| Title: | Bowtie-based alignment of CRISPR gRNA spacer sequences |
|---|---|
| Description: | Provides a user-friendly interface to map on-targets and off-targets of CRISPR gRNA spacer sequences using bowtie. The alignment is fast, and can be performed using either commonly-used or custom CRISPR nucleases. The alignment can work with any reference or custom genomes. Both DNA- and RNA-targeting nucleases are supported. |
| Authors: | Jean-Philippe Fortin [aut, cre] |
| Maintainer: | Jean-Philippe Fortin <[email protected]> |
| License: | MIT + file LICENSE |
| Version: | 1.16.0 |
| Built: | 2026-06-10 06:59:57 UTC |
| Source: | https://github.com/bioc/crisprBowtie |
Perform short sequence alignment with bowtie.
runBowtie( sequences, bowtie_index, bsgenome = NULL, n_mismatches = 0, all_alignments = TRUE, n_max_alignments = 1000, verbose = TRUE )runBowtie( sequences, bowtie_index, bsgenome = NULL, n_mismatches = 0, all_alignments = TRUE, n_max_alignments = 1000, verbose = TRUE )
sequences |
Character vector of DNA sequences. |
bowtie_index |
String specifying path to a bowtie index. |
bsgenome |
BSgenome object. |
n_mismatches |
Integer between 0 and 3 specifying maximum number of mismatches allowed between query sequences and target DNA. 0 by default. |
all_alignments |
Should all possible alignments be returned? TRUE by default. |
n_max_alignments |
Maximum number of alignments to return if
|
verbose |
Should messages be printed to the console? TRUE by default. |
fasta <- system.file(package="crisprBowtie", "example/chr1.fa") outdir <- tempdir() Rbowtie::bowtie_build(fasta,outdir=outdir, force=TRUE, prefix="tempIndex")
runBowtie can be used to map short DNA sequences
to a reference genome. To search for sequences while imposing
constraints on PAM sequences (such as gRNA spacer sequences), see
runCrisprBowtie instead.
A data.frame of the alignments with the following columns:
query — string specifying query DNA sequence
target — string specifying target DNA sequence
chr - string specifying chromosome name
pos - string specifying genomic coordinate of the start
of the target DNA sequence
strand - string specifying strand ("+" or "-")
n_mismatches - integer specifying number of mismatches
between query and target sequences
Jean-Philippe Fortin
runCrisprBowtie to map gRNA spacer sequences.
fasta <- system.file(package="crisprBowtie", "example/chr1.fa") outdir <- tempdir() Rbowtie::bowtie_build(fasta,outdir=outdir, force=TRUE, prefix="tempIndex") index <- file.path(outdir, "tempIndex") seqs <- c("GGAAGT", "GTGGAC", "GTGTGC") results <- runBowtie(seqs, bowtie_index=index, n_mismatches=2)fasta <- system.file(package="crisprBowtie", "example/chr1.fa") outdir <- tempdir() Rbowtie::bowtie_build(fasta,outdir=outdir, force=TRUE, prefix="tempIndex") index <- file.path(outdir, "tempIndex") seqs <- c("GGAAGT", "GTGGAC", "GTGTGC") results <- runBowtie(seqs, bowtie_index=index, n_mismatches=2)
Perform CRISPR gRNA spacer alignment with bowtie.
runCrisprBowtie( spacers, mode = c("protospacer", "spacer"), bowtie_index = NULL, bsgenome = NULL, crisprNuclease = NULL, canonical = TRUE, ignore_pam = FALSE, n_mismatches = 0, all_alignments = TRUE, n_max_alignments = 1000, force_spacer_length = FALSE, rna_strict_directionality = TRUE, verbose = TRUE )runCrisprBowtie( spacers, mode = c("protospacer", "spacer"), bowtie_index = NULL, bsgenome = NULL, crisprNuclease = NULL, canonical = TRUE, ignore_pam = FALSE, n_mismatches = 0, all_alignments = TRUE, n_max_alignments = 1000, force_spacer_length = FALSE, rna_strict_directionality = TRUE, verbose = TRUE )
spacers |
Character vector specifying gRNA spacer sequences. Sequences must all be of equal length. |
mode |
String specifying which alignment mode should be used:
|
bowtie_index |
String specifying path to a bowtie index. |
bsgenome |
A BSgenome object.
Must be provided if |
crisprNuclease |
A CrisprNuclease object. |
canonical |
Should only canonical PAM sequences be considered? TRUE by default. |
ignore_pam |
Should PAM sequences be ignore? If TRUE, all alignments are returned regardless of PAM tolerance. FALSE by default. |
n_mismatches |
Integer between 0 and 3 specifying maximum number of mismatches allowed between spacer sequences and target DNA. 0 by default. |
all_alignments |
Should all possible alignments be returned? TRUE by default. |
n_max_alignments |
Maximum number of alignments to return if
|
force_spacer_length |
Should the spacer length be overwritten in the
|
rna_strict_directionality |
Should only protospacers found in the original direction of the RNA be considered for RNA-targeting nucleases? TRUE by default. |
verbose |
Should messages be printed to the console? TRUE by default. |
When mode is "spacer", spacer sequences are aligned to the
reference index without appending PAM sequences first. This requires the
specification of a BSgenome object through the argument
bsgenome to validate that the aligned spacer sequences are
adjacent to valid PAM sequences.
When mode is "protospacer", sequences are aligned with all
valid PAM sequences appended (spacer + PAM). The set of valid PAM
sequences depend on the inputs canonical and ignore_pam.
This is faster than the "spacer" mode if the number of possible
PAM sequences is small (e.g. SpCas9).
For RNA-targeting nucleases, such as RfxCas13d (CasRx), the bowtie index should be built on a transcriptome. For such applications, only the "protospacer" mode can be used as there is no corresponding bsgenome package. The protospacer sequences searched in the reference index will be the reverse complement of the input spacer sequences.
A data.frame of the spacer alignments with the following columns:
spacer — string specifying gRNA spacer sequence
protospacer — string specifying target protospacer sequence
pam — string specifying target PAM sequence
chr - string specifying chromosome name
pam_site - string specifying genomic coordinate of the
first nucleotide of the PAM sequence.
strand - string specifying strand ("+" or "-")
n_mismatches - integer specifying number of mismatches
between spacer and protospacer sequences
canonical - logical indicating whether or not PAM sequence
is canonical.
Jean-Philippe Fortin
runBowtie to map general DNA sequences.
fasta <- system.file(package="crisprBowtie", "example/chr1.fa") outdir <- tempdir() Rbowtie::bowtie_build(fasta,outdir=outdir, force=TRUE, prefix="tempIndex") index <- file.path(outdir, "tempIndex") seqs <- c("GGAAATTCCCCCAGTGGCGC", "ACACAGCTGCGGACAGGGCC") data(SpCas9, package="crisprBase") results <- runCrisprBowtie(seqs, bowtie_index=index, n_mismatches=2, crisprNuclease=SpCas9)fasta <- system.file(package="crisprBowtie", "example/chr1.fa") outdir <- tempdir() Rbowtie::bowtie_build(fasta,outdir=outdir, force=TRUE, prefix="tempIndex") index <- file.path(outdir, "tempIndex") seqs <- c("GGAAATTCCCCCAGTGGCGC", "ACACAGCTGCGGACAGGGCC") data(SpCas9, package="crisprBase") results <- runCrisprBowtie(seqs, bowtie_index=index, n_mismatches=2, crisprNuclease=SpCas9)