##
## Attaching package: 'BiocStyle'
## The following objects are masked from 'package:rmarkdown':
##
## html_document, md_document, pdf_document
Lorena Pantano - Harvard TH Chan School of Public Health, Boston, US
Georgia Escaramis - CIBERESP (CIBER Epidemiologia y Salud Publica)
miRNAs are small RNA fragments (18-23 nt long) that influence gene expression during development and cell stability. Morin et al (Morin et al. 2008), discovered isomiRs first time after sequencing human stem cells.
IsomiRs are miRNAs that vary slightly in sequence, which result from variations in the cleavage site during miRNA biogenesis (5’-trimming and 3’-trimming variants), nucleotide additions to the 3’-end of the mature miRNA (3’-addition variants) and nucleotide modifications (substitution variants)(Martı́ et al. 2010).
There are many tools designed for isomiR detection, however the majority are web application where user can not control the analysis. The two main command tools for isomiRs mapping are SeqBuster and sRNAbench (Guillermo et al. 2014). isomiRs. package is designed to analyze the output of SeqBuster tool or any other tool after converting to the desire format.
If you use the package, please cite this paper (Pantano L 2010).
The input should be the output of SeqBuster-miraligner tool (*.mirna files). It is compatible with mirTOP tool as well, which parses BAM files with alignments against miRNA precursors.
For each sample the file should have the following format:
seq name freq mir start end mism add t5 t3
TGTAAACATCCTACACTCAGCT seq_100014_x23 23 hsa-miR-30b-5p 17 40 0 0 0 GT
TGTAAACATCCCTGACTGGAA seq_100019_x4 4 hsa-miR-30d-5p 6 26 13TC 0 0 g
TGTAAACATCCCTGACTGGAA seq_100019_x4 4 hsa-miR-30e-5p 17 37 12CT 0 0 g
CAAATTCGTATCTAGGGGATT seq_100049_x1 1 hsa-miR-10a-3p 63 81 0 TT 0 ata
TGACCTAGGAATTGACAGCCAGT seq_100060_x1 1 hsa-miR-192-5p 25 47 8GT 0 c agt
This is the standard output of SeqBuster-miraligner tool, but can be converted from any other tool having the mapping information on the precursors. Read more on miraligner manual.
This object will store all raw data from the input files and some
processed information used for visualization and statistical analysis.
It is a subclass of SummarizedExperiment with
colData and counts methods. Beside that, the
object contains raw and normalized counts from miraligner allowing to
update the summarization of miRNA expression.
The user can access the normalized count matrix with
counts(object, norm=TRUE).
You can browse for the same miRNA or isomiRs in all samples with
isoSelect method.
## DataFrame with 6 rows and 14 columns
## cc1 cc2 cc3 cc4 cc5
## <numeric> <numeric> <numeric> <numeric> <numeric>
## hsa-let-7a-5p 235825 171354 149541 180654 168884
## hsa-let-7a-5p;iso_3p:T 8806 5478 5427 6249 5538
## hsa-let-7a-5p;iso_3p:gtt 1173 884 751 1010 963
## hsa-let-7a-5p;iso_3p:t 50920 52403 35525 53213 51499
## hsa-let-7a-5p;iso_3p:tt 6041 5467 3817 7491 6394
## hsa-let-7a-5p;iso_add3p:A 9616 4742 5437 6714 5846
## cc6 cc7 ct1 ct2 ct3
## <numeric> <numeric> <numeric> <numeric> <numeric>
## hsa-let-7a-5p 107430 153061 143030 163569 114028
## hsa-let-7a-5p;iso_3p:T 3734 5482 4825 6045 4626
## hsa-let-7a-5p;iso_3p:gtt 580 863 927 756 495
## hsa-let-7a-5p;iso_3p:t 30659 45492 42878 35795 24993
## hsa-let-7a-5p;iso_3p:tt 3984 5940 7107 4828 2858
## hsa-let-7a-5p;iso_add3p:A 3799 5532 5214 7326 4790
## ct4 ct5 ct6 ct7
## <numeric> <numeric> <numeric> <numeric>
## hsa-let-7a-5p 123454 133092 158909 140272
## hsa-let-7a-5p;iso_3p:T 4181 4505 5134 4670
## hsa-let-7a-5p;iso_3p:gtt 719 682 1048 860
## hsa-let-7a-5p;iso_3p:t 34512 36973 47873 39585
## hsa-let-7a-5p;iso_3p:tt 5087 5652 6589 5447
## hsa-let-7a-5p;iso_add3p:A 4430 5010 6034 5081
metadata(mirData) contains two lists:
rawList is a list with same length than number of samples
and stores the input files for each sample; isoList is a
list with same length than number of samples and stores information for
each isomiR type summarizing the different changes for the different
isomiRs (trimming at 3’, trimming a 5’, addition and substitution). For
instance, you can get the data stored in isoList for sample
1 and 5’ changes with this code
metadata(ids)[["isoList"]][[1]]["t5sum"].
IsomiR names follows this structure:
iso if the sequence has variations. t5 tag: indicates
variations at 5’ position. The naming contains two words:
direction - nucleotides, where direction can be UPPER CASE
NT (changes upstream of the 5’ reference position) or LOWER CASE NT
(changes downstream of the 5’ reference position). 0
indicates no variation, meaning the 5’ position is the same as the
reference. After direction, it follows the nucleotide/s
that are added (for upstream changes) or deleted (for downstream
changes). t3 tag: indicates variations at 3’ position. The naming
contains two words: direction - nucleotides, where
direction can be LOWER CASE NT (upstream of the 3’ reference position)
or UPPER CASE NT (downstream of the 3’ reference position).
0 indicates no variation, meaning the 3’ position is the
same as the reference. After direction, it follows the
nucleotide/s that are added (for downstream changes) or deleted (for
upstream chanes). ad tag: indicates nucleotides additions at 3’
position. The naming contains two words:
direction - nucleotides, where direction is UPPER CASE NT
(upstream of the 5’ reference position). 0 indicates no
variation, meaning the 3’ position has no additions. After
direction, it follows the nucleotide/s that are added.
mm tag: indicates nucleotides substitutions along the sequences.
The naming contains three words:
position-nucleotideATsequence-nucleotideATreference. *seed
tag: same as mm tag, but only if the change happens between
nucleotide 2 and 8.In general nucleotides in UPPER case mean insertions respect to the reference sequence, and nucleotides in LOWER case mean deletions respect to the reference sequence.
We are going to use a small RNAseq data from human brain samples (Pantano et al. 2015) to give some basic examples of isomiRs analyses.
In this data set we will find two groups:
pc: 7 control individuals pt: 7 patients with Parkinson’s Disease in early stage.
The function IsomirDataSeqFromFiles needs a vector with
the paths for each file and a data frame with the design experiment
similar to the one used for a mRNA differential expression analysis. Row
names of the data frame should be the names for each sample in the same
order than the list of files.
You can plot isomiRs expression with isoPlot. In this
figure you will see how abundant is each type of isomiRs at different
positions considering the total abundance and the total number of
sequences. The type parameter controls what type of isomiRs
to show. It can be trimming (iso5 and iso3), addition (add) or
substitution (subs) changes.
isoCounts gets the count matrix that can be used for
many different downstream analyses changing the way isomiRs are
collapsed. The following command will merge all isomiRs into one
feature: the reference miRNA.
## cc1 cc2 cc3 cc4 cc5 cc6 cc7 ct1 ct2
## hsa-let-7a-2-3p 5 13 4 9 11 6 7 0 4
## hsa-let-7a-3p 767 707 630 609 731 389 681 258 496
## hsa-let-7a-5p 317730 244832 203888 260931 244784 153049 220563 208511 222066
## hsa-let-7b-3p 1037 1949 679 1385 1884 697 1499 338 931
## hsa-let-7b-5p 69671 64702 42347 65322 60767 34975 56875 22215 45069
## hsa-let-7c-3p 36 16 25 40 26 23 35 3 30
## ct3 ct4 ct5 ct6 ct7
## hsa-let-7a-2-3p 2 12 12 8 3
## hsa-let-7a-3p 343 635 622 452 519
## hsa-let-7a-5p 154246 175523 189733 230690 199923
## hsa-let-7b-3p 494 1149 1194 1431 988
## hsa-let-7b-5p 28312 41214 43058 61258 46600
## hsa-let-7c-3p 28 26 24 22 17
The normalization uses rlog from DESeq2
package and allows quick integration to another analyses like heatmap,
clustering or PCA.
library(pheatmap)
ids = isoNorm(ids, formula = ~ condition)
pheatmap(counts(ids, norm=TRUE)[1:100,],
annotation_col = data.frame(colData(ids)[,1,drop=FALSE]),
show_rownames = FALSE, scale="row")To get a detail description for each isomiR, the function
isoAnnotate can return the naming, sequence and importance
value for each sample and isomiR. The importance is calculated by:
\[importance = \frac{isomiR\_reads}{miRNA\_reads}\]
The columns are:
position:nt_ref:nt_isomiR.## seq
## 1 AAAAACCGTAGTTACTTTTGCAT
## 2 AAAAACTGAGACTACTTTTG
## 3 AAAAACTGAGACTACTTTTGC
## 4 AAAAACTGAGACTACTTTTGCA
## 5 AAAAACTGAGACTACTTTTGCAA
## 6 AAAAACTGCAGTTACTTTTGC
## uid cc1 cc2
## 1 hsa-miR-548bb-3p;iso_snp:8GA;iso_add:T;iso_5p:c;iso_3p:A NA NA
## 2 hsa-miR-548e-3p;iso_3p:ca 9.375 10.71429
## 3 hsa-miR-548e-3p;iso_3p:a 34.375 10.71429
## 4 hsa-miR-548e-3p;ref 21.875 64.28571
## 5 hsa-miR-548e-3p;iso_add:A 34.375 NA
## 6 hsa-miR-548ah-3p;iso_5p:c 15.000 11.76471
## cc3 cc4 cc5 cc6 cc7 ct1 ct2 ct3 ct4
## 1 NA 100.000000 NA NA NA NA NA NA NA
## 2 15.15152 6.896552 NA NA NA 19.04762 NA 8.333333 20
## 3 30.30303 41.379310 28 66.66667 25 19.04762 47.61905 29.166667 20
## 4 27.27273 17.241379 44 33.33333 60 38.09524 23.80952 16.666667 30
## 5 21.21212 13.793103 12 NA 15 23.80952 19.04762 25.000000 30
## 6 23.07692 NA NA NA NA NA NA NA NA
## ct5 ct6 ct7 edit_mature_position
## 1 NA NA NA 9:AG
## 2 8.695652 NA NA NA
## 3 30.434783 13.04348 46.15385 NA
## 4 30.434783 34.78261 30.76923 NA
## 5 17.391304 43.47826 23.07692 NA
## 6 NA NA NA NA
The isoDE uses functions from DESeq2
package. This function has parameters to create a matrix using only the
reference miRNAs, all isomiRs, or some of them. This matrix and the
design matrix are the inputs for DESeq2. The output will be a
DESeqDataSet object, allowing to generate any plot or table explained in
DESeq2 package vignette.
## log2 fold change (MLE): condition ct vs cc
## Wald test p-value: condition ct vs cc
## DataFrame with 6 rows and 6 columns
## baseMean log2FoldChange lfcSE stat pvalue
## <numeric> <numeric> <numeric> <numeric> <numeric>
## hsa-let-7a-2-3p 6.60005e+00 -0.391808 0.609493 -0.642843 0.520326
## hsa-let-7a-3p 5.46805e+02 -0.225686 0.224797 -1.003953 0.315401
## hsa-let-7a-5p 2.20626e+05 0.113470 0.270505 0.419475 0.674869
## hsa-let-7b-3p 1.09679e+03 -0.391275 0.329461 -1.187621 0.234983
## hsa-let-7b-5p 4.74160e+04 -0.235215 0.226065 -1.040476 0.298119
## hsa-let-7c-3p 2.31178e+01 -0.174438 0.302732 -0.576212 0.564472
## padj
## <numeric>
## hsa-let-7a-2-3p 0.989528
## hsa-let-7a-3p 0.989528
## hsa-let-7a-5p 0.989528
## hsa-let-7b-3p 0.989528
## hsa-let-7b-5p 0.989528
## hsa-let-7c-3p 0.989528
You can differentiate between reference sequences and isomiRs at 5’ end with this command:
## row baseMean log2FoldChange lfcSE stat
## 1 hsa-let-7a-2-3p 2.4059793 -0.8425278 1.0440442 -0.8069848
## 2 hsa-let-7a-2-3p;iso_5p:TAA 0.1285419 1.1051761 3.0845751 0.3582912
## 3 hsa-let-7a-2-3p;ref 4.0407844 -0.2219555 0.6581561 -0.3372384
## 4 hsa-let-7a-3p 376.7216287 -0.1663188 0.2027009 -0.8205135
## 5 hsa-let-7a-3p;iso_5p:A 0.6517381 1.0223121 1.7714731 0.5770972
## 6 hsa-let-7a-3p;iso_5p:c 84.6025648 -0.3165339 0.2538101 -1.2471289
## pvalue padj
## 1 0.4196753 0.9865695
## 2 0.7201254 0.9865695
## 3 0.7359372 0.9865695
## 4 0.4119234 0.9865695
## 5 0.5638738 0.9865695
## 6 0.2123502 0.9865695
Alternative, for more complicated cases or if you want to control
more the differential expression analysis paramters you can use directly
DESeq2
package feeding it with the output of counts(ids) and
colData(ids) like this:
Here is the output of sessionInfo on the system on which
this document was compiled:
## R version 4.6.1 (2026-06-24)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 26.04 LTS
##
## Matrix products: default
## BLAS: /usr/lib/x86_64-linux-gnu/openblas-pthread/libblas.so.3
## LAPACK: /usr/lib/x86_64-linux-gnu/openblas-pthread/libopenblasp-r0.3.32.so; LAPACK version 3.12.0
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=C
## [9] LC_ADDRESS=C LC_TELEPHONE=C
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
##
## time zone: Etc/UTC
## tzcode source: system (glibc)
##
## attached base packages:
## [1] stats4 stats graphics grDevices utils datasets methods
## [8] base
##
## other attached packages:
## [1] DESeq2_1.52.0 pheatmap_1.0.13
## [3] isomiRs_1.40.0 SummarizedExperiment_1.42.0
## [5] Biobase_2.72.0 GenomicRanges_1.64.0
## [7] Seqinfo_1.2.0 IRanges_2.46.0
## [9] S4Vectors_0.50.1 BiocGenerics_0.58.1
## [11] generics_0.1.4 MatrixGenerics_1.24.0
## [13] matrixStats_1.5.0 BiocStyle_2.40.0
## [15] rmarkdown_2.31
##
## loaded via a namespace (and not attached):
## [1] bitops_1.0-9 mnormt_2.1.2
## [3] DBI_1.3.0 gridExtra_2.3.1
## [5] rlang_1.3.0 magrittr_2.0.5
## [7] clue_0.3-68 GetoptLong_1.1.1
## [9] otel_0.2.0 compiler_4.6.1
## [11] RSQLite_3.53.3 png_0.1-9
## [13] vctrs_0.7.3 stringr_1.6.0
## [15] pkgconfig_2.0.3 shape_1.4.6.1
## [17] crayon_1.5.3 fastmap_1.2.0
## [19] backports_1.5.1 XVector_0.52.0
## [21] labeling_0.4.3 caTools_1.18.3
## [23] tzdb_0.5.0 purrr_1.2.2
## [25] bit_4.6.0 xfun_0.60
## [27] cachem_1.1.0 jsonlite_2.0.0
## [29] blob_1.3.0 reshape_0.8.10
## [31] DelayedArray_0.38.2 BiocParallel_1.46.0
## [33] psych_2.6.5 broom_1.0.13
## [35] parallel_4.6.1 cluster_2.1.8.2
## [37] DEGreport_1.48.0 R6_2.6.1
## [39] stringi_1.8.7 bslib_0.11.0
## [41] RColorBrewer_1.1-3 limma_3.68.4
## [43] GGally_2.4.0 jquerylib_0.1.4
## [45] Rcpp_1.1.2 iterators_1.0.14
## [47] knitr_1.51 readr_2.2.0
## [49] Matrix_1.7-5 tidyselect_1.2.1
## [51] abind_1.4-8 yaml_2.3.12
## [53] gplots_3.3.0 doParallel_1.0.17
## [55] codetools_0.2-20 plyr_1.8.9
## [57] lattice_0.22-9 tibble_3.3.1
## [59] withr_3.0.3 KEGGREST_1.52.2
## [61] S7_0.2.2 evaluate_1.0.5
## [63] ggstats_0.13.0 ConsensusClusterPlus_1.76.0
## [65] circlize_0.4.18 Biostrings_2.80.1
## [67] pillar_1.11.1 BiocManager_1.30.27
## [69] KernSmooth_2.23-26 foreach_1.5.2
## [71] hms_1.1.4 ggplot2_4.0.3
## [73] scales_1.4.0 gtools_3.9.5
## [75] glue_1.8.1 maketools_1.3.2
## [77] tools_4.6.1 sys_3.4.3
## [79] locfit_1.5-9.12 buildtools_1.0.0
## [81] cowplot_1.2.0 grid_4.6.1
## [83] tidyr_1.3.2 AnnotationDbi_1.74.0
## [85] edgeR_4.10.1 colorspace_2.1-3
## [87] nlme_3.1-169 cli_3.6.6
## [89] S4Arrays_1.12.0 ggdendro_0.2.0
## [91] ComplexHeatmap_2.28.0 dplyr_1.2.1
## [93] gtable_0.3.6 logging_0.10-111
## [95] sass_0.4.10 digest_0.6.39
## [97] SparseArray_1.12.2 ggrepel_0.9.8
## [99] rjson_0.2.23 farver_2.1.2
## [101] memoise_2.0.1 htmltools_0.5.9
## [103] lifecycle_1.0.5 httr_1.4.8
## [105] GlobalOptions_0.1.4 statmod_1.5.2
## [107] MASS_7.3-65 bit64_4.8.2