| Title: | Annotation for microarrays |
|---|---|
| Description: | Using R enviroments for annotation. |
| Authors: | R. Gentleman |
| Maintainer: | Bioconductor Package Maintainer <[email protected]> |
| License: | Artistic-2.0 |
| Version: | 1.90.0 |
| Built: | 2026-05-29 08:59:27 UTC |
| Source: | https://github.com/bioc/annotate |
Given one or more accession values, this function will attempt to convert them into NCBI UID values.
accessionToUID(...,db=c("genbank","pubmed"))accessionToUID(...,db=c("genbank","pubmed"))
... |
Accession numbers to be transformed. |
db |
Which database this accession number refers to, defaults to Genbank |
Utilizes the PubMed tool esearch.fcgi to convert an accession number into a valid NCBI UID number.
WARNING: The powers that be at NCBI have been known to ban the IP addresses of users who abuse their servers (currently defined as less then 2 seconds between queries). Do NOT put this function in a type loop or you may find your access revoked.
Returns either a valid NCBI UID value or NULL (if there was nothing available).
Jeff Gentry
## The two returns from genbank should be the same xdoc <- genbank("U03397",type="accession",disp="data") x <- accessionToUID("U03397",db="genbank") xdoc <- genbank(x, type="uid",disp="data") ## Can handle multiple inputs y <- accessionToUID("M16653","U892893",db="genbank")## The two returns from genbank should be the same xdoc <- genbank("U03397",type="accession",disp="data") x <- accessionToUID("U03397",db="genbank") xdoc <- genbank(x, type="uid",disp="data") ## Can handle multiple inputs y <- accessionToUID("M16653","U892893",db="genbank")
Given a data package name, ACCNUMStats counts how many of the probe ids are mapped to GenBank Accession numbers, UniGene ids, RefSeq ids, or Image clone ids.
ACCNUMStats(pkgName) whatACC(accs)ACCNUMStats(pkgName) whatACC(accs)
pkgName |
|
accs |
|
The ACCNUM environment of each BioC data package contains mappings between probe ids and a set of public ids based on which mappings of probe ids to other annotation data can be obtained using public data sources. The set of ids were provided by a manufacturer or user at the time when the data package was built. The manufacturer/user provided ids can be of different types of public ids, such as GenBank Accession number, UniGene ids, etc..
ACCNUMStats counts the number of probes that are mapped to different types of public ids and have the results presented in a table.
Jianhua Zhang
The ACCNUM environment of a platform dependent BioC data package
library("hgu95av2.db") ACCNUMStats("hgu95av2")library("hgu95av2.db") ACCNUMStats("hgu95av2")
This function returns the name of the Bioconductor annotation data
package that corresponds to the specified chip or genome. The
type argument is used to request an annotation package with a
particular backing store.
annPkgName(name, type = c("db", "env"))annPkgName(name, type = c("db", "env"))
name |
string specifying the name of the chip or genome. For
example, |
type |
Either |
a string giving the name of the annotation data package
Seth Falcon
annPkgName("hgu133plus2", type="db") annPkgName("hgu133plus2", type="env")annPkgName("hgu133plus2", type="db") annPkgName("hgu133plus2", type="env")
This function returns a character vector of all GO identifiers in the specified ontologies: Biological Process (BP), Cellular Component (CC), Molecular Function (MF).
aqListGOIDs(ont)aqListGOIDs(ont)
ont |
A character vector specifying the two-letter codes of the
ontologies from which all GO IDs will be retrieved. Entries must be
one of |
A character vector of GO IDs. The vector will contain all GO IDs in
the GO ontologies specified by the ont argument.
Seth Falcon
## all GO IDs in BP bp_ids = aqListGOIDs("BP") length(bp_ids) ## all GO IDs in BP or CC bp_or_cc_ids = aqListGOIDs(c("BP", "CC")) length(bp_or_cc_ids)## all GO IDs in BP bp_ids = aqListGOIDs("BP") length(bp_ids) ## all GO IDs in BP or CC bp_or_cc_ids = aqListGOIDs(c("BP", "CC")) length(bp_or_cc_ids)
This function sends a query to NCBI as a string of sequence or an entrez gene ID and then returns a series of MultipleAlignment objects.
blastSequences(x, database, hitListSize, filter, expect, program, timeout=40, as=c("DNAMultipleAlignment", "data.frame", "XML"))blastSequences(x, database, hitListSize, filter, expect, program, timeout=40, as=c("DNAMultipleAlignment", "data.frame", "XML"))
x |
A sequence as a character vector or an integer corresponding to an
entrez gene ID. Submit multiple sequences as a length-1 character
vector, |
database |
Which NCBI database to use. If not “blastn”, then set
|
hitListSize |
Number of hits to keep. |
filter |
Sequence filter; “L” for Low Complexity, “R” for Human Repeats, “m” for Mask lookup |
expect |
The BLAST ‘expect’ value above which matches will be returned. |
program |
Which program do you want to use for blast. |
timeout |
Approximate maximum length of time, in seconds, to wait for a result. |
as |
character(1) indicating whether the result from the NCBI server
should be parsed to a list of |
Right now the function only works for "blastn".
The NCBI URL api used by this function is documented at https://www.ncbi.nlm.nih.gov/blast/Doc/urlapi.html
By default, a series of DNAMultipleAlignment (see
MultipleAlignment-class
objects. Alternatively, a data.frame or XML document returned
from the NCBI server. The data.frame is a ‘long form’
representation of the ‘Iteration’, ‘Hit’ and
‘Hsp’ results returned from the server. The XML document is the
result of the xmlParse function of the XML library, and follows
the format described by
https://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd and
https://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.mod.dtd.
M. Carlson
## x can be an entrez gene ID blastSequences(17702, timeout=40, as="data.frame") if (interactive()) { ## or x can be a sequence blastSequences(x = "GGCCTTCATTTACCCAAAATG") ## hitListSize does not promise that you will get the number of ## matches you want.. It will just try to get that many. blastSequences(x = "GGCCTTCATTTACCCAAAATG", hitListSize="20") }## x can be an entrez gene ID blastSequences(17702, timeout=40, as="data.frame") if (interactive()) { ## or x can be a sequence blastSequences(x = "GGCCTTCATTTACCCAAAATG") ## hitListSize does not promise that you will get the number of ## matches you want.. It will just try to get that many. blastSequences(x = "GGCCTTCATTTACCCAAAATG", hitListSize="20") }
This function will take the name of a data package and build a chromLocation object representing that data set.
buildChromLocation(dataPkg)buildChromLocation(dataPkg)
dataPkg |
The name of the data package to be used |
The requested data set must be available in the user's
.libPaths(), and the function will throw an error if this is
not the case.
If the data package is present, the necessary information will be
extracted from the data package and a chromLocation object will
be created.
A chromLocation object representing the specified data set.
Jeff Gentry
library("hgu95av2.db") z <- buildChromLocation("hgu95av2")library("hgu95av2.db") z <- buildChromLocation("hgu95av2")
This function will take in a XML tree object and will create an instance of a pubMedAbst class. This instance is returned to the caller.
buildPubMedAbst(xml)buildPubMedAbst(xml)
xml |
A XMLTree object that corresponds to a Pubmed abstract. |
This function returns an instantiation of a pubMedAbst object to the caller.
Jeff Gentry
x <- pubmed("9695952","8325638","8422497") a <- xmlRoot(x) numAbst <- length(xmlChildren(a)) absts <- list() for (i in 1:numAbst) { absts[[i]] <- buildPubMedAbst(a[[i]]) }x <- pubmed("9695952","8325638","8422497") a <- xmlRoot(x) numAbst <- length(xmlChildren(a)) absts <- list() for (i in 1:numAbst) { absts[[i]] <- buildPubMedAbst(a[[i]]) }
The chrCats function takes a data package that contains a MAP environment
and returns a list that contains the locations for each gene (from the
chromosome number to more specific locations if they're available). For
example, the hgu95av2MAP environment gives the location, 14q22-q23, for
Affymetrix identifier: 1114_at. This function will return a list with
one named element for 1114_at and the values it will contain are 14,
14q, 14q2, 14q22, and 14q23 since the Affy id is located at each of those
chromosome locations.
chrCats(data) createMAPIncMat(data) createLLChrCats(data)chrCats(data) createMAPIncMat(data) createLLChrCats(data)
data |
the data package (a character string) |
This function does a lot of string manipulation and there are a few known errors so I want to discuss them here in case someone else would like to improve on this function.
The first thing, chrCats, does is only allow one location for each
Affymetrix identifier. If the MAP environment has more than one
location for an Affy id, then the first location is taken. Currently, the
hgu95av2MAP environment has only 9 Affy ids (out of 12625) that have more
than one location and the hgu133aMAP environment has only 16 Affy ids (out
of 22283) that have more than one location so this does not affect many
identifiers.
Next any spaces are removed from each location as several locations have leading spaces.
Then a for loop (which is not efficient!) is used to look at each location
individually and make a list that will be returned. A few particular
strings are looked for in each location and these include '|' and '-'.
Locations that include '|' in the string are split based on the '|' as
though it represents OR. For example, for Affy id, 32273_at, in hgu95av2MAP
the location is given as 5q33|5q31.1 and this function assumes this means
5q33 or 5q31.1 so it will return the values 5, 5q, 5q3, 5q33, 5q31, and
5q31.1 for this Affy id.
The '-' character is assumed to mean BETWEEN. For example, for Affy id,
1138_at, in hgu95av2MAP the location is given as 2q11-q14 and this function
assumes this means the location is somewhere between 2q11 and 2q14 so it
will return the values 2, 2q, 2q1, 2q11, 2q12, 2q13, and 2q14 for this Affy
id.
Now here is the first problem with this function. I do not know how to
handle the '-' when the two strings are not of equal length. For example,
for Affy id, 36779_at, in hgu95av2MAP the location is given as 5q33.3-q34,
but I do not know how to treat this BETWEEN because I do not know how many
sub-bands there are between 5q33.3 and 5q34. Is there a 5q33.4 or 5q33.5,
etc.? I'm not sure. So I treat this '-' as an '|'. This function will
return the values 5, 5q, 5q3, 5q33, 5q33.3, and 5q34 for this Affy id and
most likely, that is incorrect.
Another problem I have with the '-' occurs when all of the characters up
until the last character do not match. For example, for Affy id,
38927_i_at, in hgu95av2MAP the location is given as 11q14-q21, but again
I'm not sure how to treat this BETWEEN because I don't know the number of
sub-bands between 11q14 and 11q21. Does 11q15 exist, etc.? So I again
treat this '-' as an '|'. This function will return the values 11, 11q,
11q1, 11q14, 11q2, and 11q21 for this Affy id and this is probably
incorrect.
The problem with '-' also occurs when the location is something like
19cen-q13.1 for Affy id, 34670_at, in hgu95av2MAP. Again I don't know the
number of sub-bands between 19cen and 19q13.1 so I treat this BETWEEN as an
OR.
Another problem I have with 'cen' in the location is that sometimes the
location looks like: 19p13.2-cen and very rarely it looks like:
5p13.1-5cen. In the second case, the chromosome number is included after
the '-' and before the 'cen'. This only occurs with the location
5p13.1-5cen in both hgu95av2MAP and hgu133aMAP and all other locations do
not include the chromosome number after the '-'. Currently this function
returns the wrong information for that one location. It will return the
values 5, 5p, 5p1, 5p13, 5p13.1, 5p5,and 5p5cen, but it should return 5, 5p,
5p1, 5p13, 5p13.1, and 5cen so this one location is an error. All other
locations that include 'cen' are correct. For example, this function
returns the values 19, 19p, 19p1, 19p13, 19p13.2, and 19cen for the location
19p13.2-cen.
This function is very slow because it contains for loops and thus, it would
be useful to make it more efficient. Also, it would be nice at some point
for someone with more knowledge on chromosome location figure out how to
improve some of my string manipulation errors.
createLLChrCats is a wrapper that converts probe IDs to Entrez
Gene IDs.
createMAPIncMat is a wrapper that calls createLLChrCats
and then returns an incidence matrix with rows being the categories
and cols the Entrez Gene IDs.
A named list with an element for each Affy id. The name will be the Affy id
and the values will be the locations for that Affy id. If the Affy id had a
location of NA in the MAP environment, then a list element is not returned
for that Affy id.
Elizabeth Whalen
library("hgu95av2.db") mapValues <- chrCats("hgu95av2")library("hgu95av2.db") mapValues <- chrCats("hgu95av2")
This class provides chromosomal information provided by a Bioconductor metadata package. By creating the object once for a particular package, it can be used in a variety of locations without the need to recomputed values repeatedly.
new('chromLocation',
organism = ...., # Object of class character dataSource = ...., # Object of class character chromLocs = ...., # Object of class list probesToChrom = ...., # Object of class ANY chromInfo = ...., # Object of class numeric geneSymbols = ...., # Object of class ANY )
organism:Object of class "character". The organism that these genes correspond to.
dataSource:Object of class "character". The source of the gene data.
chromLocs:Object of class "list". A list which provides specific location information for every gene.
probesToChrom:An object with an environment-like API which will translate a probe identifier to chromosome it belongs to.
chromInfo:A numerical vector representing each chromosome, where the names are the names of the chromosomes and the values are their lengths
geneSymbols:An environment or an object with environment-like API that maps a probe ID to the appropriate gene symbol
(chromLocation): Gets the lengths of the chromosome for this organism
(chromLocation): Gets the 'chromLocs' attribute.
(chromLocation): Gets the name of the chromosomes for this organism
(chromLocation): Gets the 'dataSource' attribute.
(chromLocation): Gets the 'probesToChrom' attribute.
(chromLocation): gets the number of chromosomes this organism has
(chromLocation): gets the 'organism' attribute.
Gets the 'chromInfo' attribute.
Gets the 'geneSymbols' attribute.
library("hgu95av2.db") z <- buildChromLocation("hgu95av2") ## find the number of chromosomes nChrom(z) ## Find the names of the chromosomes chromNames(z) ## get the organism this object refers to organism(z) ## get the lengths of the chromosomes in this object chromLengths(z)library("hgu95av2.db") z <- buildChromLocation("hgu95av2") ## find the number of chromosomes nChrom(z) ## Find the names of the chromosomes chromNames(z) ## get the organism this object refers to organism(z) ## get the lengths of the chromosomes in this object chromLengths(z)
This function takes the names of installed R packages and then checks to see if they all have the same version number.
compatibleVersions(...)compatibleVersions(...)
... |
|
If all the package have the same version number, the function returns TRUE. Otherwise, the function returns FALSE
This function returns TRUE or FALSE depending on whether the packages have the same version number
Jianhua Zhang
library("hgu95av2.db") library("GO.db") compatibleVersions("hgu95av2.db", "GO.db")library("hgu95av2.db") library("GO.db") compatibleVersions("hgu95av2.db", "GO.db")
Genes are mapped to GO terms on the basis of evidence codes. In some analyses it will be appropriate to drop certain sets of annotations based on specific evidence codes.
dropECode(inlist, code="IEA")dropECode(inlist, code="IEA")
inlist |
A list of GO data |
code |
The set of codes that should be dropped. |
A simple use of lapply and sapply to find
and eliminate those terms that have the specified evidence codes.
This might be used when one is using to GO to validate a sequence matching experiment (for example), then all terms whose mapping was based on sequence similarity (say ISS and IEA) should be removed.
A list of the same length as the input list retaining only those
annotations whose evidence codes were not the ones in the exclusion
set code.
R. Gentleman
library("hgu95av2.db") bb <- hgu95av2GO[["39613_at"]] getEvidence(bb[1:3]) cc <- dropECode(bb[1:3]) if (length(cc)) getEvidence(cc)library("hgu95av2.db") bb <- hgu95av2GO[["39613_at"]] getEvidence(bb[1:3]) cc <- dropECode(bb[1:3]) if (length(cc)) getEvidence(cc)
Given a set of UniGene identifiers this function creates a set of URLs that an be used to either open a browser to the requested location or that can be used as anchors in the construction of HTML output.
entrezGeneByID(query)entrezGeneByID(query)
query |
Entrez Gene identifiers. |
Using NCBI we construct appropriate strings for directing a web browser to the Entrez Genes specified by their IDs.
A character vector containing the query string.
Be very careful about automatically querying this resource. It is considered antisocial behavior by the owners.
Marc Carlson
NCBI, https://www.ncbi.nih.gov/
q1<-entrezGeneByID(c("100", "1002")) q1 if( interactive()) browseURL(q1[1])q1<-entrezGeneByID(c("100", "1002")) q1 if( interactive()) browseURL(q1[1])
Given a set of search terms this function creates a set of URLs that an be used to either open a browser to the requested location or that can be used as anchors in the construction of HTML output.
entrezGeneQuery(query)entrezGeneQuery(query)
query |
The UniGene identifiers. |
Using NCBI we construct an appropriate string for directing a web browser to information about genes of that type at NCBI.
A character vector containing the query string.
Be very careful about automatically querying this resource. It is considered antisocial behavior by the owners.
Marc Carlson
NCBI, https://www.ncbi.nih.gov/
q1<-entrezGeneQuery(c("leukemia", "Homo sapiens")) q1 if( interactive()) browseURL(q1[1])q1<-entrezGeneQuery(c("leukemia", "Homo sapiens")) q1 if( interactive()) browseURL(q1[1])
Given a character vector containing GO identifiers, return a logical vector indicating which GO IDs are in the specified ontology (BP, CC, or MF).
filterGOByOntology(goids, ontology = c("BP", "CC", "MF"))filterGOByOntology(goids, ontology = c("BP", "CC", "MF"))
goids |
a character vector of GO IDs |
ontology |
One of "BP", "CC", or "MF" |
A logical vector with length equal to goids. A TRUE
indicates that the corresponding GO ID in goids is a member
of the ontology specified by ontology.
Seth Falcon
haveGO <- suppressWarnings(require("GO.db")) if (haveGO) { ids <- c("GO:0001838", "GO:0001839") stopifnot(all(filterGOByOntology(ids, "BP"))) stopifnot(!any(filterGOByOntology(ids, "MF"))) } else cat("Sorry, this example requires the GO package\n")haveGO <- suppressWarnings(require("GO.db")) if (haveGO) { ids <- c("GO:0001838", "GO:0001839") stopifnot(all(filterGOByOntology(ids, "BP"))) stopifnot(!any(filterGOByOntology(ids, "MF"))) } else cat("Sorry, this example requires the GO package\n")
Give a data package with mappings between Entrez Gene IDs and their locations on chromosomes, this function locates genes that are within a defined range on a given chromosome. If a Entrez Gene ID is passed as one of the arguments, genes located will be neighbors to the gene represented by the Entrez Gene ID within a defined range on the chromosome the target gene resides
findNeighbors(chrLoc, llID, chromosome, upBase, downBase, mergeOrNot = TRUE) checkArgs(llID, chromosome, upBase, downBase) findChr4LL(llID, chrEnv, organism) getValidChr(organism) getBoundary(loc, base, lower = TRUE) weightByConfi(foundLLs)findNeighbors(chrLoc, llID, chromosome, upBase, downBase, mergeOrNot = TRUE) checkArgs(llID, chromosome, upBase, downBase) findChr4LL(llID, chrEnv, organism) getValidChr(organism) getBoundary(loc, base, lower = TRUE) weightByConfi(foundLLs)
chrLoc |
|
llID |
|
chromosome |
|
upBase |
|
downBase |
|
organism |
|
chrEnv |
|
loc |
|
base |
|
lower |
|
mergeOrNot |
|
foundLLs |
|
A chrLoc data package can be created using function chrLocPkgBuilder of AnnBuilder, in which Entrez Gene IDs are mapped to location data on individual chromosomes.
Genes are considered to be neighbors to a given target gene or within a given range when the transcription of genes start and end within the given range.
findNeighbors, checkArgs, findChr4LL, getValidChr, and getBoundary are accessory functions called by findNeighbors and may not have real values outside.
The function returns a list of named vectors. The length of the list is one when genes in a given region are sought but varies depending on whether a given gene can be mapped to one or more chromosomes when neighboring genes of a target gene are sought. Names of vector can be "Confident" when a gene can be confidently placed on a chromosome or "Unconfident" when a gene can be placed on a chromosome but its exact location can not be determined with great confidence.
Jianhua Zhang
http://www.genome.ucsc.edu/goldenPath/
if(require("humanCHRLOC")){ findNeighbors("humanCHRLOC", "51806", 10, upBase = 600000, downBase = 600000) }else{ print("Can not find neighbors without the required data package") }if(require("humanCHRLOC")){ findNeighbors("humanCHRLOC", "51806", 10, upBase = 600000, downBase = 600000) }else{ print("Can not find neighbors without the required data package") }
Given a vector of Genbank accession numbers or NCBI UIDs, the user can either have a browser display a URL showing a Genbank query for those identifiers, or a XMLdoc object with the same data.
genbank(...,disp=c("data","browser"), type=c("accession","uid"), pmaddress=.efetch("gene", disp, type))genbank(...,disp=c("data","browser"), type=c("accession","uid"), pmaddress=.efetch("gene", disp, type))
... |
Vectorized set of Genbank accession numbers or NCBI UIDs |
disp |
Either "Data" or "Browser" (default is data). Data returns a XMLDoc, while Browser will display information in the user's browser. |
type |
Denotes whether the arguments are accession numbers or UIDS. Defaults to accession values. |
pmaddress |
Specific path to the pubmed efetch engine from the NCBI website. |
A simple function to retrieve Genbank data given a specific ID, either through XML or through a web browser. This function will accept either Genbank accession numbers or NCBI UIDs (defined as a Pubmed ID or a Medline ID) - although the types must not be mixed in a single call.
WARNING: The powers that be at NCBI have been known to ban the IP addresses of users who abuse their servers (currently defined as less then 2 seconds between queries). Do NOT put this function in a tight loop or you may find your access revoked.
If the option "data" is used, an object of type XMLDoc is returned, unless there was an error with the query in which case an object of type try-error is returned.
If the option "browser" is used, nothing is returned.
R. Gentleman
## Use UIDs to get data in both browser & data forms if ( interactive() ) { disp <- c("data","browser") } else { disp <- "data" } for (dp in disp) genbank("12345","9997",disp=dp,type="uid") ## Use accession numbers to retrieve browser info if ( interactive() ) genbank("U03397","AF030427",disp="browser")## Use UIDs to get data in both browser & data forms if ( interactive() ) { disp <- c("data","browser") } else { disp <- "data" } for (dp in disp) genbank("12345","9997",disp=dp,type="uid") ## Use accession numbers to retrieve browser info if ( interactive() ) genbank("U03397","AF030427",disp="browser")
This function retrieves a map object from an annotation data package. It is intended to serve as a common interface for obtaining map objects from both SQLite-based and environment-based annotation data packages.
getAnnMap(map, chip, load = TRUE, type = c("db", "env"))getAnnMap(map, chip, load = TRUE, type = c("db", "env"))
map |
a string specifying the name of the map to retrieve. For
example, |
chip |
a string describing the chip or genome |
load |
a logical value. When |
type |
a character vector of one or more annotation data
package types. The currently supported types are |
getAnnMap uses the search path (see search) to find an
appropriate annotation data package; when called with
chip="hgu95av2", the function will use the first hgu95av2
package on the search path whether it be db or environment-based. If
load=TRUE and no suitable package is found on the search path,
then the function will attempt to load an appropriate package. The
type argument is used to determine which type of package (db or
env) is loaded first.
If type is "db", an S4 object representing the
requested map. If type is "env", an R
environment object representing the requested map.
Seth Falcon
map <- getAnnMap("ENTREZID", "hgu95av2", load=TRUE, type=c("env", "db")) class(map)map <- getAnnMap("ENTREZID", "hgu95av2", load=TRUE, type=c("env", "db")) class(map)
For each mapping of a gene to a GO term there are a set of evidence codes that are used. Genes can be mapped using one, or more evidence codes and this function obtains the evidence codes for all genes provided in the input list.
getEvidence(inlist)getEvidence(inlist)
inlist |
A list of GO identifers. |
A list of the same length as the input list, each element is a
vector of evidence codes.
R. Gentleman
library("hgu95av2.db") bb <- hgu95av2GO[["39613_at"]] getEvidence(bb)library("hgu95av2.db") bb <- hgu95av2GO[["39613_at"]] getEvidence(bb)
These functions provide access to data in the GO package. The data are assembled from publically available data from the Gene Ontology Consortium (GO), www.go.org. Given a list of GO identifiers they access the children (more specific terms), the parents (less specific terms) and the terms themselves.
getGOTerm(x) getGOParents(x) getGOChildren(x) getGOOntology(x)getGOTerm(x) getGOParents(x) getGOChildren(x) getGOOntology(x)
x |
A character vector of valid GO identifiers. |
GO consists of three (soon to be more) specific hierarchies: Molecular Function (MF), Biological Process (BP) and Cellular Component (CC). For more details consult the GO website. For each GO identifier each of these three hierarchies is searched and depending on the function called the appropriate values are obtained and returned.
It is possible for a GO identifier to have no children or for it to have no parents. However, it must have a term associated with it.
A list of the same length as x.
The list contains one entry for each element of x. That entry
is itself a list. With one component named Ontology which
has as its value one of MF, BP or CC. The second component has the
same name as the suffix of the call, i.e. Children, Parents, or Term.
If there was no match in any of the ontologies then a length zero list
is returned for that element of x.
For getGOOntology a vector of categories (the names of which
are the original GO term names). Elements of this list that are
NA indicate term names for which there is no category (and
hence they are not really term names).
R. Gentleman
The Gene Ontology Consortium
library("GO.db") sG <- sample(keys(GO.db, "GOID"), 8) gT <- getGOTerm(sG) gP <- getGOParents(sG) gC <- getGOChildren(sG) gcat <- getGOOntology(sG)library("GO.db") sG <- sample(keys(GO.db, "GOID"), 8) gT <- getGOTerm(sG) gP <- getGOParents(sG) gC <- getGOChildren(sG) gcat <- getGOOntology(sG)
Find the subset of GO terms for the specified ontology, for each element of the supplied list of associations. The input list is typically from one of the chip-specific meta-data files.
getOntology(inlist, ontology=c("MF", "BP", "CC"))getOntology(inlist, ontology=c("MF", "BP", "CC"))
inlist |
A list of GO associations |
ontology |
The name of the ontology you want returned. |
The input list should be a list of lists, each element of inlist
is itself a list containing the information that maps from a specified
ID (usually LocusLink) to GO information. Each element of the inner list
is a list with elements GOID, Ontology and Evidence.
A list of the same length as the input list. Each element of this
list will contain a vector of GOIDs for those terms that match
the requested ontology.
R. Gentleman
library("hgu95av2.db") bb <- hgu95av2GO[["39613_at"]] getOntology(bb) sapply(bb, function(x) x$Ontology)library("hgu95av2.db") bb <- hgu95av2GO[["39613_at"]] getOntology(bb) sapply(bb, function(x) x$Ontology)
extract publication details and abstract from annotate::pubmed function output
getPMInfo(x)getPMInfo(x)
x |
an object of class xmlDocument; assumed to be result of a pubmed() call |
uses xmlDOMApply to extract and structure key features of the XML tree returned by annotate::pubmed()
a list with one element per pubmed id processed by pubmed. Each element of the list is in turn a list with elements for author list, title, journal info, and abstract text.
this should be turned into a method returning an instance of a formal class representing articles.
Vince Carey <[email protected]>
demo <- pubmed("11780146", "11886385", "11884611") getPMInfo(demo)demo <- pubmed("11780146", "11886385", "11884611") getPMInfo(demo)
Given a vector of ids, the functions will create a vector of
hypertext links to a defined public repositories such as
LocusLink, UniGene .... The linkages can be placed in a html file
constructed by htmlpage.
getQueryLink(ids, repository = "ug", ...) getTDRows(ids, repository = "ug", ...) getCells(ids, repository = "ug", ...) getQuery4UG(ids, ...) getQuery4SP(ids, ...) getQuery4GB(ids, ...) getQuery4OMIM(ids, ...) getQuery4Affy(ids, ...) getQuery4FB(ids, ...) getQuery4EN(ids, ...) getQuery4TR(ids, ...) getQuery4ENSEMBL(ids, ...)getQueryLink(ids, repository = "ug", ...) getTDRows(ids, repository = "ug", ...) getCells(ids, repository = "ug", ...) getQuery4UG(ids, ...) getQuery4SP(ids, ...) getQuery4GB(ids, ...) getQuery4OMIM(ids, ...) getQuery4Affy(ids, ...) getQuery4FB(ids, ...) getQuery4EN(ids, ...) getQuery4TR(ids, ...) getQuery4ENSEMBL(ids, ...)
ids |
A character vector of ids, or alternatively, a list containing character vectors of ids. These will be used to construct hypertext links. A list should be used in cases where there are multiple ids per gene. |
repository |
A character string for the name of a public repository. Valid values include "ll", "ug", "gb", "sp", "omim", "affy", "en", and "fb". See the details section for more information. |
... |
Allows end user to pass additional arguments. See details
for |
getQuery4GB constructs hypertext links to GenBank using the
provided ids.
getQuery4UG constructs hypertext links to UniGene using the
provided ids.
getQuery4Affy constructs hypertext links to Affymetrix using the
provided ids.
getQuery4SP constructs hypertext links to SwissProt using the
provided ids.
getQuery4OMIM constructs hypertext links to OMIM using the
provided ids.
getQuery4FB constructs hypertext links to FlyBase using
the provided ids.
getQuery4EN constructs hypertext links to EntrezGene
using the provided ids.
getQuery4TR constructs hypertext links to TAIR using the
provided ids.
getQuery4ENSEMBL constructs hypertext links to Ensembl
using the provided ids. An additional 'species' argument must be passed
to this function via the ... argument to htmlpage. The
form of the argument must be e.g., species="Homo_sapiens" for
human. Note the capitalized genus and underscore (_) separator.
getQueryLink directs calls to construct hypertext links using
the provided ids.
getTDRows constructs each row of the resulting table.
getCells constructs each cell of the resulting table.
Note that some of these functions (getQuery4OMIM,
getQuery4UG, getQuery4FB) attempt to
return empty cells for ids that don't make sense, rather than broken
links. For the other getQuery4XX functions, the end user must replace
all nonsense ids with " " in order to have an empty cell.
Also note that creating additional links is quite simple. First, define
a new 'getQuery4XX()' function modeled on the existing functions, then
add this function to the getQueryLink function.
Returns a vector of character strings representing the hypertext links.
Jianhua Zhang <[email protected]> with further modifications by James W. MacDonald <[email protected]>
Given a GenBank Accession number, getSEQ queries the NCBI database for the nucleotide sequence.
getGI(accNum) getSEQ(gi)getGI(accNum) getSEQ(gi)
accNum |
|
gi |
|
The NCBI database is queried for the given GenBank Accession number to obtain the nucleotide sequence in FASTA format. The leading identification line of the sequence data is then dropped to return only the nucleotide sequence.
getGI returns the gi number corresponding to a given GenBank accession number.
getSEQ returns a character string of nucleotide sequence
Jianhua Zhang
https://www.ncbi.nlm.nih.gov/entrez/query.fcgi
getSEQ("M22490")getSEQ("M22490")
The functions documented here are intended to make it easier to map from a set of manufacturers identifiers (such as you will get from the chips etc) to other identifiers.
getSYMBOL(x, data) getEG(x, data) getGO(x, data) getPMID(x, data) getGOdesc(x, which) lookUp(x, data, what, load = FALSE) getUniqAnnItem()getSYMBOL(x, data) getEG(x, data) getGO(x, data) getPMID(x, data) getGOdesc(x, which) lookUp(x, data, what, load = FALSE) getUniqAnnItem()
x |
The identifiers to be mapped (usually manufacturer) |
data |
The basename of the meta-data package to be used. |
what |
|
which |
|
load |
A logical value indicating whether to attempt to load the required annotation data package if it isn't already loaded. |
Users must supply the basename of the meta-data package that they want to use to provide the mappings. The name of the meta-data package is the same as the basename.
Appropriate translations are done. In some cases such as getEG
and getSYMBOL there will only be one match and a vector is
returned. In other cases such as getPMID and getGO there
may be multiple matches and a list is returned.
For getGOdesc x contains GO identifiers (not
manufacturer identifiers) and the output is a list of GOTerms objects,
if which specifies some subset of the ontologies (MF, BP or CC)
then only terms for that ontology are retained.
lookUp is a general function that can be used to look
up matches. All other translation functions use lookUp
A BioC annotation data package contains annotation data environments
whose names are package name (e. g. hgu95av2) + element name
(e. g. PMID). what must be one of the element names for the
given data package.
getUniqAnnItem keeps track of the annotation elements that have
one to one mappings.
Either a vector or a list depending on whether multiple values per input are possible.
R. Gentleman
library("hgu95av2.db") library("GO.db") data(sample.ExpressionSet) gN <- featureNames(sample.ExpressionSet)[100:105] lookUp(gN, "hgu95av2", "SYMBOL") # Same as lookUp for SYMBOL except the return is a vector getSYMBOL(gN,"hgu95av2" ) gg <- getGO(gN, "hgu95av2") lookUp(gg[[2]][[1]][["GOID"]], "GO", "TERM") # Same as lookUp for TERM getGOdesc(gg[[2]][[1]][["GOID"]], "ANY") # For BP only getGOdesc(gg[[2]][[1]][["GOID"]], "BP") getEG(gN, "hgu95av2") getPMID(gN, "hgu95av2")library("hgu95av2.db") library("GO.db") data(sample.ExpressionSet) gN <- featureNames(sample.ExpressionSet)[100:105] lookUp(gN, "hgu95av2", "SYMBOL") # Same as lookUp for SYMBOL except the return is a vector getSYMBOL(gN,"hgu95av2" ) gg <- getGO(gN, "hgu95av2") lookUp(gg[[2]][[1]][["GOID"]], "GO", "TERM") # Same as lookUp for TERM getGOdesc(gg[[2]][[1]][["GOID"]], "ANY") # For BP only getGOdesc(gg[[2]][[1]][["GOID"]], "BP") getEG(gN, "hgu95av2") getPMID(gN, "hgu95av2")
For a given GO category or KEGG pathway, all probes in the supplied data are mapped to the pathway and a heatmap is produced.
GO2heatmap(x, eset, data, ...) KEGG2heatmap(x, eset, data, ...)GO2heatmap(x, eset, data, ...) KEGG2heatmap(x, eset, data, ...)
x |
The name of the category or pathway. |
eset |
An |
data |
The name of the chip. |
... |
Additional parameters to pass to |
For the given pathway or GO category all matching probes are
determined, these are used to subset the data and heatmap is
invoked on that set of data. Extra parameters can be passed through to
heatmap using the ... parameter.
The annotation slot of the eset argument is used to
determine the appropriate annotation data to use.
The value returned by heatmap is passed back to the user.
R. Gentleman
library("hgu95av2.db") data(sample.ExpressionSet) KEGG2heatmap("04810", sample.ExpressionSet, "hgu95av2")library("hgu95av2.db") data(sample.ExpressionSet) KEGG2heatmap("04810", sample.ExpressionSet, "hgu95av2")
For a two sample comparison, as determined by group, and a
specified KEGG pathway or GO category, per group means are computed
and plotted against each other.
GOmnplot(x, eset, data = "hgu133plus2", group, ...) KEGGmnplot(x, eset, data = "hgu133plus2", group, ...)GOmnplot(x, eset, data = "hgu133plus2", group, ...) KEGGmnplot(x, eset, data = "hgu133plus2", group, ...)
x |
The name of the KEGG pathway or GO category. |
eset |
An |
data |
The name of the chip that was used to provide the data. |
group |
The variable indicating group membership, should have two different values. |
... |
Extra parameters to pass to the call to |
All probes in eset that map to the given category are
determined. Then per group, per probe means are computed and plotted
against each other. Extra parameters can be passed to the plot
function via the dots argument.
The matrix of per group means, for each probe.
R. Gentleman
library("hgu95av2.db") data(sample.ExpressionSet) KEGGmnplot("04810", sample.ExpressionSet, sample.ExpressionSet$sex, data = "hgu95av2")library("hgu95av2.db") data(sample.ExpressionSet) KEGGmnplot("04810", sample.ExpressionSet, sample.ExpressionSet$sex, data = "hgu95av2")
Given a GO term, or a vector of GO terms and an ontology this function determines which of the terms have GO annotation in the specified ontology.
hasGOannote(x, which="MF")hasGOannote(x, which="MF")
x |
A character vector, an instance of the |
which |
One of "MF", "BP" or "CC" |
The available GO annotation is searched and a determination of whether a specific GO identifier has a value in the specified ontology is made.
A logical vector of the same length as x.
R. Gentleman
library("GO.db") t1 <- "GO:0003680" hasGOannote(t1) hasGOannote(t1, "BP")library("GO.db") t1 <- "GO:0003680" hasGOannote(t1) hasGOannote(t1, "BP")
The data is described above.
data(hgByChroms)data(hgByChroms)
A list, with the names consisting of the names of the chromosomes in the human genome (thus 24 elements). Each element consists of a named vector of +/- values - where each value represents the location of a base pair (the numeric value is the location, while the +/- denotes the strand value), with the name providing the name of the base pair.
Cheng Li of the Dana-Farber Cancer Institute.
data(hgByChroms)data(hgByChroms)
The data is described above.
data(hgCLengths)data(hgCLengths)
A vector containing 24 values, each corresponding to the total chromosome length.
UCSC Human Genome Project
data(hgCLengths)data(hgCLengths)
Data, in the form of environments for the Affymetrix U95A chip.
data(hgu95Achroloc)data(hgu95Achroloc)
These data sets provide environments with mappings from the Affymetrix
identifiers to chromosomal location, in bases.
The environments function like hashtables and can be accessed using
mget.
If the returned value is NA then the current
mapping was unable to identify this. Mappings and data sources are
constantly evolving so updating often is recommended.
The AnnBuilder package.
data(hgu95Achroloc) data(sample.ExpressionSet) mget(featureNames(sample.ExpressionSet)[330:340], env=hgu95Achroloc, ifnotfound=NA)data(hgu95Achroloc) data(sample.ExpressionSet) mget(featureNames(sample.ExpressionSet)[330:340], env=hgu95Achroloc, ifnotfound=NA)
Data, in the form of environments for the Affymetrix U95A chip.
data(hgu95Achrom)data(hgu95Achrom)
This data set provides an environment (treat as a hashtable)
with mappings from the Affymetrix
identifiers to chromosome number/name.
The environment functions like a hashtable and can be accessed using
mget.
If the returned value is NA then the current
mapping was unable to identify this. Mappings and data sources are
constantly evolving so updating often is recommended.
The AnnBuilder package.
data(hgu95Achrom) data(sample.ExpressionSet) mget(featureNames(sample.ExpressionSet)[330:340], env=hgu95Achrom, ifnotfound=NA)data(hgu95Achrom) data(sample.ExpressionSet) mget(featureNames(sample.ExpressionSet)[330:340], env=hgu95Achrom, ifnotfound=NA)
Data, in the form of environments for the Affymetrix U95A chip.
data(hgu95All)data(hgu95All)
These data sets provide environments with mappings from the Affymetrix
identifiers to Entrez Gene identifiers.
The environment functions like a hashtable and can be accessed using
mget.
If the returned value is NA then the current
mapping was unable to identify this. Mappings and data sources are
constantly evolving so updating often is recommended.
The AnnBuilder package.
data(hgu95All) data(sample.ExpressionSet) mget(featureNames(sample.ExpressionSet)[330:340], env=hgu95All, ifnotfound=NA)data(hgu95All) data(sample.ExpressionSet) mget(featureNames(sample.ExpressionSet)[330:340], env=hgu95All, ifnotfound=NA)
gives chromosome locations for Affy U95 probes
species:Object of class character, value: 'Human'
datSource:Object of class character, value
nChrom:Object of class numeric, value: 24
chromNames:Object of class character, value: 1:22, X,Y
chromLocs:Object of class list, value: long: sense and antisense locations associated with affy identifiers
chromLengths:Object of class numeric,
geneToChrom:Object of class environment
class:Object of class character, value: 'chromLocation'
Data, in the form of environments for the Affymetrix U95A chip.
data(hgu95Asym)data(hgu95Asym)
This data set provides an environment with mappings from the Affymetrix
identifiers to gene symbol.
The environment functions like a hashtables and can be accessed using
mget.
If the returned value is NA then the current
mapping was unable to identify this. Mappings and data sources are
constantly evolving so updating often is recommended.
The AnnBuilder package.
data(hgu95Asym) data(sample.ExpressionSet) mget(featureNames(sample.ExpressionSet)[330:340], env=hgu95Asym, ifnotfound=NA)data(hgu95Asym) data(sample.ExpressionSet) mget(featureNames(sample.ExpressionSet)[330:340], env=hgu95Asym, ifnotfound=NA)
A class to present data for HomologGene data of a matching sequence
Objects can be created by calls of the form new("homoData", ...).
homoOrg:Object of class "character" the
scientific name of the organism of interest
homoLL:Object of class "numeric" the LocusLink
id of the gene of interest
homoType:Object of class "character" the type of
similarity. Valid values include B - a recipiprocal best best
between 3 or more organisms, b - a reciprocal best match, and c -
a curated homology relationship
homoPS:Object of class "numeric" percent
similarity value
homoURL:Object of class "character" the URL for
curated homology relationship
homoACC:Object of class "character" the
accession number
homoHGID:Object of class "numeric" the
internal HomologGeneID
signature(object = "homoData"): the get function for
slot homoPS
signature(object = "homoData"): the get function
for slot homoLL
signature(object = "homoData"): the get function
for slot homoOrg
signature(object = "homoData"): the get function
for slot homoType
signature(object = "homoData"): the get function
for slot homoURL
signature(object = "homoData"): the get function
for slot homoACC
signature(object = "homoHGID"): the get
function for slot homoHGID
Jianhua Zhang
ftp://ftp.ncbi.nih.gov/pub/HomoloGene/README
new("homoData", homoPS = 82.3, homoLL = 2324853, homoOrg = "Homo sapins", homoType = "B", homoURL = "", homoHGID = 12345)new("homoData", homoPS = 82.3, homoLL = 2324853, homoOrg = "Homo sapins", homoType = "B", homoURL = "", homoHGID = 12345)
This function is designed to create an HTML table containing both static information as well as links to various online annotation sources.
htmlpage(genelist, filename, title, othernames, table.head, table.center = TRUE, repository = list("en"), ...)htmlpage(genelist, filename, title, othernames, table.head, table.center = TRUE, repository = list("en"), ...)
genelist |
A list or |
filename |
A filename for the resultant HTML table. |
title |
A title for the table. |
othernames |
A list or |
table.head |
A character vector of column headers for the table. |
table.center |
Center the table? Defaults to |
repository |
A list of repositories to use
for creating the hypertext links. Currently available repositories
include 'gb' (GenBank), 'en' (EntrezGene), 'omim' (Online Mendelian
Inheritance in Man), 'sp' (SwissProt), 'affy' (Affymetrix), 'ug'
(UniGene), 'fb' (FlyBase), 'go' (Gene Ontology), 'ens' (Ensembl).
Additional repositories can easily be added. See
|
... |
Further arguments to be passed. See details for more information. |
This function will accept a list or data.frame of
character vectors, each containing different ids that are to be turned
into hyperlinks (e.g., a list containing affy ids, genbank accession
numbers, and Entrez Gene ids). For instances where there are more than
one id per gene, use a sub-list of character vectors. See the vignette
'HowTo: Get HTML Output' for more information. Othernames should be a
list or data.frame. Again, if there are multiple entries for a
given gene, use a sub-list. This is more easily explained using an
example - please see the examples section below and the above
mentioned vignette.
In even the simplest case the genelist, othernames and repository have to be lists. A simple character vector will not suffice.
Note that this function now uses xtable to create the HTML
table, and there is the ability to pass some arguments on to either
xtable or print.xtable. One such argument would be
'append=TRUE', which would allow one to put lots of tables in one
page, as long as the filename argument remained the same.
Additionally, the Ensembl repository needs a species argument in order
to form a usable URI. This argument can be passed in the form of e.g.,
species = "Homo_sapiens". Note the capitalization of the genus, and
the separation by an underscore (_).
This function is used only for the side effect of creating an HTML table.
Robert Gentleman <[email protected]>, further modifications by James W. MacDonald <[email protected]>
## A very simple example. Two columns, one with links, the other without. gos <- paste("GO:000000", 1:9, sep="") notlinks <- LETTERS[1:9] htmlpage(list(gos), "simple.html", "Two column data", list(notlinks), c("GO IDs", "Letters"), repository = list("go")) if(!interactive()) file.remove("simple.html") ## A more complex example with multiple links per cell ## first we create data to annotate unigene <- list("Hs.600536",c("Hs.596913","HS.655491"),"Hs.76704") refseq <- list(c("NM_001030050", "NM_001030047", "NM_001648", "NM_001030049"), "NM_000860", c("NM_001011645", "NM_000044")) entrez <- c("354", "3248", "367") genelist <- list(unigene, refseq, entrez) ## now some other data symb <- c("KLK3","HPGD","AR") desc <- c("Prostate-specific antigen precursor", "15-hydroxyprostaglandin dehydrogenase", "Androgen receptor") t.stat <- c(40.21, -22.14, 21.56) p.value <- rep(0,3) fold.change <- c(3.54, -2.35, 3.18) expression <- matrix(c(11.78, 11.69, 11.62, 8.17, 5.78, 5.58, 5.68, 8.26, 9.08, 9.28, 9.19, 6.05), ncol=4, byrow=TRUE) otherdata <- list(symb, desc, t.stat, p.value, fold.change, expression) table.head <- c("UniGene", "RefSeq", "EntrezGene", "Symbol", "Description", "t-stat", "p-value", "fold change", paste("Sample", 1:4)) htmlpage(genelist, "test.html", "Some gene expression data", otherdata, table.head, repository = list("ug","gb","en")) if(!interactive()) file.remove("test.html")## A very simple example. Two columns, one with links, the other without. gos <- paste("GO:000000", 1:9, sep="") notlinks <- LETTERS[1:9] htmlpage(list(gos), "simple.html", "Two column data", list(notlinks), c("GO IDs", "Letters"), repository = list("go")) if(!interactive()) file.remove("simple.html") ## A more complex example with multiple links per cell ## first we create data to annotate unigene <- list("Hs.600536",c("Hs.596913","HS.655491"),"Hs.76704") refseq <- list(c("NM_001030050", "NM_001030047", "NM_001648", "NM_001030049"), "NM_000860", c("NM_001011645", "NM_000044")) entrez <- c("354", "3248", "367") genelist <- list(unigene, refseq, entrez) ## now some other data symb <- c("KLK3","HPGD","AR") desc <- c("Prostate-specific antigen precursor", "15-hydroxyprostaglandin dehydrogenase", "Androgen receptor") t.stat <- c(40.21, -22.14, 21.56) p.value <- rep(0,3) fold.change <- c(3.54, -2.35, 3.18) expression <- matrix(c(11.78, 11.69, 11.62, 8.17, 5.78, 5.58, 5.68, 8.26, 9.08, 9.28, 9.19, 6.05), ncol=4, byrow=TRUE) otherdata <- list(symb, desc, t.stat, p.value, fold.change, expression) table.head <- c("UniGene", "RefSeq", "EntrezGene", "Symbol", "Description", "t-stat", "p-value", "fold change", paste("Sample", 1:4)) htmlpage(genelist, "test.html", "Some gene expression data", otherdata, table.head, repository = list("ug","gb","en")) if(!interactive()) file.remove("test.html")
Class HTMLPage and FramedHTMLPage are a pair
of experimental classes used to explore concepts of representing HTML
pages using S4 objects.
fileName:Object of class "character" The
filename of the HTML page
pageText:Object of class "character" The text
of the HTML page
pageTitle:Object of class "character" The
title of the HTML page
topPage:Object of class "HTMLPage" The header
page for a FramedHTMLPage
sidePage:Object of class "HTMLPage" The side
index page for a FramedHTMLPage
mainPage:Object of class "HTMLPage" The
primary page for a FramedHTMLPage
signature(object = "HTMLPage"): Describes
information about the page
signature(object = "HTMLPage"): Gets the
fileName slot
signature(object = "HTMLPage"): Gets the
pageText slot
signature(object = "HTMLPage"): Gets the
pageTitle slot
signature(object = "HTMLPage"): Writes the page
out to the file designated by the fileName slot
These classes are currently experimental.
FramedHTMLPage is modeled after the framing layout of the Bioconductor website (www.bioconductor.org).
Jeff Gentry
##---- Should be DIRECTLY executable !! ----##---- Should be DIRECTLY executable !! ----
These functions either verify that a list of IDs are primary and valid IDs for a package, or else return all the valid primary IDs from a package
isValidKey(ids, pkg) allValidKeys(pkg) ## S4 method for signature 'character,character' isValidKey(ids, pkg) ## S4 method for signature 'character,OrgDb' isValidKey(ids, pkg) ## S4 method for signature 'character' allValidKeys(pkg) ## S4 method for signature 'OrgDb' allValidKeys(pkg)isValidKey(ids, pkg) allValidKeys(pkg) ## S4 method for signature 'character,character' isValidKey(ids, pkg) ## S4 method for signature 'character,OrgDb' isValidKey(ids, pkg) ## S4 method for signature 'character' allValidKeys(pkg) ## S4 method for signature 'OrgDb' allValidKeys(pkg)
ids |
A character vector containing IDs that you wish to validate. |
pkg |
Either the name of an installed annotation package (e.g., "org.Hs.eg.db"), or an uninstalled annotation package, e.g., from AnnotationHub. |
Every package has some kind of ID that is central to that package. For chip-based packages this will be some kind of probe, and for the organism based packages it will be something else (usually an entrez gene ID). isValidKey takes a list of IDs and tests to see whether or not they are present (valid) in a particular package. allValidKeys simply returns all the valid primary IDs for a package.
isValidKey returns a vector of TRUE or FALSE values corresponding to whether or not the
ID is valid.
allValidKeys returns a vector of all the valid primary IDs.
Marc Carlson
## Not run: ## 2 bad IDs and a 3rd that will be valid ids <- c("15S_rRNA_2","21S_rRNA_4","15S_rRNA") isValidKey(ids, "org.Sc.sgd") ## 2 good IDs and a 3rd that will not be valid ids <- c("5600","7531", "altSymbol") isValidKey(ids, "org.Hs.eg") ## Get all the valid primary id from org.Hs.eg.db allValidKeys("org.Hs.eg") ## End(Not run)## Not run: ## 2 bad IDs and a 3rd that will be valid ids <- c("15S_rRNA_2","21S_rRNA_4","15S_rRNA") isValidKey(ids, "org.Sc.sgd") ## 2 good IDs and a 3rd that will not be valid ids <- c("5600","7531", "altSymbol") isValidKey(ids, "org.Hs.eg") ## Get all the valid primary id from org.Hs.eg.db allValidKeys("org.Hs.eg") ## End(Not run)
These functions are DEFUNCT. All this functionality has been replaced by inPARANOID packages. Given a set of LocusLink ids or NCBI HomoloGeneIDs, the functions obtain the homology data and represent them as a list of sub-lists using the homology data package for the organism of interest. A sub-list can be of length 1 or greater depending on whether a LocusLink id can be mapped to one or more HomoloGeneIDs.
LL2homology(homoPkg, llids) HGID2homology(hgid, homoPkg) ACC2homology(accs, homoPkg)LL2homology(homoPkg, llids) HGID2homology(hgid, homoPkg) ACC2homology(accs, homoPkg)
llids |
|
hgid |
|
accs |
|
homoPkg |
|
The homology data package has to be installed before executing any of the two functions.
Each sub-list has the following elements:
homoOrg - a named vector of a single character string whose value is the scientific name of the organism and name the numeric code used by NCBI for the organism.
homoLL - an integer for LocusLink id.
homoHGID - an integer for internal HomoloGeneID.
homoACC - a character string for GenBank accession number of the best matching sequence of the organism.
homoType - a single letter for the type of similarity measurement between the homologous genes. homoType can be either B (reciprocal best best between three or more organisms), b (reciprocal best match between two organisms), or c (curated homology relationship between two organisms).
homoPS - a percentage value measured as the percent of identity of base pair alignment between the homologous sequences.
homoURL - a url to the source if the homology relationship is a curated orthology.
Sub-lists with homoType = B or b will not have any value for homoURL and objects with homoType = c will not have any value for homoPS.
Both functions returns a list of sub-lists containing data for homologous genes in other organisms.
Jianhua Zhang
https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?=homologene
## Not run: ## hsahomology is a defunct package! if(require("hsahomology")){ llids <- ls(env = hsahomologyLL2HGID)[2:5] LL2homology("hsahomology", llids) } ## End(Not run)## Not run: ## hsahomology is a defunct package! if(require("hsahomology")){ llids <- ls(env = hsahomologyLL2HGID)[2:5] LL2homology("hsahomology", llids) } ## End(Not run)
This function will take a set of links and titles and will generate HTML anchor tags out of these values
makeAnchor(link, title, toMain = FALSE)makeAnchor(link, title, toMain = FALSE)
link |
A vector of URLs |
title |
A vector of website names |
toMain |
Used for frame pages |
A vector of HTML anchor tags
Jeff Gentry
makeAnchor("http://www.bioconductor.org","Bioconductor")makeAnchor("http://www.bioconductor.org","Bioconductor")
These functions help map to organism identifiers used at the NCBI.
mapOrgs(toMap, what = c("code","name")) getOrgNameNCode()mapOrgs(toMap, what = c("code","name")) getOrgNameNCode()
toMap |
|
what |
|
mapOrgs converts organism codes to scientific names.
mapOrgs returns a vector of character strings.
Jianhua Zhang
ftp://ftp.ncbi.nih.gov/pub/HomoloGene/README
The most basic organism method just takes a character string (which represents a particular annotation package) and returns the organism that said package is based upon.
organism(object)organism(object)
object |
a character string that names a package |
The name of the organism used for this package or object
Marc Carlson
require(hgu95av2.db) ## get the organism for this annotation package organism("hgu95av2") ## get the organism this object refers to ## (for a ChromLocation object) z <- buildChromLocation("hgu95av2") organism(z)require(hgu95av2.db) ## get the organism for this annotation package organism("hgu95av2") ## get the organism this object refers to ## (for a ChromLocation object) z <- buildChromLocation("hgu95av2") organism(z)
A user friendly interface to the functionality provided by
pubmed.
pm.abstGrep(pattern, absts, ...)pm.abstGrep(pattern, absts, ...)
pattern |
A pattern for the call to |
absts |
A list containing abstracts downloaded using |
... |
Extra arguments passed to |
The absts are a list of PubMed XML objects that have been downloaded
and parsed. This function lets the user quickly search the abstracts
for any regular expression. The returned value is a logical vector
indicating which of the abstracts contain the regular expression.
The returned value is a logical vector indicating which of the abstracts contain the regular expression.
Robert Gentleman
library("hgu95av2.db") hoxa9 <- "37806_at" absts <- pm.getabst(hoxa9, "hgu95av2") pm.abstGrep("SH3", absts[[1]]) pm.abstGrep("autism", absts[[1]])library("hgu95av2.db") hoxa9 <- "37806_at" absts <- pm.getabst(hoxa9, "hgu95av2") pm.abstGrep("SH3", absts[[1]]) pm.abstGrep("autism", absts[[1]])
The data provided by PubMed is reduced to a small set. This set is then suitable for further rendering.
pm.getabst(geneids, basename)pm.getabst(geneids, basename)
geneids |
The identifiers used to find Abstracts |
basename |
The base name of the annotation package to use. |
We rely on the annotation in the package associated with the
basename to provide PubMed identifiers for the genes described by
the gene identifiers.
With these in hand we then use the pmfetch utility to download the
PubMed abstracts in XML form. These are then translated (transformed) to a
shorter version containing a small subset of the data provided by PubMed.
This function has the side effect of creating an environment in
.GlobalEnv that contains the mapping for the requested data.
This is done for efficiency – so we don't continually read in the data
when there are many different queries to be performed.
A list of lists containing objects of class pubMedAbst.
There will be one element of the list for each identifier.
Each of these elements is a list containing one abstract (of
class pubMedAbst for each PubMed identifier associated with
the gene identifier.
Robert Gentleman
library("hgu95av2.db") hoxa9 <- "37806_at" absts <- pm.getabst(hoxa9, "hgu95av2")library("hgu95av2.db") hoxa9 <- "37806_at" absts <- pm.getabst(hoxa9, "hgu95av2")
This function returns the titles from a list of PubMed abstracts.
pm.titles(absts)pm.titles(absts)
absts |
The list of PubMed abstracts. |
It simply uses sapply.
A character vector of length equal to the number of abstracts. Each element is the title of the corresponding abstract.
Robert Gentleman
library("hgu95av2.db") hoxa9 <- "37806_at" absts <- pm.getabst(hoxa9, "hgu95av2") pm.titles(absts)[[1]][[1]]library("hgu95av2.db") hoxa9 <- "37806_at" absts <- pm.getabst(hoxa9, "hgu95av2") pm.titles(absts)[[1]][[1]]
This function will take a pubMedAbst object, or a list of these
objects and generate a web page that will list the titles of
the abstracts and link to their full page on PubMed
pmAbst2HTML(absts, filename, title, frames = FALSE, table.center = TRUE)pmAbst2HTML(absts, filename, title, frames = FALSE, table.center = TRUE)
absts |
A list of |
filename |
The output filename. If |
title |
Extra title information for your listing |
frames |
If |
table.center |
If TRUE, will center the listing of abstracts |
This function uses the Entrez functionality provided by NCBI to
retrieve the abstract URL at the PubMed site. It will then create a
tabular webpage which will list the titles of the abstracts provided
and have them link to the appropriate PubMed page. If frames
is TRUE, the table of links will be on the left hand side of
the page and the right hand will link directly to the appropriate
PubMed page.
If frames is FALSE, a simple HTML file is created with
the name specified by filename.
If frames is TRUE, then there are four HTML files
created, of the form XXXtop.html, XXXside.html,
XXXmain.html and XXXindex.html, where XXX is the
string provided by filename.
Jeff Gentry
pubMedAbst
x <- pubmed("9695952","8325638","8422497") a <- xmlRoot(x) numAbst <- length(xmlChildren(a)) absts <- list() for (i in 1:numAbst) { absts[[i]] <- buildPubMedAbst(a[[i]]) } ## First try it w/o frames - using a temporary ## file for the output fname <- tempfile() pmAbst2HTML(absts,filename=fname) if (interactive()) browseURL(paste("file://",fname,sep="")) ## Now try it w/ frames, using temporary files again. fnameBase <- tempfile() pmAbst2HTML(absts,filename=fnameBase, frames=TRUE) if (interactive()) browseURL(paste("file://",fnameBase,"index.html",sep=""))x <- pubmed("9695952","8325638","8422497") a <- xmlRoot(x) numAbst <- length(xmlChildren(a)) absts <- list() for (i in 1:numAbst) { absts[[i]] <- buildPubMedAbst(a[[i]]) } ## First try it w/o frames - using a temporary ## file for the output fname <- tempfile() pmAbst2HTML(absts,filename=fname) if (interactive()) browseURL(paste("file://",fname,sep="")) ## Now try it w/ frames, using temporary files again. fnameBase <- tempfile() pmAbst2HTML(absts,filename=fnameBase, frames=TRUE) if (interactive()) browseURL(paste("file://",fnameBase,"index.html",sep=""))
use web to populate MIAME instance with pubmed details
pmid2MIAME(pmid)pmid2MIAME(pmid)
pmid |
string encoding PMID |
uses XML library to decode parts of the query response and load a MIAME object
An instance of class MIAME
Vince Carey <[email protected]>
if (interactive()) pmid2MIAME("9843569")if (interactive()) pmid2MIAME("9843569")
For a given chip or a given set of genes, it computes the mapping from probes to PubMed id.
PMIDAmat(pkg, gene=NULL)PMIDAmat(pkg, gene=NULL)
pkg |
The package name of the chip for which the incidence matrix should be computed. |
gene |
A character vector of interested probe set ids or NULL (default). |
Not much to say, just find which probes are associated with which PubMed ids and return the incidence matrix, with PubMed ids as rows and probes as columns.
To specify a set of probes to use, let the argument gene to be
a vector of probe ids. Bt this way, the calculations are not
involved with non-interested genes/PubMed ids so that the whole
process could finish soon.
A matrix containing zero or one, depending on whether the probe (column) is associated with a PubMed id (row).
R. Gentleman
library("hgu95av2.db") probe <- names(as.list(hgu95av2ACCNUM)) Amat <- PMIDAmat("hgu95av2", gene=sample(probe, 10))library("hgu95av2.db") probe <- names(as.list(hgu95av2ACCNUM)) Amat <- PMIDAmat("hgu95av2", gene=sample(probe, 10))
Given a PMID, will create a URL which can be used to open a browser and retrieve the specified information from PubMed.
pmidQuery(query)pmidQuery(query)
query |
The PubMed ID (or IDs) |
Using ublished details from NCBI we construct an appropriate string for directing a web browser to the information available at the NCBI.
A character string containing the appropriate URL
Jeff Gentry
NCBI, https://www.ncbi.nih.gov/
a <- "9695952" pmidQuery(a)a <- "9695952" pmidQuery(a)
Given a vector of Pubmed identifiers or accession numbers, the user can either have a browser display a URL showing a Pubmed query for those identifiers, or a XMLdoc object with the same data.
pubmed(...,disp=c("data","browser"), type=c("uid","accession"), pmaddress=.efetch("PubMed", disp, type))pubmed(...,disp=c("data","browser"), type=c("uid","accession"), pmaddress=.efetch("PubMed", disp, type))
... |
Vectorized set of Pubmed ID's |
disp |
Either "Data" or "Browser" (default is data). Data returns a XMLDoc, while Browser will display information in the user's browser. |
type |
Denotes whether the arguments are accession numbers or UIDS. Defaults to uids. |
pmaddress |
Specific path to the pubmed efetch engine from the NCBI website. |
A simple function to retrieve Pubmed data given a specific ID, either through XML or through a web browser. This function will accept either pubmed accession numbers or NCBI UIDs (defined as a Pubmed ID or a Medline ID) - although the types must not be mixed in a single call.
WARNING: The powers that be at NCBI have been known to ban the IP addresses of users who abuse their servers (currently defined as less then 2 seconds between queries). Do NOT put this function in a tight loop or you may find your access revoked.
If the option "data" is used, an object of type XMLDoc is returned, unless there was an error with the query in which case an object of type try-error is returned.
If the option "browser" is used, nothing is returned.
R. Gentleman
if( interactive() ) opts <- c("data","browser") else opts <- "data" for (dp in opts) pubmed("11780146","11886385","11884611",disp=dp)if( interactive() ) opts <- c("data","browser") else opts <- "data" for (dp in opts) pubmed("11780146","11886385","11884611",disp=dp)
This is a class representation for PubMed abstracts.
new('pubMedAbst', authors = ...., # Object of class vector pmid = ...., # Object of class character abstText = ...., # Object of class character articleTitle = ...., # object of class character journal = ...., # Object of class character pubDate = ...., # Object of class character )
pmid:Object of class "character" The PubMed ID
for this paper.
authors:Object of class "vector" The authors
of the paper.
abstText:Object of class "character" The
contained text of the abstract.
articleTitle:Object of class "character" The
title of the article the abstract pertains to.
journal:Object of class "character" The journal
the article was published in.
pubDate:Object of class "character" The date the
journal was published.
signature(object = "pmid"): An accessor function
for pmid
signature(object = "pubMedAbst"): An accessor
function for abstText
signature(object = "pubMedAbst"): An accessor
function for articleTitle
signature(object = "pubMedAbst"): An accessor
function for authors
signature(object = "pubMedAbst"): An accessor
function for journal
signature(object = "pubMedAbst"): An accessor
function for pubDate
Jeff Gentry
x <- pubmed("9695952","8325638","8422497") a <- xmlRoot(x) numAbst <- length(xmlChildren(a)) absts <- list() for (i in 1:numAbst) { absts[[i]] <- buildPubMedAbst(a[[i]]) }x <- pubmed("9695952","8325638","8422497") a <- xmlRoot(x) numAbst <- length(xmlChildren(a)) absts <- list() for (i in 1:numAbst) { absts[[i]] <- buildPubMedAbst(a[[i]]) }
For a given chip we compute the mapping from probes to KEGG pathways.
PWAmat(data)PWAmat(data)
data |
The name of the chip for which the incidence matrix should be computed. |
Not much to say, just find which probes are in which pathways and return the incidence matrix, with pathways as rows and probes as columns.
It would be nice to be able to specify a set of probes to use, so that one does not do perform the calculations using all probes if they are not of interest.
A matrix containing zero or one, depending on whether the probe (row) is in a pathway (column).
R. Gentleman
library("hgu95av2.db") Am1 <- PWAmat("hgu95av2")library("hgu95av2.db") Am1 <- PWAmat("hgu95av2")
Data files that are available at GEO web site are identified by GEO accession numbers. Given the url for the CGI script at GEO and a GEO accession number, the functions extract data from the web site and returns a matrix containing the data.
readGEOAnn(GEOAccNum, url = "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?") readIDNAcc(GEOAccNum, url = "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?") getGPLNames(url ="https://www.ncbi.nlm.nih.gov/geo/query/browse.cgi?") getSAGEFileInfo(url = "https://www.ncbi.nlm.nih.gov/geo/query/browse.cgi?view=platforms&prtype=SAGE&dtype=SAGE") getSAGEGPL(organism = "Homo sapiens", enzyme = c("NlaIII", "Sau3A")) readUrl(url)readGEOAnn(GEOAccNum, url = "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?") readIDNAcc(GEOAccNum, url = "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?") getGPLNames(url ="https://www.ncbi.nlm.nih.gov/geo/query/browse.cgi?") getSAGEFileInfo(url = "https://www.ncbi.nlm.nih.gov/geo/query/browse.cgi?view=platforms&prtype=SAGE&dtype=SAGE") getSAGEGPL(organism = "Homo sapiens", enzyme = c("NlaIII", "Sau3A")) readUrl(url)
url |
|
GEOAccNum |
|
organism |
|
enzyme |
|
url is the CGI script that processes user's
request. readGEOAnn invokes the CGI by passing a GEO
accession number and then processes the data file obtained.
readIDNAcc calls readGEOAnn to read the
data and the extracts the columns for probe ids and accession numbers.
The GEOAccNum has to be the id for an Affymetrix chip.
getGPLNames parses the html file that lists GEO
accession numbers and descriptions of the array represented by the
corresponding GEO accession numbers.
Both readGEOAnn and readIDNAcc return a
matrix.
getGPLNames returns a named vector of the names of
commercial arrays. The names of the vector are the corresponding GEO
accession number.
Jianhua Zhang
# Get array names and GEO accession numbers #geoAccNums <- getGPLNames() # Read the annotation data file for HG-U133A which is GPL96 based on # examining geoAccNums #temp <- readGEOAnn(GEOAccNum = "GPL96") #temp2 <- readIDNAcc(GEOAccNum = "GPL96")# Get array names and GEO accession numbers #geoAccNums <- getGPLNames() # Read the annotation data file for HG-U133A which is GPL96 based on # examining geoAccNums #temp <- readGEOAnn(GEOAccNum = "GPL96") #temp2 <- readIDNAcc(GEOAccNum = "GPL96")
This function will serialize an environment in R to an XML format stored in a compressed file.
serializeEnv(env, fname) serializeDataPkgEnvs(pkgDir)serializeEnv(env, fname) serializeDataPkgEnvs(pkgDir)
env |
The name of the environment to serialize. |
fname |
The name of the output file. |
pkgDir |
The directory where a data package is |
The environment is converted into an XML format and then outputted to
a gzipped file (using gzfile). The values in the
environment are serialized (using serialize) in ASCII
format although the keys are stored in plain text.
The format of the XML is very simple, with the primary block being
values, which contain blocks of entries, and each entry
having a key and a value. For instance, if we had an
environment with one value in it, the character c with a key
of a (e.g. assign("a", "c", env=foo)), this is what the
output would look like.
<?xml version="1.0"?>
<values xmlns:bt="http://www.bioconductor.org/RGDBM">
<entry>
<key>
a
</key>
<value>
A\n2\n131072\n66560\n1040\n1\n1033\n1\nc\n
</value>
</entry>
</values>
Jeff Gentry
z <- new.env() assign("a", 1, env=z) assign("b", 2, env=z) assign("c", 3, env=z) serializeEnv(z, tempfile())z <- new.env() assign("a", 1, env=z) assign("b", 2, env=z) assign("c", 3, env=z) serializeEnv(z, tempfile())
These functions allow end users to add arbitrary
repositories for use with the htmlpage function.
setRepository(repository, FUN, ..., verbose=TRUE) getRepositories() clearRepository(repository, verbose=TRUE)setRepository(repository, FUN, ..., verbose=TRUE) getRepositories() clearRepository(repository, verbose=TRUE)
repository |
A character name for the repository. |
FUN |
A function to build hyperlinks for the repository. See details for more information. |
... |
Allows one to pass arbitrary code to underlying functions. |
verbose |
Output warning messages? |
These functions allow end users to add, view, and remove repositories
for use with the htmlpage function. getRepositories will
output a vector of names for available
repositories. clearRepository can be used to remove a
repository if so desired. setRepository can be used to add a
repository. See the examples section for the format of the FUN
argument.
Once a new repository has been set, the htmlpage function can
be called using the name of the new repository as a value in the
repository argument (e.g., htmlpage(<other args>, repository =
list("newrepositoryname"))
Martin Morgan <[email protected]>
## A simple fake URI repofun <- function(ids, ...) paste("http://www.afakeuri.com/", ids, sep = "") setRepository("simple", repofun) ## More complicated, we want to make sure that ## NAs get converted to empty cells repofun <- function(ids, ...){ bIDs <- which(is.na(ids)) out <- paste("http://www.afakeuri.com/", ids, sep = "") out[bIDs] <- " " out } setRepository("complex", repofun) ## More complicated URI where we need to pass more information ## An example is Ensembl, which requires a species as part of the URI ## Since htmlpage() has an '...' argument, we can pass arbitrary ## arguments to this function that will be passed down to our ## repfun. Here we assume the argument species="Homo_sapiens" has been ## included in the call to htmlpage(). repofun <- function(ids, ...){ if(!is.null(list(...)$species)) species <- list(...)$species else stop("To make links for Ensembl, you need to pass a 'species' argument.", call. = FALSE) out <- paste("http://www.ensembl.org/", species, "/Search/Summary?species=", species, ";idx=;q=", ids, sep = "") out } setRepository("species_arg", repofun)## A simple fake URI repofun <- function(ids, ...) paste("http://www.afakeuri.com/", ids, sep = "") setRepository("simple", repofun) ## More complicated, we want to make sure that ## NAs get converted to empty cells repofun <- function(ids, ...){ bIDs <- which(is.na(ids)) out <- paste("http://www.afakeuri.com/", ids, sep = "") out[bIDs] <- " " out } setRepository("complex", repofun) ## More complicated URI where we need to pass more information ## An example is Ensembl, which requires a species as part of the URI ## Since htmlpage() has an '...' argument, we can pass arbitrary ## arguments to this function that will be passed down to our ## repfun. Here we assume the argument species="Homo_sapiens" has been ## included in the call to htmlpage(). repofun <- function(ids, ...){ if(!is.null(list(...)$species)) species <- list(...)$species else stop("To make links for Ensembl, you need to pass a 'species' argument.", call. = FALSE) out <- paste("http://www.ensembl.org/", species, "/Search/Summary?species=", species, ";idx=;q=", ids, sep = "") out } setRepository("species_arg", repofun)
Given a set of UniGene identifiers this function creates a set of URLs that an be used to either open a browser to the requested location or that can be used as anchors in the construction of HTML output.
UniGeneQuery(query, UGaddress="UniGene/", type="CID")UniGeneQuery(query, UGaddress="UniGene/", type="CID")
query |
The UniGene identifiers. |
UGaddress |
The address of UniGene, within the NCBI repository. |
type |
What type of object is being asked for; eithe CID or UGID |
Using published details from NCBI we construct an appropriate string for directing a web browser to the information available at the NCBI for that genomic product (usually an EST).
A character vector containing the query string.
Be very careful about automatically querying this resource. It is considered antisocial behavior by the owners.
Robert Gentleman
NCBI, https://www.ncbi.nih.gov/
q1<-UniGeneQuery(c("Hs.293970", "Hs.155650")) q1 if( interactive()) browseURL(q1[1])q1<-UniGeneQuery(c("Hs.293970", "Hs.155650")) q1 if( interactive()) browseURL(q1[1])
Given a list of gene symbols and a package, find a valid ID for that package. If there isn't a valid ID, then return the original symbol.
updateSymbolsToValidKeys(symbols, pkg)updateSymbolsToValidKeys(symbols, pkg)
symbols |
A character vector containing gene symbols that you wish to try and translate into valid IDs. |
pkg |
The package name of the chip for which we wish to validate IDs. |
This is a convenience function for getting from a possibly varied list of gene symbols mapped onto something that is a nice concrete ID such as an entrez gene ID. When such an ID cannot be found, the original symbol will come back to prevent the loss of any information.
This function returns a vector of IDs corresponding to the symbols that were input. If the symbols don't have a valid ID, then they come back instead.
Marc Carlson
## Not run: ## one "bad" ID, one that can be mapped onto a valid ID, and a 3rd ## which already is a valid ID syms <- c("15S_rRNA_2","21S_rRNA_4","15S_rRNA") updateSymbolsToValidKeys(syms, "org.Sc.sgd") ## 3 symbols and a 4th that will NOT be valid syms <- c("MAPK11","P38B","FLJ45465", "altSymbol") updateSymbolsToValidKeys(syms, "org.Hs.eg") ## End(Not run)## Not run: ## one "bad" ID, one that can be mapped onto a valid ID, and a 3rd ## which already is a valid ID syms <- c("15S_rRNA_2","21S_rRNA_4","15S_rRNA") updateSymbolsToValidKeys(syms, "org.Sc.sgd") ## 3 symbols and a 4th that will NOT be valid syms <- c("MAPK11","P38B","FLJ45465", "altSymbol") updateSymbolsToValidKeys(syms, "org.Hs.eg") ## End(Not run)
Given an instance of an ExpressionSet, a chromLocation object
and the name of a chromosome this function returns all genes represented
in the ExpressionSet on the specified chromosome.
usedChromGenes(eSet, chrom, specChrom)usedChromGenes(eSet, chrom, specChrom)
eSet |
An instance of an |
chrom |
The name of the chromosome of interest. |
specChrom |
An instance of a |
Returns a vector of gene names that represent the genes from the
ExpressionSet that are on the specified chromosome.
Jeff Gentry
data(sample.ExpressionSet) data(hgu95AProbLocs) usedChromGenes(sample.ExpressionSet, "1", hgu95AProbLocs)data(sample.ExpressionSet) data(hgu95AProbLocs) usedChromGenes(sample.ExpressionSet, "1", hgu95AProbLocs)