSetExample)
Formal class 'MapperSet'
‘Targeted next-generation sequencing detects point mutations, insertions, deletions, and balanced chromosomal rearrangements as well as identifies novel leukemia-specific fusion genes in a single procedure’ (Leukemia, submitted)
data(mapperSetExample) mapperSetExampledata(mapperSetExample) mapperSetExample
Structural variation like transversions or inversion cause two
breakpoints. In the context of fusion genes, these are called the
pathogenic breakpoint and the reciproce breakpoint. The method
detectBreakpoints processes each breakpoint individually
and does explicitly not put reads from the pathogenic and reciproce
breakpoint into the same cluster. Hence, it is usually sensible to call
this methods afterward to search for related pairs of breakpoints to
gain more confidence about the existence of a structural variation.
mergeBreakpoints(breakpoints, maxDist, mergeBPs)mergeBreakpoints(breakpoints, maxDist, mergeBPs)
breakpoints |
An object of class |
maxDist |
The maximal distance in basepairs at which two breakpoints will be merged. Default value is 1000. |
mergeBPs |
An optional list of vectors of length two giving the breakpoints that should be merged. If this argument is given, the method will not search for related breakpoints. |
If the maxDist argument is given, the method compares each pair
of breakpoints and checks, whether the two breakpoints may belong to the
same structural variation. In addition to the spanned chromosomes, the
orientation and the strand information of the reads spanning the
breakpoints are also compared for this purpose. If chrosmosome,
orientation and strand information of two breakpoints go well together,
they will be merged, if the absolute distance of the breakpoints on
chromosome A plus the absolute distance on chromosome B is smaller or
equal to maxDist. If one breakpoint has more than one potential
mate breakpoint for merging, it will be merged with the first candidate
and a warning message is printed. The default value of maxDist
is 1000.\
If the mergeBPs argument is given, the method will not search for
related breakpoints but simply merge the given breakpoints.
mergeBPs must be a list with vectors of
length two that either contain the names of the indices of the
breakpoints that should be merged.\
The arguments maxDist and mergeBPs cannot be given
together. The given Breakpoints object must not contain
breakpoints that have been merged before.
An object of class Breakpoints storing merged and unmerged
breakpoints.
Hans-Ulrich Klein
detectBreakpoints, Breakpoints-class,
plotChimericReads
# Load bam file and filter chimeric reads library(Rsamtools) bamFile = system.file("extdata", "SVDetection", "bam", "N01.bam", package="R453Plus1Toolbox") bam = scanBam(bamFile) data(captureArray) linker = sequenceCaptureLinkers("gSel3")[[1]] filterReads = filterChimericReads(bam, targetRegion=captureArray, linkerSeq=linker) # detect breakpoints of size >= 3 breakpoints = detectBreakpoints(filterReads, minClusterSize=3) table(breakpoints) summary(breakpoints) # merge breakpoints breakpoints = mergeBreakpoints(breakpoints) summary(breakpoints)# Load bam file and filter chimeric reads library(Rsamtools) bamFile = system.file("extdata", "SVDetection", "bam", "N01.bam", package="R453Plus1Toolbox") bam = scanBam(bamFile) data(captureArray) linker = sequenceCaptureLinkers("gSel3")[[1]] filterReads = filterChimericReads(bam, targetRegion=captureArray, linkerSeq=linker) # detect breakpoints of size >= 3 breakpoints = detectBreakpoints(filterReads, minClusterSize=3) table(breakpoints) summary(breakpoints) # merge breakpoints breakpoints = mergeBreakpoints(breakpoints) summary(breakpoints)
plotVariants
This data.frame is part of the vignette example of the plotVariants function. It contains annotations for the different
mutations occurring in the example data. It has columns "mutation", "legend" and "color".
data(plotVariantsExample)data(plotVariantsExample)
data.frame
data(plotVariantsExample) mutationInfodata(plotVariantsExample) mutationInfo
This function plots the relative frequency of the four bases for each position in the sequences.
nucleotideCharts(object, range=0.95, linetypes=c(A="l", C="l", G="l", T="l", N="l"), linecols=c(A="black", C="red", G="blue", T="green", N="grey70"), xlab="Position", ylab="Frequency", ...)nucleotideCharts(object, range=0.95, linetypes=c(A="l", C="l", G="l", T="l", N="l"), linecols=c(A="black", C="red", G="blue", T="green", N="grey70"), xlab="Position", ylab="Frequency", ...)
object |
An object of class DNAStringSet, ShortRead or SFFContainer. |
range |
An integer vector of length one or two. If length one only bases up to the percent quantile of read lengths defined by the given value are shown. A vector of length two gives the start and end base between which the nucleotide frequencies are plotted. |
linetypes |
The line types used for the four nucleotids + N, see (see ‘par’) |
linecols |
The colors in which the four nucleotids + N should be plotted. |
xlab |
The X axis label. |
ylab |
The Y axis label. |
... |
Arguments to be passed to methods, such as graphical parameters (see ‘par’). |
Christian Ruckert
A function for visualizing the number of reads per amplicon or per MID / pico titer plate.
## S4 method for signature 'AVASet,character,logical' plotAmpliconCoverage(avaSet, type="amplicon", bothDirections=TRUE, cex.names=0.8, cex.axis=0.8, las=3, col=c(rgb(217/255, 214/255, 209/255), rgb(173/255, 38/255, 36/255)), ...)## S4 method for signature 'AVASet,character,logical' plotAmpliconCoverage(avaSet, type="amplicon", bothDirections=TRUE, cex.names=0.8, cex.axis=0.8, las=3, col=c(rgb(217/255, 214/255, 209/255), rgb(173/255, 38/255, 36/255)), ...)
avaSet |
An instance of AVASet. |
type |
A character vector specifying the type of plot. |
bothDirections |
A logical value determining whether the plot sums forward and reverse reads or shows them separately. |
cex.names |
Font size of the amplicon name labels. |
cex.axis |
Font size of axes' labels. |
las |
Orientation of amplicon name labels. |
col |
Colors used in the plot. |
... |
Arguments to be passed to methods, such as graphical parameters (see ‘par’). |
If the argumnet type is “amplicon”, the number of reads for each amplicon are visualized. In case of a AVASet with one sample, a barplot with one bar for each amplicon is created. In case of more than one sample, a boxplot with one box for each amplicon is plotted. If type is “mid”, a boxplot with one box for each MID is created. If type is “ptp”, a boxplot with one box for each pico titer plate is created.
Hans-Ulrich Klein
## Not run: data(avaSetExample) plotAmpliconCoverage(avaSetExample) plotAmpliconCoverage(avaSetExample[,1]) ## End(Not run)## Not run: data(avaSetExample) plotAmpliconCoverage(avaSetExample) plotAmpliconCoverage(avaSetExample[,1]) ## End(Not run)
This function plots a given set of aligned chimeric reads along a reference sequence. It plots the breakpoints of translations or inversions and marks deletions, insertions and mismatches. Optionally, it displays all base pairs in a given region around the breakpoint.
plotChimericReads(brpData, geneSymbols=FALSE, plotMut=TRUE, plotBasePairs=FALSE, maxBasePairs=50, legend=FALSE, title="", col=c("red", "green", "black", "orange"))plotChimericReads(brpData, geneSymbols=FALSE, plotMut=TRUE, plotBasePairs=FALSE, maxBasePairs=50, legend=FALSE, title="", col=c("red", "green", "black", "orange"))
brpData |
A |
geneSymbols |
Boolean value whether to automatically load and plot the gene symbols from the Ensembl database. Additionally,
|
plotMut |
Boolean value whether to mark deletions, insertions and mismatches. |
plotBasePairs |
Optionally, |
maxBasePairs |
The maximum number of base pairs to be plotted. Only used in conjunction with |
legend |
A logical value (TRUE/FALSE) whether to plot a legend that explains the colouration of the insertions, deletions, mismatches and breakpoints. |
title |
A title for the plot. |
col |
A vector of four colours to draw insertions, deletions, mismatches and breakpoints. In this order, the default colours are "red",
"green", "black" and "orange" (use |
This method is intended to be run after the pipeline for structural
variant detection. Therefore, see the methods
filterChimericReads, detectBreakpoints and
mergeBreakpoints to correctly preprocess your alignment
before running plotChimericReads.
It is recommended to first create and resize the output device (e.g. the plotting window or a pdf file) before plotting. For example, on Unix
systems you may try X11(width=w, height=h) or pdf(file="plotChimericReads.pdf", width=w, height=h) for some window width w (e.g.
w=12) and window height h (e.g. h=6).
Christoph Bartenhagen
Breakpoints-class,
detectBreakpoints,
mergeBreakpoints
# load breakpoint data containing twelve chimeric reads describing an inversion in chromosome 16 data("breakpoints") breakpoints # standard plot # (only arrangement of reads plotted; breakpoints in orange, deletions # in red, insertions in green and mismatches in black by default) plotChimericReads(breakpoints) # plot base pairs in the breakpoint region (+/- 32bp) ## Not run: plotChimericReads(breakpoints, plotBasePairs=TRUE, maxBasePairs=32) # use custom colours and display a legend: # deletions="brown", insertions="blue", mismatches="yellow", breakpoints="gray" plotChimericReads(breakpoints, col=c("brown", "blue", "yellow", "gray"), legend=TRUE)# load breakpoint data containing twelve chimeric reads describing an inversion in chromosome 16 data("breakpoints") breakpoints # standard plot # (only arrangement of reads plotted; breakpoints in orange, deletions # in red, insertions in green and mismatches in black by default) plotChimericReads(breakpoints) # plot base pairs in the breakpoint region (+/- 32bp) ## Not run: plotChimericReads(breakpoints, plotBasePairs=TRUE, maxBasePairs=32) # use custom colours and display a legend: # deletions="brown", insertions="blue", mismatches="yellow", breakpoints="gray" plotChimericReads(breakpoints, col=c("brown", "blue", "yellow", "gray"), legend=TRUE)
This function illustrates the positions and types of mutations within a given gene and transcript. The plot shows only coding regions (thus, units are amino acids / codons). The coding region is further divided into exons labeled with their rank in the transcript. Transcript annotation is obtained from the ensembl GRCh37 server.
plotVariants(data, gene, transcript, regions, mutationInfo, groupBy, horiz=FALSE, cex=1, title="", legend=TRUE)plotVariants(data, gene, transcript, regions, mutationInfo, groupBy, horiz=FALSE, cex=1, title="", legend=TRUE)
data |
This can be either a data.frame or an instance of class
|
gene |
A string containing the Ensembl id of the gene of interest (required). |
transcript |
A string containing an Ensembl transcript id (optional, but recommended). If no Ensembl transcript-id is passed, it is chosen automatically and the function will return an appropriate data frame with all annotated transcripts for the given gene. |
regions |
A data frame having columns "name", "start", "end" and "color". The plot will highlight these regions with the given colors and print their name in the legend. |
mutationInfo |
A data frame with annotations for the different mutations occurring in the data (optional but recommended). It requires the columns "mutation", "legend" and "color". The first column must list the exact mutation names that occur in the data column "mutation". The column "legend" allows for a more detailed name of the mutation that will appear in the legend. The color of each mutation type is optional and can also be assigned automatically. |
groupBy |
By default, the mutations will be grouped by their
position (i.e. the column "pos"). If necessary, one might give the name of an other column
in the |
horiz |
In more comprehensive datasets, more than one
mutation may be listed for a single position. If |
cex |
A numeric value |
title |
A title for the plot (optional). |
legend |
A logical value (TRUE/FALSE) whether to plot a legend
for the mutations types (see |
The plot will show the coding part of the gene and its exons as
x-axis at the bottom. Mutations will be marked and ordered above according to
their genomic position. The axis units are amino acids / codons (hence, all given
genomic positions should be divided by three if necessary).
Passing a data frame to this function allows a much more individual and detailed
annotation of the mutations like labels, colors and user defined
mutation types.
Passing an instance of class annotatedVariants is useful for integration into the
R453Plus1Toolbox pipeline and for compatibility to older versions of the
plot. Then, it will only distinguish deletions and missense, nonsense
and silent mutations.
By default, the plot will group mutations (horizontally or vertically) by their position. It is
possible to group by an other column in the data (see parameter
groupBy), but in the current version this makes
only sense if the mutations in one group are locally clustered, i.e. have
the same or a similar position. The parameter groupBy is
mainly useful to modify or even disable the automatic grouping of different mutations at the same position.
The function will return a data frame containing all Ensembl transcript information for the given gene ("ensembl_transcript_id", "rank", "cds_start", "cds_end" and "cds_length"). This data frame may prove useful for retrieving a Ensembl transcript id for future plots.
Depending on the amount of mutations and the size of the gene, the plot
may not fit into the device or the text may become too small. It is
recommended to carefully select the right size of your device
before starting this function to ensure a well scaled and beautiful
plot.
This function requires the package TeachingDemos to work, which
can be found at CRAN.
Christoph Bartenhagen
# EXAMPLE 1: Working with intances of class annotatedVariants # one missense, one nonsense point mutation and one deletion variants = data.frame( row.names=c("missense", "deletion", "nonsense"), start=c(106157528, 106157635, 106193892), end=c(106157528, 106157635, 106193892), chromosome=c("4", "4", "4"), strand=c("+", "+", "+"), seqRef=c("A", "G", "C"), seqMut=c("G", "-", "T"), seqSur=c("TACAGAA", "TAAGCAG", "CGGCGAA"), stringsAsFactors=FALSE) # annotate variants with affected genes, exons and codons (may take a minute to finish) ## Not run: varAnnot = annotateVariants(variants) # plot variants for gene TET2 having the Ensembl id "ENSG00000168769" # when passing no transcript, the largest transcript annotated in the Ensembl database for this gene will be selected automatically ## Not run: plotVariants(data=varAnnot, gene="ENSG00000168769", title="plotVariants Example", legend=TRUE) # EXAMPLE 2: Working with a data frame # two missense at one position, one nonsense point mutation and one deletion # it is possible to assign a color to every single mutation independently from its type variants = data.frame( label=c("A>G","A>G(2)","delG","C>T"), pos=c(831,831,867,1437), mutation=c("M","M","D","N"), color=c("black", "black", "green", "red"), stringsAsFactors=FALSE ) # more detailed names for mutation abbreviations can be passed as mutationInfo # this is useful for the legend, but can also be generated automatically mutationInfo = data.frame( mutation=c("M","D","S","N"), legend=c("Missense","Nonsense","Silent","Deletion"), stringsAsFactors=FALSE ) # regions of interest can be highlighted using the regions parameter regions = data.frame( name = c("region1", "region2"), start = c(700, 1400), end = c(1000, 1900), color = c("red", "blue") ) # using the horiz parameter, multiple mutations occurring at the same place can be either aligned ... # ... vertically ## Not run: plotVariants(data=variants, gene="ENSG00000168769", transcript="ENST00000513237", regions=regions, mutationInfo=mutationInfo, horiz=FALSE, title="'plotVariants' Example", legend=TRUE) # ... or horizontally in groups ## Not run: plotVariants(data=variants, gene="ENSG00000168769", transcript="ENST00000513237", regions=regions, mutationInfo=mutationInfo, horiz=TRUE, title="'plotVariants' Example", legend=TRUE) # group mutations by their label and not by their position (which is the default) ## Not run: plotVariants(data=variants, gene="ENSG00000168769", transcript="ENST00000513237", regions=regions, mutationInfo=mutationInfo, groupBy="label", horiz=TRUE, title="'plotVariants' Example", legend=TRUE)# EXAMPLE 1: Working with intances of class annotatedVariants # one missense, one nonsense point mutation and one deletion variants = data.frame( row.names=c("missense", "deletion", "nonsense"), start=c(106157528, 106157635, 106193892), end=c(106157528, 106157635, 106193892), chromosome=c("4", "4", "4"), strand=c("+", "+", "+"), seqRef=c("A", "G", "C"), seqMut=c("G", "-", "T"), seqSur=c("TACAGAA", "TAAGCAG", "CGGCGAA"), stringsAsFactors=FALSE) # annotate variants with affected genes, exons and codons (may take a minute to finish) ## Not run: varAnnot = annotateVariants(variants) # plot variants for gene TET2 having the Ensembl id "ENSG00000168769" # when passing no transcript, the largest transcript annotated in the Ensembl database for this gene will be selected automatically ## Not run: plotVariants(data=varAnnot, gene="ENSG00000168769", title="plotVariants Example", legend=TRUE) # EXAMPLE 2: Working with a data frame # two missense at one position, one nonsense point mutation and one deletion # it is possible to assign a color to every single mutation independently from its type variants = data.frame( label=c("A>G","A>G(2)","delG","C>T"), pos=c(831,831,867,1437), mutation=c("M","M","D","N"), color=c("black", "black", "green", "red"), stringsAsFactors=FALSE ) # more detailed names for mutation abbreviations can be passed as mutationInfo # this is useful for the legend, but can also be generated automatically mutationInfo = data.frame( mutation=c("M","D","S","N"), legend=c("Missense","Nonsense","Silent","Deletion"), stringsAsFactors=FALSE ) # regions of interest can be highlighted using the regions parameter regions = data.frame( name = c("region1", "region2"), start = c(700, 1400), end = c(1000, 1900), color = c("red", "blue") ) # using the horiz parameter, multiple mutations occurring at the same place can be either aligned ... # ... vertically ## Not run: plotVariants(data=variants, gene="ENSG00000168769", transcript="ENST00000513237", regions=regions, mutationInfo=mutationInfo, horiz=FALSE, title="'plotVariants' Example", legend=TRUE) # ... or horizontally in groups ## Not run: plotVariants(data=variants, gene="ENSG00000168769", transcript="ENST00000513237", regions=regions, mutationInfo=mutationInfo, horiz=TRUE, title="'plotVariants' Example", legend=TRUE) # group mutations by their label and not by their position (which is the default) ## Not run: plotVariants(data=variants, gene="ENSG00000168769", transcript="ENST00000513237", regions=regions, mutationInfo=mutationInfo, groupBy="label", horiz=TRUE, title="'plotVariants' Example", legend=TRUE)
This method creates a plot similar to the variation frequency plot in Roche's GS Amplicon Variant Analyzer. The plot shows the reference sequence along the x-axis and indicates variants as bars at the appropriate positions. The height of the bars corresponds to the percentage of reads carrying the variant. A second y-axis indicates the absolute number of reads covering the variant.
plotVariationFrequency(object, plotRange, ...)plotVariationFrequency(object, plotRange, ...)
object |
A character pointing to an Amplicon Variant Analyser Global Alignmnet export file. |
plotRange |
A two dimensional numeric vector giving the start and end base of the reference sequence that should be plotted. |
... |
Arguments passed to other plotting methods. Especially, argument |
The text file used as imput must have the format generated by the AVA
export function. Such a file can be generated using the export button in
the Global Alignment view of the AVA software.
The col argument specifies the colours used for different bases
and deletions. The following listing gives the meaning of the i-th position
of the col vector (default values in braces):
A (green)
C (blue)
G (black)
T (red)
N (purple)
deletion (gray)
Hans-Ulrich Klein
## Not run: file = system.file("extdata", "AVAVarFreqExport", "AVAVarFreqExport.xls", package="R453Plus1Toolbox") plotVariationFrequency(file, plotRange=c(50, 150)) ## End(Not run)## Not run: file = system.file("extdata", "AVAVarFreqExport", "AVAVarFreqExport.xls", package="R453Plus1Toolbox") plotVariationFrequency(file, plotRange=c(50, 150)) ## End(Not run)
Creates a boxplot of the quality scores over all sequences at each position.
positionQualityBoxplot(object, range, binsize=10, xlab=paste("Read position in bp (Bin size: ", binsize, "bp)", sep=""), ylab="Quality score", col="firebrick1", ...)positionQualityBoxplot(object, range, binsize=10, xlab=paste("Read position in bp (Bin size: ", binsize, "bp)", sep=""), ylab="Quality score", col="firebrick1", ...)
object |
An object of class QualityScaledDNAStringSet, ShortReadQ or SFFContainer. |
range |
A numeric vector of length one or two. If length one only bases from the first until this position are plotted. If two all bases between these two positions are plotted. |
binsize |
Number of positions to summarize in one box in the plot. |
xlab |
The X axis label. |
ylab |
The Y axis label. |
col |
The plotting color. |
... |
Arguments to be passed to methods, such as graphical parameters (see ‘par’). |
Christian Ruckert
This function takes a character vector consisting of filenames pointing to files in Roche's SFF format as input and creates a quality report in PDF format as output.
qualityReportSFF(sfffiles, outfile)qualityReportSFF(sfffiles, outfile)
sfffiles |
A character vector of the SFF files to read in. |
outfile |
The name of the PDF report file created. Defaults to ‘qcreport.pdf’ in the current directory. |
The function uses the qualityReport.Rnw file from the extdata directory of the package and Sweave
to create a .tex file which is afterwards converted to .pdf format. In the .Rnw file the following quality
control functions are used: readLengthStats, readLengthHist,
baseQualityStats, baseQualityHist, sequenceQualityHist,
positionQualityBoxplot, baseFrequency, nucleotideCharts,
gcContent, gcPerPosition, gcContentHist,
complexity.dust, complexity.entropy, dinucleotideOddsRatio.
Christian Ruckert
## Not run: file <- system.file("extdata", "SFF", "example.sff", package="R453Plus1Toolbox") qualityReportSFF(file, "QualityReport.pdf") ## End(Not run)## Not run: file <- system.file("extdata", "SFF", "example.sff", package="R453Plus1Toolbox") qualityReportSFF(file, "QualityReport.pdf") ## End(Not run)
This function plots a histogram of the read lengths.
readLengthHist(object, cutoff=0.99, xlab="Read length", ylab="Number of sequences", col="firebrick1", breaks=100, ...)readLengthHist(object, cutoff=0.99, xlab="Read length", ylab="Number of sequences", col="firebrick1", breaks=100, ...)
object |
An object of class DNAStringSet, ShortRead or SFFContainer. |
cutoff |
Reads longer than the cutoff-percent quantile are omitted from the plot. |
xlab |
The X axis label. |
ylab |
The Y axis label. |
col |
The plotting color. |
breaks |
The number of breaks in the histogram (see ‘hist’). |
... |
Arguments to be passed to methods, such as graphical parameters (see ‘par’). |
Christian Ruckert
This function returns the mean, median, minimum, maximum and standard deviation of the read lengths over a set of sequences.
readLengthStats(object)readLengthStats(object)
object |
An object of class DNAStringSet, ShortRead or SFFContainer. |
A vector with five entries: mean, median, min, max and sd.
Christian Ruckert
This function reads in files in Roche's Standard Flowgram Format (SFF) and store the contents in
an SFFContainer-class object.
readSFF(files)readSFF(files)
files |
The name of the .sff file to read in or a character vector of multiple file names or the name of a directory containing .sff files. |
An object or a list of objects of class SFFContainer storing all the information from the
.sff file(s).
Christian Ruckert
file <- system.file("extdata", "SFF", "example.sff", package="R453Plus1Toolbox") sffContainer <- readSFF(file) sffContainerfile <- system.file("extdata", "SFF", "example.sff", package="R453Plus1Toolbox") sffContainer <- readSFF(file) sffContainer
This methods checks (approximately) whether the given reads align within a given region.
readsOnTarget(alnReads, targetRegion)readsOnTarget(alnReads, targetRegion)
alnReads |
A list as returned by |
targetRegion |
The target region as a |
The detailed alignment information given by the CIGAR strings in .bam files are ignored by the function. Instead, it is assumed that the whole read alignes to the reference without indels. This is often not true for longer read (e.g. generated with Roche 454 Sequencing), but saves computation time. Hence, this method is useful to approximate the number of reads that align in the target region of a targeted sequencing experiment.
A list with one logical vector for each list entry in alnReads. The logical vector indicates for each read whether it overlaps with at least one base from any target region or not.
Hans-Ulrich Klein
library(Rsamtools) bamFile = system.file("extdata", "SVDetection", "bam", "N01.bam", package="R453Plus1Toolbox") bam = scanBam(bamFile) region = GRanges(IRanges(start=118307205, end=118395936), seqnames=11) targetReads = readsOnTarget(bam, region) sum(targetReads[[1]])library(Rsamtools) bamFile = system.file("extdata", "SVDetection", "bam", "N01.bam", package="R453Plus1Toolbox") bam = scanBam(bamFile) region = GRanges(IRanges(start=118307205, end=118395936), seqnames=11) targetReads = readsOnTarget(bam, region) sum(targetReads[[1]])
This function give access to a slot of an instance of the AVASet storing information about all reference sequences of the amplicons.
referenceSequences(object)referenceSequences(object)
object |
An |
The data is stored in an object of class AlignedRead and thus gives information about all reference sequences and
their position on a chromosome (if alignShortReads has been called before).
Christoph Bartenhagen
# load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) referenceSequences(avaSetExample)# load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) referenceSequences(avaSetExample)
plotVariants
This data.frame is part of the vignette example of the plotVariants function. It has the columns "name", "start", "end" and
"color". The plot will highlight these regions with the given colors and print their name in the legend.
data(plotVariantsExample)data(plotVariantsExample)
data.frame
data(plotVariantsExample) regionsdata(plotVariantsExample) regions
If linkers are attached during sample preparation, it may be useful to remove the linkers' sequences after sequencing. This method finds and removes linker sequences that are located at the start of the given reads.
## S4 method for signature 'XStringSet,DNAString,logical,numeric,numeric' removeLinker(reads, linker, removeReadsWithoutLinker, minOverlap, penalty)## S4 method for signature 'XStringSet,DNAString,logical,numeric,numeric' removeLinker(reads, linker, removeReadsWithoutLinker, minOverlap, penalty)
reads |
A |
linker |
A |
removeReadsWithoutLinker |
Whether reads without linkers should be removed. Default is FALSE |
minOverlap |
The minimal score that must be achived when aligning the linker. Default is length(linker)/2 |
penalty |
The penalty for substitutions or indels. Default is 2 |
The best alignment of the linker within the start (length of linker + 5) of each given sequence is computed. The followong scoring schema is used: Each matching bases scores +1. Each substitution or indel scores the given penalty argument (default: penalty=2). There are no penalties for gaps and the end of the linker (overlap). An alignment is considered as match, if the scores is larger of equal to minOverlap (default: minOverlap=round(length(linker)/2)). In cases of a successful match, the subsequence from position 1 until the end of the linker's alignment is removed.
removeLinker returns a DNAStringSet with trimmed reads.
Hans-Ulrich Klein
sequenceCaptureLinkers, DNAStringSet,
pairwiseAlignment
linker = sequenceCaptureLinkers()[[1]] reads = DNAStringSet(c( "CTCGAGAATTCTGGATCCTCAAA", "GAATTCTGGATCCTCAAA", "CTCGAGAAAAAAAAATCCTCAAA")) removeLinker(reads, linker)linker = sequenceCaptureLinkers()[[1]] reads = DNAStringSet(c( "CTCGAGAATTCTGGATCCTCAAA", "GAATTCTGGATCCTCAAA", "CTCGAGAAAAAAAAATCCTCAAA")) removeLinker(reads, linker)
This method returns the NimbleGen's linker sequences used with their sequence capture arrays. See pp.29-30 in the NimbleGen Arrays User's Guide.
## S4 method for signature 'character' sequenceCaptureLinkers(name) ## S4 method for signature 'missing' sequenceCaptureLinkers()## S4 method for signature 'character' sequenceCaptureLinkers(name) ## S4 method for signature 'missing' sequenceCaptureLinkers()
name |
Character vector with linker sequences' names |
If the argument name is omitted, both linker
sequences are returned.
sequenceCaptureLinkers returns a DNAStringSet with the
requested linker sequences.
Hans-Ulrich Klein
sequenceCaptureLinkers()sequenceCaptureLinkers()
This function creates a histogram of the mean qualities of the sequences.
sequenceQualityHist(object, xlab="Mean of quality scores per sequence", ylab="Number of sequences", col="firebrick1", ...)sequenceQualityHist(object, xlab="Mean of quality scores per sequence", ylab="Number of sequences", col="firebrick1", ...)
object |
An object of class QualityScaledDNAStringSet, ShortReadQ or SFFContainer. |
xlab |
The X axis label. |
ylab |
The Y axis label. |
col |
The plotting color. |
... |
Arguments to be passed to methods, such as graphical parameters (see ‘par’). |
Christian Ruckert
This functions sets the filter to display only those variants, whose amplicon coverage (in percent) in forward and reverse direction in at least one sample is higher than a given value. The coverage is defined as the percentual amount of reads that cover a variant.
setVariantFilter(object, filter=0)setVariantFilter(object, filter=0)
object |
An instance of an |
filter |
A filter value between 0 and 1. If two values are given in a vector, the variants are filterd according to the forward (first value) and reverse direction (second value) separately. In this case, a variant has to meet both requirements. |
Setting the filter affects the assayData and the featureData of the variant slot. See also getVariantPercentages for further details.
setVariantFilter returns the given link{AVASet-class}/link{MapperSet-class} instance with an updated filter value.
Christoph Bartenhagen
link{AVASet-class},
link{MapperSet-class},
getVariantPercentages.
# load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) avaSetExample # use only those variants that are covered by at least 10% of all reads in one sample in both directions together (259 -> 4 variants) avaSetExample = setVariantFilter(avaSetExample, filter=0.1) avaSetExample # use only those variants that are covered by at least 0.1% of all reads in one sample in forward direction # and by at least 0% in reverse direction (259 -> 6 variants) avaSetExample = setVariantFilter(avaSetExample, filter=c(0.1, 0)) avaSetExample # reset filter values to zero avaSetExample = setVariantFilter(avaSetExample, filter=0) # or simply avaSetExample = setVariantFilter(avaSetExample)# load an AVA dataset containing 6 samples, 4 amplicons and 259 variants data(avaSetExample) avaSetExample # use only those variants that are covered by at least 10% of all reads in one sample in both directions together (259 -> 4 variants) avaSetExample = setVariantFilter(avaSetExample, filter=0.1) avaSetExample # use only those variants that are covered by at least 0.1% of all reads in one sample in forward direction # and by at least 0% in reverse direction (259 -> 6 variants) avaSetExample = setVariantFilter(avaSetExample, filter=c(0.1, 0)) avaSetExample # reset filter values to zero avaSetExample = setVariantFilter(avaSetExample, filter=0) # or simply avaSetExample = setVariantFilter(avaSetExample)
This function takes a SFFContainer object and writes it to a file in FASTQ format.
sff2fastq(x, outdir, fname)sff2fastq(x, outdir, fname)
x |
An object of class SFFContainer. |
outdir |
The directory where the file should be stored, defaults to the current working directory. |
fname |
The name of the file to write. Defaults to the filename slot of the SFFContainer, with .sff substituted with .fastq. |
Christian Ruckert
"SFFContainer"
This class is a container for data from files in Roche's Standard Flowgram Format (SFF).
Objects can be created by calls of the form new("SFFContainer", ...).
Usually, objects will be created by calling the readSFF method on a file in SFF
format.
name:Object of class "character" containing the name of the file this
SFFContainer was created from.
flowgramFormat:Object of class "numeric" representing the format used to
encode each of the flowgram values for each read. Currently, only one flowgram format has been
adopted and is coded by the value 1.
flowChars:Object of class "character" containing the array of nucleotide
bases ('A', 'C', 'G', 'T') that correspond to the nucleotides used for each flow of each
read.
keySequence:Object of class "character" representing the nucleotide bases
of the key sequence used for these reads.
clipQualityLeft:Object of class "numeric" representing the position of the
first base after the clipping point for an attached quality sequence for each read. If only a
combined (quality+adapter) clipping position is computed it should be stored in
clipQualityLeft. If no clipping value is computed the field is set to 0. The position values
use 1-based indexing.
clipQualityRight:Object of class "numeric" representing the position of
the last base before the clipping point for an attached quality sequence for each read. If
only a combined (quality+adapter) clipping position is computed it should be stored in
clipQualityRight. If no clipping value is computed the field is set to 0. The position values
use 1-based indexing.
clipAdapterLeft:Object of class "numeric" representing the position of the
first base after the clipping point for an attached adapter sequence for each read. If only a
combined (quality+adapter) clipping position is computed it should be stored in
clipQualityLeft. If no clipping value is computed the field is set to 0. The position values
use 1-based indexing.
clipAdapterRight:Object of class "numeric" representing the position of
the last base before the clipping point for an attached adapter sequence for each read. If
only a combined (quality+adapter) clipping position is computed it should be stored in
clipQualityRight. If no clipping value is computed the field is set to 0. The position values
use 1-based indexing.
flowgrams:Object of class "list" containing the homopolymer stretch
estimates for each flow using one list item for each read.
flowIndexes:Object of class "list" containing the flow positions for
each base in the called sequence, i.e. for each base, the position in the flowgram whose
estimate resulted in that base being called. Each read has its own list item.
reads:Object of class "QualityScaledDNAStringSet" containing the
basecalled nucleotide sequences of each read together with the quality scores for each of the
bases in the sequence using the standard -log10 probability scale.
signature(object = "SFFContainer", read = "SFFRead"): Adds an object of
class SFFRead to the SFFContainer
signature(object = "SFFContainer", readname = "character"): Returns the
read with the given name as an object of class SFFRead.
signature(object = "SFFContainer", value = "numeric"):
Setter-method for the clipAdapterLeft slot.
signature(object = "SFFContainer"):
Getter-method for the clipAdapterLeft slot.
signature(object = "SFFContainer", value = "numeric"):
Setter-method for the clipAdapterRight slot.
signature(object = "SFFContainer"):
Getter-method for the clipAdapterRight slot.
signature(object = "SFFContainer", value = "numeric"):
Setter-method for the clipQualityLeft slot.
signature(object = "SFFContainer"):
Getter-method for the clipQualityLeft slot.
signature(object = "SFFContainer", value = "numeric"):
Setter-method for the clipQualityRight slot.
signature(object = "SFFContainer"):
Getter-method for the clipQualityRight slot.
signature(object = "SFFContainer", value = "character"):
Setter-method for the name slot.
signature(object = "SFFContainer"):
Getter-method for the name slot.
signature(object = "SFFContainer", value = "character"):
Setter-method for the flowChars slot.
signature(object = "SFFContainer"):
Getter-method for the flowChars slot.
signature(object = "SFFContainer", value = "numeric"):
Setter-method for the flowgramFormat slot.
signature(object = "SFFContainer"):
Getter-method for the flowgramFormat slot.
signature(object = "SFFContainer", value = "list"):
Setter-method for the flowgrams slot.
signature(object = "SFFContainer"):
Getter-method for the flowgrams slot.
signature(object = "SFFContainer", value = "list"):
Setter-method for the flowIndexes slot.
signature(object = "SFFContainer"):
Getter-method for the flowIndexes slot.
signature(object = "SFFContainer", value = "character"):
Setter-method for the keySequence slot.
signature(object = "SFFContainer"):
Getter-method for the keySequence slot.
signature(object = "SFFContainer", value = "QualityScaledDNAStringSet"):
Setter-method for the reads slot.
signature(object = "SFFContainer"):
Getter-method for the reads slot.
signature(x = "SFFContainer", i = "ANY", j = "ANY"):
Subsetting a SFFContainer object.
Christian Ruckert
showClass("SFFContainer")showClass("SFFContainer")
"SFFRead"
This class is a container for a single read from files in Roche's Standard Flowgram Format (SFF).
Objects can be created by calls of the form new("SFFRead", ...).
Usually, objects will be created by calling the getRead method on an object of class
SFFContainer.
name:Object of class "character" representing the name of the read.
read:Object of class "DNAString" containing the basecalled
nucleotide sequence of the read.
flowgramFormat:Object of class "numeric" representing the format used to
encode each of the flowgram values for each read. Currently, only one flowgram format has been
adopted and is coded by the value 1.
flowChars:Object of class "character" containing the array of nucleotide
bases ('A', 'C', 'G', 'T') that correspond to the nucleotides used for each flow of each
read.
keySequence:Object of class "character" representing the nucleotide bases
of the key sequence used for these reads.
clipQualityLeft:Object of class "numeric" representing the position of the
first base after the clipping point for an attached quality sequence. If only a combined
(quality+adapter) clipping position is computed it should be stored in clipQualityLeft. If no
clipping value is computed the field is set to 0. The position values use 1-based indexing.
clipQualityRight:Object of class "numeric" representing the position of
the last base before the clipping point for an attached quality sequence. If only a combined
(quality+adapter) clipping position is computed it should be stored in clipQualityRight. If no
clipping value is computed the field is set to 0. The position values use 1-based indexing.
clipAdapterLeft:Object of class "numeric" representing the position of the
first base after the clipping point for an attached adapter sequence. If only a combined
(quality+adapter) clipping position is computed it should be stored in clipQualityLeft. If no
clipping value is computed the field is set to 0. The position values use 1-based indexing.
clipAdapterRight:Object of class "numeric" representing the position of
the last base before the clipping point for an attached adapter sequence. If only a combined
(quality+adapter) clipping position is computed it should be stored in clipQualityRight. If no
clipping value is computed the field is set to 0. The position values use 1-based indexing.
flowgram:Object of class "numeric" containing the homopolymer stretch
estimates for each flow.
flowIndexes:Object of class "numeric" containing the flow positions for
each base in the called sequence, i.e. for each base, the position in the flowgram whose
estimate resulted in that base being called.
quality:Object of class "BString" containing
the quality scores for each of the bases in the sequence, where
the values use the standard -log10 probability scale.
signature(object = "SFFRead", value = "DNAString"):
Setter-method for the read slot.
signature(object = "SFFRead"):
Getter-method for the read slot.
signature(object = "SFFContainer", value = "character"):
Setter-method for the flowChars slot.
signature(object = "SFFContainer"):
Getter-method for the flowChars slot.
signature(object = "SFFContainer", value = "numeric"):
Setter-method for the flowgramFormat slot.
signature(object = "SFFContainer"):
Getter-method for the flowgramFormat slot.
signature(object = "SFFContainer", value = "character"):
Setter-method for the keySequence slot.
signature(object = "SFFContainer"):
Getter-method for the keySequence slot.
signature(object = "SFFRead", value = "numeric"):
Setter-method for the clipAdapterLeft slot.
signature(object = "SFFRead"):
Getter-method for the clipAdapterLeft slot.
signature(object = "SFFRead", value = "numeric"):
Setter-method for the clipAdapterRight slot.
signature(object = "SFFRead"):
Getter-method for the clipAdapterRight slot.
signature(object = "SFFRead", value = "numeric"):
Setter-method for the clipQualityLeft slot.
signature(object = "SFFRead"):
Getter-method for the clipQualityLeft slot.
signature(object = "SFFRead", value = "numeric"):
Setter-method for the clipQualityRight slot.
signature(object = "SFFRead"):
Getter-method for the clipQualityRight slot.
signature(object = "SFFRead", value = "numeric"):
Setter-method for the flowgram slot.
signature(object = "SFFRead"):
Getter-method for the flowgram slot.
signature(object = "SFFRead", value = "numeric"):
Setter-method for the flowIndexes slot.
signature(object = "SFFRead"):
Getter-method for the flowIndexes slot.
signature(object = "SFFRead", value = "character"):
Setter-method for the name slot.
signature(object = "SFFRead"):
Getter-method for the name slot.
signature(object = "SFFRead", value = "BString"):
Setter-method for the quality slot.
signature(object = "SFFRead"):
Getter-method for the quality slot.
Christian Ruckert
showClass("SFFRead")showClass("SFFRead")
plotVariants
This data.frame is part of the vignette example of the plotVariants function. It has the columns
"label", "pos" "mutation" and "color" specifying an annotation for each mutation, its position, the mutation type and an individual color.
The position is given as amino acids / codons.
data(plotVariantsExample)data(plotVariantsExample)
data.frame
data(plotVariantsExample) variantsdata(plotVariantsExample) variants
This function takes an object of class SFFContainer-class and writes its contents into
a file in Roche's Standard Flowgram Format (SFF) with the given filename.
writeSFF(sffContainer, filename)writeSFF(sffContainer, filename)
sffContainer |
An |
filename |
The name of the file to write into. |
Christian Ruckert
file <- system.file("extdata", "SFF", "example.sff", package="R453Plus1Toolbox") sffContainer <- readSFF(file) sffContainer2 <- sffContainer[1:5] ## Not run: writeSFF(sffContainer2, "output.sff")file <- system.file("extdata", "SFF", "example.sff", package="R453Plus1Toolbox") sffContainer <- readSFF(file) sffContainer2 <- sffContainer[1:5] ## Not run: writeSFF(sffContainer2, "output.sff")