| Title: | Kernel-Based Analysis of Biological Sequences |
|---|---|
| Description: | The package provides functionality for kernel-based analysis of DNA, RNA, and amino acid sequences via SVM-based methods. As core functionality, kebabs implements following sequence kernels: spectrum kernel, mismatch kernel, gappy pair kernel, and motif kernel. Apart from an efficient implementation of standard position-independent functionality, the kernels are extended in a novel way to take the position of patterns into account for the similarity measure. Because of the flexibility of the kernel formulation, other kernels like the weighted degree kernel or the shifted weighted degree kernel with constant weighting of positions are included as special cases. An annotation-specific variant of the kernels uses annotation information placed along the sequence together with the patterns in the sequence. The package allows for the generation of a kernel matrix or an explicit feature representation in dense or sparse format for all available kernels which can be used with methods implemented in other R packages. With focus on SVM-based methods, kebabs provides a framework which simplifies the usage of existing SVM implementations in kernlab, e1071, and LiblineaR. Binary and multi-class classification as well as regression tasks can be used in a unified way without having to deal with the different functions, parameters, and formats of the selected SVM. As support for choosing hyperparameters, the package provides cross validation - including grouped cross validation, grid search and model selection functions. For easier biological interpretation of the results, the package computes feature weights for all SVMs and prediction profiles which show the contribution of individual sequence positions to the prediction result and indicate the relevance of sequence sections for the learning result and the underlying biological functions. |
| Authors: | Johannes Palme [aut], Ulrich Bodenhofer [aut, cre, ths] |
| Maintainer: | Ulrich Bodenhofer <[email protected]> |
| License: | GPL (>= 2.1) |
| Version: | 1.46.0 |
| Built: | 2026-05-29 06:08:51 UTC |
| Source: | https://github.com/bioc/kebabs |
Create an object containing a set of DNA-, RNA- or amino acid sequences
## Constructors: RNAVector(x = character()) AAVector(x = character()) ## Accessor-like methods: see below ## S4 method for signature 'BioVector,index,missing,ANY' x[i] ## S4 method for signature 'BioVector' as.character(x, use.names = TRUE)## Constructors: RNAVector(x = character()) AAVector(x = character()) ## Accessor-like methods: see below ## S4 method for signature 'BioVector,index,missing,ANY' x[i] ## S4 method for signature 'BioVector' as.character(x, use.names = TRUE)
x |
character vector containing a set of sequences as uppercase characters or in mixed uppercase/lowercase form. |
i |
numeric vector with indicies or character with element names |
use.names |
when set to |
The class DNAVector is used for storing DNA sequences,
RNAVector for RNA sequences and AAVector for
amino acid sequences. The class BioVector is derived from
the R base type character representing a vector of character
strings. It is an abstract class which can not be instantiated.
BioVector is the parent class for DNAVector, RNAVector
and AAVector. For the three derived classes identically named
functions exist which are constructors. It should be noted that the
constructors only wrap the sequence data into a class without copying or
recoding the data.
The functions provided for DNAVector, RNAVector and
AAVector classes are only a very small subset compared to those
of XStringSet but are designed along their counterparts
from the Biostrings package. Assignment of metadata
and element metadata via mcols is supported for the
DNAVector, RNAVector and AAVector objects similar to
objects of XStringSet derived classes (for details on metadata
assignment see annotationMetadata and
positionMetadata).
In contrast to XStringSet the BioVector derived classes
also support the storage of lowercase characters. This can be relevant
for repeat regions which are often coded in lowercase characters. During
the creation of XStringSet derived classes the lowercase
characters are converted to uppercase automatically and the information
about repeat regions is lost. For BioVector derived classes the
user can specify during creation of a sequence kernel object whether
lowercase characters should be included as uppercase characters or
whether repeat regions should be ignored during sequence analysis.
In this way it is possible to perform both types of analysis on the same
set of sequences through defining one kernel object which accepts lowercase
characters and another one which ignores them.
constructors DNAVector, RNAVector, AAVector return a
sequence set of identical class name
In the code snippets below, x is a BioVector.
length(x)gives the number of sequences in x.
width(x)provides vector of integer values with the number of bases/amino acids for each sequence in the set.
names(x)provides character vector of sample names.
In the code snippets below, x is a BioVector.
x[i]returns a BioVector object that only contains the samples selected
with the subsetting parameter i. This parameter can be a numeric
vector with indices or a character vector which is matched against the
names of x. Element related metadata is subsetted accordingly if
available.
c(x, ...)returns a sequence set that is a concatination of the given sequence sets.
In the code snippets below, x is a BioVector.
as.character(x, use.names=TRUE)returns the sequence set as named or unnamed character vector dependent on
the use.names parameter.
Sequence data can be processed by KeBABS in XStringSet and BioVector based
format. Within KeBABS except for treatment of lowercase characters both
formats are equivalent. It is recommended to use XStringSet
based formats whenever the support of lowercase characters is not of
interest because these classes provide in general much richer functionality
than the BioVector classes. String kernels provided in the
kernlab package (see stringdot) do not
support XStringSet derived objects. The usage of these kernels
is possible in KeBABS with sequence data in BioVector based format.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
metadata, elementMetadata,
XStringSet, DNAStringSet,
RNAStringSet, AAStringSet
## in general DNAStringSet should be prefered as described above ## create DNAStringSet object for a set of sequences x <- DNAStringSet(c("AACCGCGATTATCGatatatatatatatatTGGAAGCTAGGACTA", "GACTTACCCgagagagagagagaCATGAGAGGGAAGCTAGTA")) ## assign names to the sequences names(x) <- c("Sample1", "Sample2") ## to show the different handling of lowercase characters ## create DNAVector object for the same set of sequences and assign names xv <- DNAVector(c("AACCGCGATTATCGatatatatatatatatTGGAAGCTAGGACTA", "GACTTACCCgagagagagagagaCATGAGAGGGAAGCTAGTA")) names(xv) <- c("Sample1", "Sample2") ## show DNAStringSet object - lowercase characters were translated x ## in the DNAVector object lowercase characters are unmodified ## their handling can be defined at the level of the sequence kernel xv ## show number of the sequences in the set and their number of characters length(xv) width(xv) nchar(xv)## in general DNAStringSet should be prefered as described above ## create DNAStringSet object for a set of sequences x <- DNAStringSet(c("AACCGCGATTATCGatatatatatatatatTGGAAGCTAGGACTA", "GACTTACCCgagagagagagagaCATGAGAGGGAAGCTAGTA")) ## assign names to the sequences names(x) <- c("Sample1", "Sample2") ## to show the different handling of lowercase characters ## create DNAVector object for the same set of sequences and assign names xv <- DNAVector(c("AACCGCGATTATCGatatatatatatatatTGGAAGCTAGGACTA", "GACTTACCCgagagagagagagaCATGAGAGGGAAGCTAGTA")) names(xv) <- c("Sample1", "Sample2") ## show DNAStringSet object - lowercase characters were translated x ## in the DNAVector object lowercase characters are unmodified ## their handling can be defined at the level of the sequence kernel xv ## show number of the sequences in the set and their number of characters length(xv) width(xv) nchar(xv)
BioVector, DNAVector, RNAVector and AAVector Classes
This class is the parent class for representing sets of biological
sequences with support of lowercase characters. The derived classes
DNAVector, RNAVector and
AAVector hold DNA-, RNA- or AA-sequences which can
contain also lowercase characters. In many cases repeat regions are coded
as lowercase characters and with the BioVector based
classes sequence analysis with and without repeat regions can be performed
from the same sequence set. Whenever lowercase is not needed please use the
XStringSet based classes as they provide much richer
functionality. The class BioVector is derived from "character" and
holds the sequence information as character vector. Interfaces for the
small set of functions needed in KeBABS are designed consistent with
XStringSet.
Instances of the DNAVector class are used for representing sets of
DNA sequences.
Instances of the RNAVector class are used for representing sets of
RNA sequences.
Instances of the AAVector class are used for representing sets of
amino acid sequences.
NAMESsequence names
elementMetadataelement metadata, which is applicable per element and holds a DataFrame with one entry per sequence in each column. KeBABS uses the column names "annotation" and "offset".
metadatametadata applicable for the entire sequence set as list. KeBABS stores the annotation character set as list element named "annotationCharset".
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
Compute the receiver operating characteristic (ROC) and area under the ROC curve (AUC) as performance measure for binary classification
computeROCandAUC(prediction, labels, allLabels = NULL)computeROCandAUC(prediction, labels, allLabels = NULL)
prediction |
prediction results in the form of decision values as
returned by |
labels |
label vector of same length as parameter 'prediction'. |
allLabels |
vector containing all occuring labels once. This parameter is required only if the labels parameter is not a factor. Default=NULL |
For binary classfication this function computes the receiver operating curve (ROC) and the area under the ROC curve (AUC).
On successful completion the function returns an object of class
ROCData containing the AUC, a numeric vector of
TPR values and a numeric vector containing the FPR values. If the ROC and
AUC cannot be computed because of missing positive or negative samples the
function returns 3 NA values.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## load transcription factor binding site data data(TFBS) enhancerFB ## select 70% of the samples for training and the rest for test train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) test <- c(1:length(enhancerFB))[-train] ## create the kernel object for gappy pair kernel with normalization gappy <- gappyPairKernel(k=1, m=3) ## show details of kernel object gappy ## run training with explicit representation model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="LiblineaR", svm="C-svc", cost=80, explicit="yes", featureWeights="no") ## predict the test sequences pred <- predict(model, enhancerFB[test]) ## print prediction performance evaluatePrediction(pred, yFB[test], allLabels=unique(yFB)) ## compute ROC and AUC preddec <- predict(model, enhancerFB[test], predictionType="decision") rocdata <- computeROCandAUC(preddec, yFB[test], allLabels=unique(yFB)) ## show AUC value rocdata ## Not run: ## plot ROC plot(rocdata) ## End(Not run)## load transcription factor binding site data data(TFBS) enhancerFB ## select 70% of the samples for training and the rest for test train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) test <- c(1:length(enhancerFB))[-train] ## create the kernel object for gappy pair kernel with normalization gappy <- gappyPairKernel(k=1, m=3) ## show details of kernel object gappy ## run training with explicit representation model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="LiblineaR", svm="C-svc", cost=80, explicit="yes", featureWeights="no") ## predict the test sequences pred <- predict(model, enhancerFB[test]) ## print prediction performance evaluatePrediction(pred, yFB[test], allLabels=unique(yFB)) ## compute ROC and AUC preddec <- predict(model, enhancerFB[test], predictionType="decision") rocdata <- computeROCandAUC(preddec, yFB[test], allLabels=unique(yFB)) ## show AUC value rocdata ## Not run: ## plot ROC plot(rocdata) ## End(Not run)
KeBABS Control Information Class
Instances of this class store control information for the KeBABS meta-SVM.
classificationindicator for classification task
multiclassTypetype of multiclass SVM
featureWeightsfeature weights control information
selMethodselected processing method
onlyDenseindicator that only dense processing can be performed
sparseindicator for sparse processing
runtimeWarningindicator for runtime warning
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
Cross Validation Result Class
Instances of this class store the result of cross validation.
crossnumber of folds for cross validation
noCrossnumber of CV runs
groupBygroup assignment of samples
perfParameterscollected performance parameters
outerCVflag indicating outer CV
foldsfolds used in CV
cvErrorcross validation error
foldErrorsfold errors
noSVnumber of support vectors
ACCcross validation accuracy
BACCcross validation balanced accuracy
MCCcross validation Matthews correlation coefficient
AUCcross validation area under the ROC curve
foldACCfold accuracy
foldBACCfold balanced accuracy
foldMCCfold Matthews correlation coefficient
foldAUCfold area under the ROC curve
sumAlphassum of alphas
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
CrossValidationResult Accessors
## S4 method for signature 'CrossValidationResult' folds(object)## S4 method for signature 'CrossValidationResult' folds(object)
object |
a cross validation result object (can be extracted from
KeBABS model with accessor |
folds: returns the folds used in CVperformance: returns a list with the performance values
foldsreturns the CV folds.
performancereturns the collected performance parameters.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## create kernel object for normalized spectrum kernel specK5 <- spectrumKernel(k=5) ## Not run: ## load data data(TFBS) ## perform training - feature weights are computed by default model <- kbsvm(enhancerFB, yFB, specK5, pkg="LiblineaR", svm="C-svc", cross=10, cost=15, perfParameters="ALL") ## show model selection result cvResult(model) ## extract fold AUC performance(cvResult(model))$foldAUC ## End(Not run)## create kernel object for normalized spectrum kernel specK5 <- spectrumKernel(k=5) ## Not run: ## load data data(TFBS) ## perform training - feature weights are computed by default model <- kbsvm(enhancerFB, yFB, specK5, pkg="LiblineaR", svm="C-svc", cross=10, cost=15, perfParameters="ALL") ## show model selection result cvResult(model) ## extract fold AUC performance(cvResult(model))$foldAUC ## End(Not run)
Evaluate performance results of prediction on a testset based on given labels for binary classification
evaluatePrediction(prediction, label, allLabels = NULL, decValues = NULL, print = TRUE, confmatrix = TRUE, numPrecision = 3, numPosNegTrainSamples = numeric(0))evaluatePrediction(prediction, label, allLabels = NULL, decValues = NULL, print = TRUE, confmatrix = TRUE, numPrecision = 3, numPosNegTrainSamples = numeric(0))
prediction |
prediction results as returned by |
label |
label vector of same length as parameter 'prediction'. |
allLabels |
vector containing all occuring labels once. This parameter is required only if the label vector is numeric. Default=NULL |
decValues |
numeric vector containing decision values for the
predictions as returned by the |
print |
This parameter indicates whether performance values should be printed or returned as data frame without printing (for details see below). Default=TRUE |
confmatrix |
When set to TRUE a confusion matrix is printed. The rows correspond to predictions, the columns to the true labels. Default=TRUE |
numPrecision |
minimum number of digits to the right of the decimal point. Values between 0 and 20 are allowed. Default=3 |
numPosNegTrainSamples |
optional integer vector with two values giving the number of positive and negative training samples. When this parameter is set the balancedness of the training set is reported. Default=numeric(0) |
For binary classfication this function computes the performance measures
accuracy, balanced accuracy, sensitivity, specificity, precision and the
Matthews Correlation Coefficient(MCC). If decision values are passed in the
parameter decValues the function additionally determines the AUC.
When the number of positive and negative training samples is passed to
the function it also shows the balancedness of the training set. The
performance results are either printed by the routine directly or returned
in a data frame. The columns of the data frame are:
| column name | performance measure |
| -------------------- | -------------- |
| TP | true positive |
| FP | false positive |
| FN | false negative |
| TN | true negative |
| ACC | accuracy |
| BAL_ACC | balanced accuracy |
| SENS | sensitivity |
| SPEC | specificity |
| PREC | precision |
| MAT_CC | Matthews correlation coefficient |
| AUC | area under ROC curve |
| PBAL | prediction balancedness (fraction of positive samples) |
| TBAL | training balancedness (fraction of positive samples) |
When the parameter 'print' is set to FALSE the function returns a data frame containing the prediction performance values (for details see above).
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## set seed for random generator, included here only to make results ## reproducable for this example set.seed(456) ## load transcription factor binding site data data(TFBS) enhancerFB ## select 70% of the samples for training and the rest for test train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) test <- c(1:length(enhancerFB))[-train] ## create the kernel object for gappy pair kernel with normalization gappy <- gappyPairKernel(k=1, m=3) ## show details of kernel object gappy ## run training with explicit representation model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="LiblineaR", svm="C-svc", cost=80, explicit="yes", featureWeights="no") ## predict the test sequences pred <- predict(model, enhancerFB[test]) ## print prediction performance evaluatePrediction(pred, yFB[test], allLabels=unique(yFB)) ## Not run: ## print prediction performance including AUC ## additionally determine decision values preddec <- predict(model, enhancerFB[test], predictionType="decision") evaluatePrediction(pred, yFB[test], allLabels=unique(yFB), decValues=preddec) ## print prediction performance including training set balance trainPosNeg <- c(length(which(yFB[train] == 1)), length(which(yFB[train] == -1))) evaluatePrediction(pred, yFB[test], allLabels=unique(yFB), numPosNegTrainSamples=trainPosNeg) ## or get prediction performance as data frame perf <- evaluatePrediction(pred, yFB[test], allLabels=unique(yFB), print=FALSE) ## show performance values in data frame perf ## End(Not run)## set seed for random generator, included here only to make results ## reproducable for this example set.seed(456) ## load transcription factor binding site data data(TFBS) enhancerFB ## select 70% of the samples for training and the rest for test train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) test <- c(1:length(enhancerFB))[-train] ## create the kernel object for gappy pair kernel with normalization gappy <- gappyPairKernel(k=1, m=3) ## show details of kernel object gappy ## run training with explicit representation model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="LiblineaR", svm="C-svc", cost=80, explicit="yes", featureWeights="no") ## predict the test sequences pred <- predict(model, enhancerFB[test]) ## print prediction performance evaluatePrediction(pred, yFB[test], allLabels=unique(yFB)) ## Not run: ## print prediction performance including AUC ## additionally determine decision values preddec <- predict(model, enhancerFB[test], predictionType="decision") evaluatePrediction(pred, yFB[test], allLabels=unique(yFB), decValues=preddec) ## print prediction performance including training set balance trainPosNeg <- c(length(which(yFB[train] == 1)), length(which(yFB[train] == -1))) evaluatePrediction(pred, yFB[test], allLabels=unique(yFB), numPosNegTrainSamples=trainPosNeg) ## or get prediction performance as data frame perf <- evaluatePrediction(pred, yFB[test], allLabels=unique(yFB), print=FALSE) ## show performance values in data frame perf ## End(Not run)
Explicit Representation Dense and Sparse Classes
In KeBABS this class is the virtual parent class for explicit representations
generated from a set of biological sequences for a given kernel. The derived
classes ExplicitRepresentationDense and
ExplicitRepresentationSparse are meant to hold explicit
representations in dense or sparse format. The kernel used to generate the
explicit representation is stored together with the data.
Instances of this class are used for storing explicit representations
in dense matrix format. This class is derived from
ExplicitRepresentation.
Instances of this class are used for storing explicit representations
in sparse dgRMatrix format. This class is derived from
ExplicitRepresentation.
usedKernelkernel used for generating the explicit representation
quadraticboolean indicating a quadratic explicit representation
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
ExplicitRepresentation Accessors
## S4 methods for signature 'ExplicitRepresentation' ## x[i,j] ## further methods see below ## S4 method for signature 'matrix,dgRMatrix' x %*% y ## S4 method for signature 'dgRMatrix,numeric' x %*% y## S4 methods for signature 'ExplicitRepresentation' ## x[i,j] ## further methods see below ## S4 method for signature 'matrix,dgRMatrix' x %*% y ## S4 method for signature 'dgRMatrix,numeric' x %*% y
x |
an explicit representation in dense or sparse format |
i |
integer vector or character vector with a subset of the sample indices or names |
y |
in the first case and explicit representation and |
j |
integer vector or character vector with a subset of the feature indices or names |
see details above
x[i, ]returns a KernelMatrix object that only contains the rows selected
with the subsetting parameter i. This parameter can be a numeric
vector with indices or a character vector which is matched against the
names of x.
x[ ,j]returns a KernelMatrix object that only contains the columns
selected with the subsetting parameter j. This parameter can be a
numeric vector with indices or a character vector which is matched against
the names of x.
x[i, j]returns a KernelMatrix object that only contains the rows selected
with the subsetting parameter i and columns selected by j.
Both parameters can be a numeric vector with indices or a character vector
which is matched against the names of x.
%*%this operator provides the multiplication of a dgRMatrix or
a sparse explicit representation (which is derived from dgRMatrix)
with a matrix or a vector. This functionality is not available in package
Matrix for a dgRMatrix.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
Create a gappy pair kernel object and the kernel matrix
gappyPairKernel(k = 1, m = 1, r = 1, annSpec = FALSE, distWeight = numeric(0), normalized = TRUE, exact = TRUE, ignoreLower = TRUE, presence = FALSE, revComplement = FALSE, mixCoef = numeric(0)) ## S4 method for signature 'GappyPairKernel' getFeatureSpaceDimension(kernel, x)gappyPairKernel(k = 1, m = 1, r = 1, annSpec = FALSE, distWeight = numeric(0), normalized = TRUE, exact = TRUE, ignoreLower = TRUE, presence = FALSE, revComplement = FALSE, mixCoef = numeric(0)) ## S4 method for signature 'GappyPairKernel' getFeatureSpaceDimension(kernel, x)
k |
length of the substrings (also called kmers) which are considered in pairs by this kernel. This parameter together with parameter m (see below) defines the size of the feature space, i.e. the total number of features considered in this kernel is (|A|^(2*k))*(m+1), with |A| as the size of the alphabet (4 for DNA and RNA sequences and 21 for amino acid sequences). Sequences with a total number of characters shorter than 2 * k + m will be accepted but not all possible patterns of the feature space can be taken into account. When multiple kernels with different k and/or m values should be generated, e.g. for model selection an integer vector can be specified instead of a single numeric values. In this case a list of kernel objects with the individual values from the integer vector of parameter k is generated as result. The processing effort for this kernel is highly dependent on the value of k because of the additional factor 2 in the exponent for the feature space size) and only small values of k will allow efficient processing. Default=1 |
m |
maximal number of irrelevant positions between a pair of kmers. The value of m must be an integer value larger than 0. For example a value of m=2 means that zero, one or two irrelevant positions between kmer pairs are considered as valid features. (A value of 0 corresponds to the spectrum kernel with a kmer length of 2*k and is not allowed for the gappy pair kernel). When an integer vector is specified a list of kernels is generated as described above for parameter k. If multiple values are specified both for parameter k and parameter m one kernel object is created for each of the combinations of k and m. Default=1 |
r |
exponent which must be > 0 (see details section in spectrumKernel). Default=1 |
annSpec |
boolean that indicates whether sequence annotation should
be taken into account (details see on help page for
|
distWeight |
a numeric distance weight vector or a distance weighting
function (details see on help page for |
normalized |
generated data from this kernel will be normalized (details see below). Default=TRUE |
exact |
use exact character set for the evaluation (details see below). Default=TRUE |
ignoreLower |
ignore lower case characters in the sequence. If the parameter is not set lower case characters are treated like uppercase. Default=TRUE |
presence |
if this parameter is set only the presence of a kmers will be considered, otherwise the number of occurances of the kmer is used. Default=FALSE |
revComplement |
if this parameter is set a kmer pair and its reverse complement are treated as the same feature. Default=FALSE |
mixCoef |
mixing coefficients for the mixture variant of the gappy pair kernel. A numeric vector of length k is expected for this parameter with the unused components in the mixture set to 0. Default=numeric(0) |
kernel |
a sequence kernel object |
x |
one or multiple biological sequences in the form of a
|
Creation of kernel object
The function 'gappyPairKernel' creates a kernel object for the gappy pair
kernel. This kernel object can then be used with a set of DNA-, RNA- or
AA-sequences to generate a kernel matrix or an explicit representation for
this kernel. The gappy pair kernel uses pairs of neighboring subsequences
of length k (kmers) with up to m irrelevant positions between the kmers. For
sequences shorter than 2*k the self similarity (i.e. the value on the main
diagonal in the square kernel matrix) is 0. The explicit representation
contains only zeros for such a sample. Dependent on the learning task it
might make sense to remove such sequences from the data set as they do not
contribute to the model but still influence performance values.
For values different from 1 (=default value) parameter r
leads to a transfomation of similarities by taking each element of the
similarity matrix to the power of r. If normalized=TRUE, the feature
vectors are scaled to the unit sphere before computing the similarity value
for the kernel matrix. For two samples with the feature vectors x
and y the similarity is computed as:
For an explicit representation generated with the feature map of a
normalized kernel the rows are normalized by dividing them through their
Euclidean norm. For parameter exact=TRUE the sequence characters
are interpreted according to an exact character set. If the flag is not
set ambigous characters from the IUPAC characterset are also evaluated.
The annotation specific variant (for details see
annotationMetadata) and the position dependent variants (for
details see positionMetadata) either in the form of a position
specific or a distance weighted kernel are supported for the gappy
pair kernel. The generation of an explicit representation is not possible
for the position dependent variants of this kernel.
Creation of kernel matrix
The kernel matrix is created with the function getKernelMatrix
or via a direct call with the kernel object as shown in the examples below.
gappyPairKernel: upon successful completion, the function returns a kernel
object of class GappyPairKernel.
of getDimFeatureSpace: dimension of the feature space as numeric value
Johannes Palme
https://github.com/UBod/kebabs
C.C. Mahrenholz, I.G. Abfalter, U. Bodenhofer, R. Volkmer and
S. Hochreiter (2011) Complex networks govern coiled coil
oligomerization - predicting and profiling by means of a machine
learning approach. Mol. Cell. Proteomics, 10(5):M110.004994.
DOI: doi:10.1074/mcp.M110.004994.
U. Bodenhofer, K. Schwarzbauer, M. Ionescu, and
S. Hochreiter (2009)
Modelling position specificity in sequence kernels by fuzzy
equivalence relations. Proc. Joint 13th IFSA World Congress and 6th
EUSFLAT Conference, pp. 1376-1381, Lisbon.
P. Kuksa, P.-H. Huang and V. Pavlovic (2008) Fast Protein Homology
and Fold Detection with Sparse Spatial Sample Kernels.
Proc. 8th Int. Workshop on Data Mining in Bioinformatics,
pp. 29-37.
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
getKernelMatrix, getExRep,
kernelParameters-method, spectrumKernel,
mismatchKernel, motifKernel,
GappyPairKernel
## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created ## RNA- or AA-sequences can be used as well with the gappy pair kernel dnaseqs <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC")) names(dnaseqs) <- paste("S", 1:length(dnaseqs), sep="") ## create the kernel object for dimer pairs with up to ten irrelevant ## position between the kmers of the pair without normalization gappy <- gappyPairKernel(k=2, m=10, normalized=FALSE) ## show details of kernel object gappy ## generate the kernel matrix with the kernel object km <- gappy(dnaseqs) dim(km) km[1:5,1:5] ## alternative way to generate the kernel matrix km <- getKernelMatrix(gappy, dnaseqs) km[1:5,1:5] ## Not run: ## plot heatmap of the kernel matrix heatmap(km, symm=TRUE) ## End(Not run)## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created ## RNA- or AA-sequences can be used as well with the gappy pair kernel dnaseqs <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC")) names(dnaseqs) <- paste("S", 1:length(dnaseqs), sep="") ## create the kernel object for dimer pairs with up to ten irrelevant ## position between the kmers of the pair without normalization gappy <- gappyPairKernel(k=2, m=10, normalized=FALSE) ## show details of kernel object gappy ## generate the kernel matrix with the kernel object km <- gappy(dnaseqs) dim(km) km[1:5,1:5] ## alternative way to generate the kernel matrix km <- getKernelMatrix(gappy, dnaseqs) km[1:5,1:5] ## Not run: ## plot heatmap of the kernel matrix heatmap(km, symm=TRUE) ## End(Not run)
Gappy Pair Kernel Class
Instances of this class represent a kernel object for the gappy pair kernel. The kernel considers adjacent pairs of kmers with up to m irrelevant characters between the pair. The class is derived from SequenceKernel.
klength of the substrings considered by the kernel
mmaximum number of irrelevant character between two kmers
rexponent (for details see gappyPairKernel)
annSpecwhen set the kernel evaluates annotation information
distWeightdistance weighting function or vector
normalizeddata generated with this kernel object is normalized
exactuse exact character set for evaluation
ignoreLowerignore lower case characters in the sequence
presenceconsider only the presence of kmers not their counts
revComplementconsider a kmer and its reverse complement as the same feature
mixCoefmixing coefficients for mixture kernel
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
Generate biological sequences with uniform random distribution of alphabet characters.
genRandBioSeqs(seqType = c("DNA", "RNA", "AA"), numSequences, seqLength, biostring = TRUE, seed)genRandBioSeqs(seqType = c("DNA", "RNA", "AA"), numSequences, seqLength, biostring = TRUE, seed)
seqType |
defines the type of sequence as DNA, RNA or AA and the underlying alphabet. Default="DNA" |
numSequences |
single numeric value which specifies the number of sequences that should be generated. |
seqLength |
either a single numeric value or a numeric vector of length 'numSequences' which gives the length of the sequences to be generated. |
biostring |
if |
seed |
when present the random generator will be seeded with the value passed in this parameter |
The function generates a set of sequences with uniform distribution of
alphabet characters and returns it as XStringSet or BioVector dependent on
the parameter biostring.
When the parameter 'biostring' is set to FALSE the function returns a XStringSet derived class otherwise a BioVector derived class.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## generate a set of AA sequences of fixed length as AAStringSet aaseqs <- genRandBioSeqs("AA", 100, 1000, biostring=TRUE) ## show AA sequence set aaseqs ## Not run: ## generate a set of "DNA" sequences as DNAStringSet with uniformly ## distributed lengths between 1500 and 3000 bases seqLength <- runif(300, min=1500, max=3500) dnaseqs <- genRandBioSeqs("DNA", 100, seqLength, biostring=TRUE) ## show DNA sequence set dnaseqs ## End(Not run)## generate a set of AA sequences of fixed length as AAStringSet aaseqs <- genRandBioSeqs("AA", 100, 1000, biostring=TRUE) ## show AA sequence set aaseqs ## Not run: ## generate a set of "DNA" sequences as DNAStringSet with uniformly ## distributed lengths between 1500 and 3000 bases seqLength <- runif(300, min=1500, max=3500) dnaseqs <- genRandBioSeqs("DNA", 100, seqLength, biostring=TRUE) ## show DNA sequence set dnaseqs ## End(Not run)
Create an explicit representation
getExRep(x, kernel = spectrumKernel(), sparse = TRUE, zeroFeatures = FALSE, features = NULL, useRowNames = TRUE, useColNames = TRUE, selx = NULL) getExRepQuadratic(exRepLin, useRowNames = TRUE, useColNames = TRUE, zeroFeatures = FALSE)getExRep(x, kernel = spectrumKernel(), sparse = TRUE, zeroFeatures = FALSE, features = NULL, useRowNames = TRUE, useColNames = TRUE, selx = NULL) getExRepQuadratic(exRepLin, useRowNames = TRUE, useColNames = TRUE, zeroFeatures = FALSE)
x |
one or multiple biological sequences in the form of a
|
kernel |
a sequence kernel object. The feature map of this kernel object is used to generate the explicit representation. |
sparse |
boolean that indicates whether a sparse or dense explicit representation should be generated. Default=TRUE |
zeroFeatures |
indicates whether columns with zero feature counts across all samples should be included in the explicit representation. (see below) Default=FALSE |
features |
feature subset of the specified kernel in the form of a character vector. When a feature subset is passed to the function all other features in the feature space are not considered for the explicit representation. (see below) |
useRowNames |
if this parameter is set the sample names will be set as row names if available in the provided sequence set. Default=TRUE |
useColNames |
if this parameter is set the features will be set as column names in the explicit representation. Default=TRUE |
selx |
subset of indices into |
exRepLin |
a linear explicit representation |
Creation of an explicit representation
The function 'getExRep' creates an explicit representation of the given
sequence set using the feature map of the specified kernel. It contains
the feature counts in a matrix format. The rows of the matrix represent
the samples, the columns the features. For a dense explicit representation
of class ExplicitRepresentationDense the count data
is stored in a dense matrix. To allow efficient storage all features that
do not occur in the sequence set are removed from the explicit
representation by default. When the parameter zeroFeatures is set
to TRUE these features are also included resulting an explicit
representation which contains the full feature space. For feature spaces
larger than one million features the inclusion of zero features is not
possible.
In case of large feature spaces a sparse explicit representation of class
ExplicitRepresentationSparse is much more efficient
by storing the count data as dgRMatrix from package Matrix).
The class ExplicitRepresentationSparse
is derived from dgRMatrix. As zero features are not stored in a
sparse matrix the flag zeroFeatures only controls whether the
column names of features not occuring in the sequences are included or
not.
Both the dense and the sparse explicit representation also contain the
kernel object which was used for it's creation. For an explicit
representation without zero features column names are mandatory.
An explicit representation can be created for position independent and
annotation specific kernel variants (for details see
annotationMetadata). In annotation specific kernels the
annotation characters are included as postfix in the features. For kernels
with normalization the explicit representation is normalized resulting in
row vectors normalized to the unit sphere. For feature subsets used with
normalized kernels all features of the feature space are used in the
normalization.
Usage of explicit representations
Learning with linear SVMs (e.g. ksvmin package
kernlab or svm in package e1071) can be
performed either through passing a kernel matrix of similarity values or
an explicit representation and a linear kernel to the SVM. The SVMs in
package kernlab support a dense explicit representation or kernel
matrix as data representations. The SVMs in packages e1071) and
LiblineaR support dense or sparse explicit representations.
In many cases there can be considerable performance differences between
the two variants of passing data to the SVM. And especially for larger
feature spaces the sparse explicit representation not only brings higher
memory efficiency but also leads to drastically improved runtimes during
training and prediction. Starting with kebabs version 1.2.0 kernel matrix
support is also available for package e1071 via the dense LIBSVM
implementation integrated in package kebabs.
In general all of the complexity of converting the sequences with a specific
kernel to an explicit representation or a kernel matrix and adapting the
formats and parameters to the specific SVM is hidden within the KeBABS
training and predict methods (see kbsvm,
predict) and the user can concentrate on the actual data
analysis task. During training via kbsvm the parameter
explicit controls the training via kernel matrix or explicit
representation and the parameter explicitType determines whether a
dense or sparse explicit representation is used. Manual generation of
explicit representations is only necessary for usage with other learners
or analysis methods not supported by KeBABS.
Quadratic explicit representation
The package LiblineaR only provides linear SVMs which are tuned for
efficient processing of larger feature spaces and sample numbers. To allow
the use of a quadratic kernel on these SVMs a quadratic explicit
representation can be generated from the linear explicit representation.
It contains counts for feature pairs and the features combined to one pair
are separated by '_' in the column names of the quadratic explicit
representation. Please be aware that the dimensionality for a quadratic
explicit representation increases considerably compared to the linear one.
In the other SVMs a linear explicit representation together with a quadratic
kernel is used instead. In training via kbsvm the use
of a linear representation with a quadratic kernel or a quadratic explicit
representation instead is indicated through setting the parameter
featureType to the value "quadratic".
getExRep: upon successful completion, dependent on the flag sparse
the function returns either a dense explicit representation of class
ExplicitRepresentationDense or a sparse explicit
representation of class ExplicitRepresentationSparse.
getExRepQuadratic: upon successful completion, the function returns a quadratic explicit representation
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
ExplicitRepresentationDense,
ExplicitRepresentationSparse,
getKernelMatrix, kernelParameters-method,
SpectrumKernel, mismatchKernel,
gappyPairKernel, motifKernel
## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created ## RNA- or AA-sequences can be used as well with the spectrum kernel dnaseqs <- DNAStringSet(c("AGACTTAAGGGACCTGGACACCACACTCAGCTAGGGGGACTGGGAGC", "ATAAAGGGAGCAGACATCATGACCTTTTTGACCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACTGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCCTTACCTGCCATACAGGATAGGGCCACTGCCC", "ATAAAGGATGCAGACATCATGGCCTTTTTGACCCTAATTATTTCAGC")) names(dnaseqs) <- paste("S", 1:length(dnaseqs), sep="") ## create the kernel object for dimers with normalization speck <- spectrumKernel(k=2) ## show details of kernel object speck ## generate the dense explicit representation for the kernel erd <- getExRep(dnaseqs, speck, sparse=FALSE) dim(erd) erd[1:5,] ## generate the dense explicit representation with zero features erd <- getExRep(dnaseqs, speck, sparse=FALSE, zeroFeatures=TRUE) dim(erd) erd[1:5,] ## generate the sparse explicit representation for the kernel ers <- getExRep(dnaseqs, speck) dim(ers) ers[1:5,] ## generate the sparse explicit representation with zero features ers <- getExRep(dnaseqs, speck, zeroFeatures=TRUE) dim(ers) ers[1:5,] ## generate the quadratic explicit representation erdq <- getExRepQuadratic(erd) dim(erdq) erdq[1:5,1:15] ## Not run: ## run taining and prediction with dense linear explicit representation data(TFBS) enhancerFB train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) test <- c(1:length(enhancerFB))[-train] model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=speck, pkg="LiblineaR", svm="C-svc", cost=10, explicit="yes", explicitType="dense") pred <- predict(model, x=enhancerFB[test]) evaluatePrediction(pred, yFB[test], allLabels=unique(yFB)) ## run taining and prediction with sparse linear explicit representation model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=speck, pkg="LiblineaR", svm="C-svc", cost=10, explicit="yes", explicitType="sparse") pred <- predict(model, x=enhancerFB[test]) evaluatePrediction(pred, yFB[test], allLabels=unique(yFB)) ## End(Not run)## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created ## RNA- or AA-sequences can be used as well with the spectrum kernel dnaseqs <- DNAStringSet(c("AGACTTAAGGGACCTGGACACCACACTCAGCTAGGGGGACTGGGAGC", "ATAAAGGGAGCAGACATCATGACCTTTTTGACCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACTGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCCTTACCTGCCATACAGGATAGGGCCACTGCCC", "ATAAAGGATGCAGACATCATGGCCTTTTTGACCCTAATTATTTCAGC")) names(dnaseqs) <- paste("S", 1:length(dnaseqs), sep="") ## create the kernel object for dimers with normalization speck <- spectrumKernel(k=2) ## show details of kernel object speck ## generate the dense explicit representation for the kernel erd <- getExRep(dnaseqs, speck, sparse=FALSE) dim(erd) erd[1:5,] ## generate the dense explicit representation with zero features erd <- getExRep(dnaseqs, speck, sparse=FALSE, zeroFeatures=TRUE) dim(erd) erd[1:5,] ## generate the sparse explicit representation for the kernel ers <- getExRep(dnaseqs, speck) dim(ers) ers[1:5,] ## generate the sparse explicit representation with zero features ers <- getExRep(dnaseqs, speck, zeroFeatures=TRUE) dim(ers) ers[1:5,] ## generate the quadratic explicit representation erdq <- getExRepQuadratic(erd) dim(erdq) erdq[1:5,1:15] ## Not run: ## run taining and prediction with dense linear explicit representation data(TFBS) enhancerFB train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) test <- c(1:length(enhancerFB))[-train] model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=speck, pkg="LiblineaR", svm="C-svc", cost=10, explicit="yes", explicitType="dense") pred <- predict(model, x=enhancerFB[test]) evaluatePrediction(pred, yFB[test], allLabels=unique(yFB)) ## run taining and prediction with sparse linear explicit representation model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=speck, pkg="LiblineaR", svm="C-svc", cost=10, explicit="yes", explicitType="sparse") pred <- predict(model, x=enhancerFB[test]) evaluatePrediction(pred, yFB[test], allLabels=unique(yFB)) ## End(Not run)
Compute Feature Weights for KeBABS Model
getFeatureWeights(model, exrep = NULL, features = NULL, weightLimit = .Machine$double.eps)getFeatureWeights(model, exrep = NULL, features = NULL, weightLimit = .Machine$double.eps)
model |
|
exrep |
optional explicit representation of the support vectors from
which the feature weights should be computed. If no explicit representation
is passed to the function the explicit representation is generated internally
from the support vectors stored in the model. default= |
features |
feature subset of the specified kernel in the form of a
character vector. When a feature subset is passed to the function all other
features in the feature space are not considered for the explicit
representation. (see below) default= |
weightLimit |
the feature weight limit is a single numeric value and allows pruning of feature weights. All feature weights with an absolute value below this limit are set to 0 and are not considered in the feature weights. Default=.Machine$double.eps |
Overview
Feature weights represent the contribution to the decision value for a
single occurance of the feature in the sequence. In this way they give a
hint concerning the importance of the individual features for a given
classification or regression task. Please consider that for a pattern length
larger than 1 patterns at neighboring sequence positions overlap and are no
longer independent from each other. Apart from the obvious overlapping
possibility of patterns for e.g. gappy pair kernel, motif kernel or mixture
kernels multiple patterns can be relevant for a single position. Therefore
feature weights do not describe the relevance for individual features
exactly.
Computation of feature weights
Feature weights can be computed automatically as part of the training (see
parameter featureWeights in method kbsvm. In this case
the function getFeatureWeights is called during training automatically.
When this parameter is not set during training computation of feature weights
after training is possible with the function getFeatureWeights. The function
also supports pruning of feature weights (see parameter weightLimit
allowing to test different prunings without retraining.
Usage of feature weights
Feature weights are used during prediction to speed up the prediction
process. Prediction via feature weights is performed in KeBABS when feature
weights are available in the model (see featureWeights).
When feature weights are not available or for multiclass prediction KeBABS
defaults to the native prediction in the SVM used during training.
Feature weights are also used during generation of prediction profiles
(see getPredictionProfile). In the feature weights the general
relevance of features is reflected. When generating prediction profiles
for a given set of sequences from the feature weights the relevance of
single sequence positions is shown for the individual sequences according
to the given learning task.
Feature weights for position dependent kernels
For position dependent kernels the generation of feature weights is not
possible during training. In this case the featureWeights slot in the model
contains a data representation that allows simple computation of feature
weights during prediction or during generation of prediction profiles.
Upon successful completion, the function returns the feature weights as numeric vector. For quadratic kernels a matrix of feature weights is returned giving the feature weights for pairs of features. In case of multiclass the function returns the feature weights for the pairwise SVMs as list of numeric vectors (or matrices for quadratic kernels).
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
kbsvm, predict,
getPredictionProfile featureWeights,
KBModel
## standard method to create feature weights automatically during training ## model <- kbsvm( .... , featureWeights="yes", .....) ## this example describes the case where feature weights were not created ## during training but should be added later to the model ## load example sequences and select a small set of sequences ## to speed up training for demonstration purpose data(TFBS) ## create sample indices of training and test subset train <- sample(1:length(yFB), 200) test <- c(1:length(yFB))[-train] ## determin all labels allLables <- unique(yFB) ## create a kernel object gappyK1M4 <- gappyPairKernel(k=1, m=4) ## model is trainded with creation of feature weights model <- kbsvm(enhancerFB[train], yFB[train], gappyK1M4, pkg="LiblineaR", svm="C-svc", cost=20) ## feature weights included in model featureWeights(model) ## Not run: ## model is originally trainded without creation of feature weights model <- kbsvm(enhancerFB[train], yFB[train], gappyK1M4, pkg="LiblineaR", svm="C-svc", cost=20, featureWeights="no") ## no feature weights included in model featureWeights(model) ## later after training add feature weights and model offset of model to ## KeBABS model featureWeights(model) <- getFeatureWeights(model) modelOffset(model) <- getSVMSlotValue("b", model) ## show a part of the feature weights and the model offset featureWeights(model)[1:7] modelOffset(model) ## another scenario for getFeatureWeights is to test the performance ## behavior of different prunings of the feature weights ## show histogram of full feature weights hist(featureWeights(model), breaks=30) ## show number of features length(featureWeights(model)) ## first predict with full feature weights to see how performance ## when feature weights are included in the model prediction is always ## performed with the feature weights ## changes through pruning pred <- predict(model, enhancerFB[test]) evaluatePrediction(pred, yFB[test], allLabels=allLables) ## add feature weights with pruning to absolute values larger than 0.6 ## model offset was assigned above and is not impacted by pruning featureWeights(model) <- getFeatureWeights(model, weightLimit=0.6) ## show histogram of full feature weights hist(featureWeights(model), breaks=30) ## show reduced number of features length(featureWeights(model)) ## now predict with pruned feature weights pred <- predict(model, enhancerFB, sel=test) evaluatePrediction(pred, yFB[test], allLabels=allLables) ## End(Not run)## standard method to create feature weights automatically during training ## model <- kbsvm( .... , featureWeights="yes", .....) ## this example describes the case where feature weights were not created ## during training but should be added later to the model ## load example sequences and select a small set of sequences ## to speed up training for demonstration purpose data(TFBS) ## create sample indices of training and test subset train <- sample(1:length(yFB), 200) test <- c(1:length(yFB))[-train] ## determin all labels allLables <- unique(yFB) ## create a kernel object gappyK1M4 <- gappyPairKernel(k=1, m=4) ## model is trainded with creation of feature weights model <- kbsvm(enhancerFB[train], yFB[train], gappyK1M4, pkg="LiblineaR", svm="C-svc", cost=20) ## feature weights included in model featureWeights(model) ## Not run: ## model is originally trainded without creation of feature weights model <- kbsvm(enhancerFB[train], yFB[train], gappyK1M4, pkg="LiblineaR", svm="C-svc", cost=20, featureWeights="no") ## no feature weights included in model featureWeights(model) ## later after training add feature weights and model offset of model to ## KeBABS model featureWeights(model) <- getFeatureWeights(model) modelOffset(model) <- getSVMSlotValue("b", model) ## show a part of the feature weights and the model offset featureWeights(model)[1:7] modelOffset(model) ## another scenario for getFeatureWeights is to test the performance ## behavior of different prunings of the feature weights ## show histogram of full feature weights hist(featureWeights(model), breaks=30) ## show number of features length(featureWeights(model)) ## first predict with full feature weights to see how performance ## when feature weights are included in the model prediction is always ## performed with the feature weights ## changes through pruning pred <- predict(model, enhancerFB[test]) evaluatePrediction(pred, yFB[test], allLabels=allLables) ## add feature weights with pruning to absolute values larger than 0.6 ## model offset was assigned above and is not impacted by pruning featureWeights(model) <- getFeatureWeights(model, weightLimit=0.6) ## show histogram of full feature weights hist(featureWeights(model), breaks=30) ## show reduced number of features length(featureWeights(model)) ## now predict with pruned feature weights pred <- predict(model, enhancerFB, sel=test) evaluatePrediction(pred, yFB[test], allLabels=allLables) ## End(Not run)
compute prediction profiles for a given set of biological
sequences from a model trained with kbsvm
## S4 method for signature 'BioVector' getPredictionProfile(object, kernel, featureWeights, b, svmIndex = 1, sel = NULL, weightLimit = .Machine$double.eps) ## S4 method for signature 'XStringSet' getPredictionProfile(object, kernel, featureWeights, b, svmIndex = 1, sel = NULL, weightLimit = .Machine$double.eps) ## S4 method for signature 'XString' getPredictionProfile(object, kernel, featureWeights, b, svmIndex = 1, sel = NULL, weightLimit = .Machine$double.eps)## S4 method for signature 'BioVector' getPredictionProfile(object, kernel, featureWeights, b, svmIndex = 1, sel = NULL, weightLimit = .Machine$double.eps) ## S4 method for signature 'XStringSet' getPredictionProfile(object, kernel, featureWeights, b, svmIndex = 1, sel = NULL, weightLimit = .Machine$double.eps) ## S4 method for signature 'XString' getPredictionProfile(object, kernel, featureWeights, b, svmIndex = 1, sel = NULL, weightLimit = .Machine$double.eps)
object |
a single biological sequence in the form of an
|
kernel |
a sequence kernel object of class
|
featureWeights |
a feature weights matrix retrieved from a KeBABS model
with the accessor |
b |
model intercept from a KeBABS model. |
svmIndex |
integer value selecting one of the pairwise SVMs in case of pairwise multiclass classification. Default=1 |
sel |
subset of indices into |
weightLimit |
the feature weight limit is a single numeric value and allows pruning of feature weights. All feature weights with an absolute value below this limit are set to 0 and are not considered for the prediction profile computation. This parameter is only relevant when feature weights are calculated in KeBABS during training. Default=.Machine$double.eps |
With this method prediction profiles can be generated explicitely for a
given set of sequences with a given model represented through its feature
weights and the model intercept b. A single prediction profile shows for
each position of the sequence the contribution of the patterns at this
position to the decision value. The prediciion profile also includes the
kernel object used for the generation of the profile and the seqence
data.
A single profile or a pair can be plotted with method plot
showing the relevance of sequence positions for the prediction. Please
consider that patterns occuring at neighboring sequence positions are not
statistically independent which means that the relevance of a specific
position is not only determined by the patterns at this position but is also
influenced by the neighborhood around this position. Prediction profiles can
also be generated implicitely during predction for the predicted samples
(see parameter predProfiles in predict).
getPredictionProfile: upon successful completion, the function returns a set
of prediction profiles for the sequences as class
PredictionProfile.
Johannes Palme
https://github.com/UBod/kebabs
C.C. Mahrenholz, I.G. Abfalter, U. Bodenhofer, R. Volkmer and
S. Hochreiter (2011) Complex networks govern coiled coil
oligomerization - predicting and profiling by means of a machine
learning approach. Mol. Cell. Proteomics, 10(5):M110.004994.
DOI: doi:10.1074/mcp.M110.004994.
U. Bodenhofer, K. Schwarzbauer, M. Ionescu, and
S. Hochreiter (2009).
Modelling position specificity in sequence kernels by fuzzy
equivalence relations. Proc. Joint 13th IFSA World Congress and 6th
EUSFLAT Conference, pp. 1376-1381, Lisbon.
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
PredictionProfile, predict,
plot, featureWeights,
getPredProfMixture
## set random generator seed to make the results of this example ## reproducable set.seed(123) ## load coiled coil data data(CCoil) gappya <- gappyPairKernel(k=1,m=11, annSpec=TRUE) model <- kbsvm(x=ccseq, y=as.numeric(yCC), kernel=gappya, pkg="e1071", svm="C-svc", cost=15) ## show feature weights featureWeights(model)[,1:5] ## define two new sequences to be predicted GCN4 <- AAStringSet(c("MKQLEDKVEELLSKNYHLENEVARLKKLV", "MKQLEDKVEELLSKYYHTENEVARLKKLV")) names(GCN4) <- c("GCN4wt", "GCN_N16Y,L19T") ## assign annotation metadata annCharset <- annotationCharset(ccseq) annot <- c("abcdefgabcdefgabcdefgabcdefga", "abcdefgabcdefgabcdefgabcdefga") annotationMetadata(GCN4, annCharset=annCharset) <- annot ## compute prediction profiles predProf <- getPredictionProfile(GCN4, gappya, featureWeights(model), modelOffset(model)) ## show prediction profiles predProf ## plot prediction profile of first aa sequence plot(predProf, sel=1, ylim=c(-0.4, 0.2), heptads=TRUE, annotate=TRUE) ## plot prediction profile of both aa sequences plot(predProf, sel=c(1,2), ylim=c(-0.4, 0.2), heptads=TRUE, annotate=TRUE) ## prediction profiles can also be generated during prediction ## when setting the parameter predProf to TRUE ## plotting longer sequences to pdf is shown in the examples for the ## plot function## set random generator seed to make the results of this example ## reproducable set.seed(123) ## load coiled coil data data(CCoil) gappya <- gappyPairKernel(k=1,m=11, annSpec=TRUE) model <- kbsvm(x=ccseq, y=as.numeric(yCC), kernel=gappya, pkg="e1071", svm="C-svc", cost=15) ## show feature weights featureWeights(model)[,1:5] ## define two new sequences to be predicted GCN4 <- AAStringSet(c("MKQLEDKVEELLSKNYHLENEVARLKKLV", "MKQLEDKVEELLSKYYHTENEVARLKKLV")) names(GCN4) <- c("GCN4wt", "GCN_N16Y,L19T") ## assign annotation metadata annCharset <- annotationCharset(ccseq) annot <- c("abcdefgabcdefgabcdefgabcdefga", "abcdefgabcdefgabcdefgabcdefga") annotationMetadata(GCN4, annCharset=annCharset) <- annot ## compute prediction profiles predProf <- getPredictionProfile(GCN4, gappya, featureWeights(model), modelOffset(model)) ## show prediction profiles predProf ## plot prediction profile of first aa sequence plot(predProf, sel=1, ylim=c(-0.4, 0.2), heptads=TRUE, annotate=TRUE) ## plot prediction profile of both aa sequences plot(predProf, sel=c(1,2), ylim=c(-0.4, 0.2), heptads=TRUE, annotate=TRUE) ## prediction profiles can also be generated during prediction ## when setting the parameter predProf to TRUE ## plotting longer sequences to pdf is shown in the examples for the ## plot function
compute prediction profiles for a given set of biological sequences from a model trained with mixture kernels
## S4 method for signature 'BioVector' getPredProfMixture(object, trainseqs, mixModel, kernels, mixCoef, svmIndex = 1, sel = 1:length(object), weightLimit = .Machine$double.eps) ## S4 method for signature 'XStringSet' getPredProfMixture(object, trainseqs, mixModel, kernels, mixCoef, svmIndex = 1, sel = 1:length(object), weightLimit = .Machine$double.eps) ## S4 method for signature 'XString' getPredProfMixture(object, trainseqs, mixModel, kernels, mixCoef, svmIndex = 1, sel = 1, weightLimit = .Machine$double.eps)## S4 method for signature 'BioVector' getPredProfMixture(object, trainseqs, mixModel, kernels, mixCoef, svmIndex = 1, sel = 1:length(object), weightLimit = .Machine$double.eps) ## S4 method for signature 'XStringSet' getPredProfMixture(object, trainseqs, mixModel, kernels, mixCoef, svmIndex = 1, sel = 1:length(object), weightLimit = .Machine$double.eps) ## S4 method for signature 'XString' getPredProfMixture(object, trainseqs, mixModel, kernels, mixCoef, svmIndex = 1, sel = 1, weightLimit = .Machine$double.eps)
object |
a single biological sequence in the form of an
|
trainseqs |
training sequences on which the mixture model was
trained as
|
mixModel |
model object of class |
kernels |
a list of sequence kernel objects of class
|
mixCoef |
mixing coefficients for the kernel mixture. The same mixing coefficient values must be used as in training. |
svmIndex |
integer value selecting one of the pairwise SVMs in case of pairwise multiclass classification. Default=1 |
sel |
subset of indices into |
weightLimit |
the feature weight limit is a single numeric value and allows pruning of feature weights. All feature weights with an absolute value below this limit are set to 0 and are not considered for the prediction profile computation. This parameter is only relevant when feature weights are calculated in KeBABS during training. Default=.Machine$double.eps |
With this method prediction profiles can be generated explicitely for a
given set of sequences with a model trained on a precomputed kernel matrix
as mixture of multiple kernels.
upon successful completion, the function returns a set
of prediction profiles for the sequences as class
PredictionProfile.
Johannes Palme
https://github.com/UBod/kebabs
C.C. Mahrenholz, I.G. Abfalter, U. Bodenhofer, R. Volkmer and
S. Hochreiter (2011) Complex networks govern coiled coil
oligomerization - predicting and profiling by means of a machine
learning approach. Mol. Cell. Proteomics, 10(5):M110.004994.
DOI: doi:10.1074/mcp.M110.004994.
U. Bodenhofer, K. Schwarzbauer, M. Ionescu, and
S. Hochreiter (2009).
Modelling position specificity in sequence kernels by fuzzy
equivalence relations. Proc. Joint 13th IFSA World Congress and 6th
EUSFLAT Conference, pp. 1376-1381, Lisbon.
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
PredictionProfile, predict,
plot, featureWeights,
getPredictionProfile
## set random generator seed to make the results of this example ## reproducable set.seed(123) ## load coiled coil data data(CCoil) gappya1 <- gappyPairKernel(k=1,m=11, annSpec=TRUE) gappya2 <- gappyPairKernel(k=2,m=9, annSpec=TRUE) kernels <- list(gappya1, gappya2) mixCoef <- c(0.7,0.3) ## precompute mixed kernel matrix km <- as.KernelMatrix(mixCoef[1]*gappya1(ccseq) + mixCoef[2]*gappya2(ccseq)) mixModel <- kbsvm(x=km, y=as.numeric(yCC), pkg="e1071", svm="C-svc", cost=15) ## define two new sequences to be predicted GCN4 <- AAStringSet(c("MKQLEDKVEELLSKNYHLENEVARLKKLV", "MKQLEDKVEELLSKYYHTENEVARLKKLV")) names(GCN4) <- c("GCN4wt", "GCN_N16Y,L19T") ## assign annotation metadata annCharset <- annotationCharset(ccseq) annot <- c("abcdefgabcdefgabcdefgabcdefga", "abcdefgabcdefgabcdefgabcdefga") annotationMetadata(GCN4, annCharset=annCharset) <- annot ## compute prediction profiles predProf <- getPredProfMixture(GCN4, ccseq, mixModel, kernels, mixCoef) ## show prediction profiles predProf ## plot prediction profile of both aa sequences plot(predProf, sel=c(1,2), ylim=c(-0.4, 0.2), heptads=TRUE, annotate=TRUE)## set random generator seed to make the results of this example ## reproducable set.seed(123) ## load coiled coil data data(CCoil) gappya1 <- gappyPairKernel(k=1,m=11, annSpec=TRUE) gappya2 <- gappyPairKernel(k=2,m=9, annSpec=TRUE) kernels <- list(gappya1, gappya2) mixCoef <- c(0.7,0.3) ## precompute mixed kernel matrix km <- as.KernelMatrix(mixCoef[1]*gappya1(ccseq) + mixCoef[2]*gappya2(ccseq)) mixModel <- kbsvm(x=km, y=as.numeric(yCC), pkg="e1071", svm="C-svc", cost=15) ## define two new sequences to be predicted GCN4 <- AAStringSet(c("MKQLEDKVEELLSKNYHLENEVARLKKLV", "MKQLEDKVEELLSKYYHTENEVARLKKLV")) names(GCN4) <- c("GCN4wt", "GCN_N16Y,L19T") ## assign annotation metadata annCharset <- annotationCharset(ccseq) annot <- c("abcdefgabcdefgabcdefgabcdefga", "abcdefgabcdefgabcdefgabcdefga") annotationMetadata(GCN4, annCharset=annCharset) <- annot ## compute prediction profiles predProf <- getPredProfMixture(GCN4, ccseq, mixModel, kernels, mixCoef) ## show prediction profiles predProf ## plot prediction profile of both aa sequences plot(predProf, sel=c(1,2), ylim=c(-0.4, 0.2), heptads=TRUE, annotate=TRUE)
Create a heat map of prediction profiles
## S4 method for signature 'PredictionProfile,missing' heatmap(x, Rowv = TRUE, add.expr, margins = c(5, 5), RowSideColors = NULL, cexRow = max(min(35/nrow(x@profiles), 1), 0.1), cexCol = max(min(35/ncol(x@profiles), 1), 0.1), main = NULL, dendScale = 1, barScale = 1, startPos = 1, endPos = ncol(x@profiles), labels = NULL, windowSize = 1, ...)## S4 method for signature 'PredictionProfile,missing' heatmap(x, Rowv = TRUE, add.expr, margins = c(5, 5), RowSideColors = NULL, cexRow = max(min(35/nrow(x@profiles), 1), 0.1), cexCol = max(min(35/ncol(x@profiles), 1), 0.1), main = NULL, dendScale = 1, barScale = 1, startPos = 1, endPos = ncol(x@profiles), labels = NULL, windowSize = 1, ...)
x |
prediction profile of class
|
Rowv |
determines the row order of the plot. When set to |
add.expr |
largely analogous to the standard
|
margins |
largely analogous to the standard
|
RowSideColors |
a vector of color values specifying the colors for the side bar. Default=NULL |
cexRow |
largely analogous to the standard
|
cexCol |
largely analogous to the standard
|
main |
largely analogous to the standard
|
dendScale |
factor scaling the width of the row dendrogram; values have to be larger than 0 and not larger than 2. Default=1 |
barScale |
factor scaling the width of the label color bar. Values have to be larger than 0 and not larger than 4. Default=1 |
startPos |
start sequence position. Together with the
parameter |
endPos |
end sequence position (see also |
labels |
a numeric vector, character vector or factor specifying
the labels for the sequences in the profile. If this parameter is
different from NULL the labels are plotted as side bar using the
colors specified in the parameter |
windowSize |
numerical value specifying the window size of an optional sliding window averaging of the prediction profiles. The value must be larger than 0. Even values are changed internally to odd values by adding 1. Default=1 |
... |
additional parameters which are passed to the |
The heatmap function provides plotting of heatmaps from prediction
profiles with various possibilities for sample (=row) ordering (see
parameter Rowv). The heatmap is shown together with an optional
color sidebar showing the labels and an optional row cluster dendrogram
when hierarchical clustering defines the row order. For long sequences the
heatmap can be restricted to a subset of positions. Additionally smoothing
can be applied to the prediction profiles through sliding window averaging.
Through smoothing important regions can become better visible.
Invisibly, a cluster dendrogram.
Johannes Palme
https://github.com/UBod/kebabs
C.C. Mahrenholz, I.G. Abfalter, U. Bodenhofer, R. Volkmer and
S. Hochreiter (2011) Complex networks govern coiled coil
oligomerization - predicting and profiling by means of a machine
learning approach. Mol. Cell. Proteomics, 10(5):M110.004994.
DOI: doi:10.1074/mcp.M110.004994.
U. Bodenhofer, K. Schwarzbauer, M. Ionescu, and
S. Hochreiter (2009).
Modelling position specificity in sequence kernels by fuzzy
equivalence relations. Proc. Joint 13th IFSA World Congress and 6th
EUSFLAT Conference, pp. 1376-1381, Lisbon.
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## load coiled coil data data(CCoil) ## define annotation specific gappy pair kernel gappya <- gappyPairKernel(k=1,m=11, annSpec=TRUE) ## train model model <- kbsvm(x=ccseq, y=as.numeric(yCC), kernel=gappya, pkg="e1071", svm="C-svc", cost=15) ## generate prediction profiles predProf <- getPredictionProfile(ccseq, gappya, featureWeights(model), modelOffset(model)) ## show prediction profiles predProf ## Not run: ## plot heatmap for the prediction profiles - random ordering of samples heatmap(predProf, Rowv="random", main="Prediction Profiles", labels=yCC, RowSideColors=c("blue", "red"), cexRow=0.15, cexCol=0.3) ## plot heatmap for the prediction profiles - ordering by decision values heatmap(predProf, Rowv="decision", main="Prediction Profiles", labels=yCC, RowSideColors=c("blue", "red"), cexRow=0.15, cexCol=0.3) ## plot heatmap for the prediction profiles - with hierarchical clustering heatmap(predProf, Rowv=TRUE, main="Prediction Profiles", labels=yCC, RowSideColors=c("blue", "red"), cexRow=0.15, cexCol=0.3) ## End(Not run)## load coiled coil data data(CCoil) ## define annotation specific gappy pair kernel gappya <- gappyPairKernel(k=1,m=11, annSpec=TRUE) ## train model model <- kbsvm(x=ccseq, y=as.numeric(yCC), kernel=gappya, pkg="e1071", svm="C-svc", cost=15) ## generate prediction profiles predProf <- getPredictionProfile(ccseq, gappya, featureWeights(model), modelOffset(model)) ## show prediction profiles predProf ## Not run: ## plot heatmap for the prediction profiles - random ordering of samples heatmap(predProf, Rowv="random", main="Prediction Profiles", labels=yCC, RowSideColors=c("blue", "red"), cexRow=0.15, cexCol=0.3) ## plot heatmap for the prediction profiles - ordering by decision values heatmap(predProf, Rowv="decision", main="Prediction Profiles", labels=yCC, RowSideColors=c("blue", "red"), cexRow=0.15, cexCol=0.3) ## plot heatmap for the prediction profiles - with hierarchical clustering heatmap(predProf, Rowv=TRUE, main="Prediction Profiles", labels=yCC, RowSideColors=c("blue", "red"), cexRow=0.15, cexCol=0.3) ## End(Not run)
KeBABS Model Class
Instances of this class represent a model object for the KeBABS meta-SVM.
callinvocation string of KeBABS meta-SVM
numSequencesnumber of sequences used for training
selindex subset of samples used for training
yvector of target values
levelslevels of target
numClassesnumber of classes
classNamesclass labels
classWeightsclass weights
SVsupport vectors
svIndexsupport vector indices
alphaIndexlist of SVM indices per SVM
trainingFeaturesfeature names used in training
featureWeightsfeature Weights
bmodel offset
probAfitted logistic function parameter A
probBfitted logistic function parameter A
sigmascale of Laplacian fitted to regression residuals
cvResultcross validation result of class
CrossValidationResult
modelSelResultmodel selection / grid search result of class
ModelSelectionResult
ctlInfoKeBABS control info of class
ControlInformation
svmInfoinfo about requested / used SVM of class
SVMInformation
svmModeloriginal model returned from SVM
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
KBModel Accessors
## S4 method for signature 'KBModel' modelOffset(object) getSVMSlotValue(paramName, model, raw = FALSE)## S4 method for signature 'KBModel' modelOffset(object) getSVMSlotValue(paramName, model, raw = FALSE)
object |
a KeBABS model |
paramName |
unified name of an SVM model data element |
model |
a KeBABS model |
raw |
when set to |
getSVMSlotValue:
value of requested parameter in unified or native format dependent on
parameter raw.
In all descriptions below, object is an object of class
KBModel.
modelOffset(object)returns the model offset.
featureWeights(object)returns the feature weights.
SVindex(object)returns the support vector indices for the training samples.
cvResult(object)returns result of cross validation as object of class
CrossValidationResult.
modelSelResult(object)returns result of model selection as object of class
ModelSelectionResult.
svmModel(object)returns the native svm model stored within KeBABS model.
probabilityModel(object)returns the probability model stored within KeBABS model.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## create kernel object for normalized spectrum kernel specK5 <- spectrumKernel(k=5) ## Not run: ## load data data(TFBS) ## perform training - feature weights are computed by default model <- kbsvm(enhancerFB, yFB, specK5, pkg="LiblineaR", svm="C-svc", cost=15, cross=10, showProgress=TRUE) showProgress=TRUE) ## show result of validation cvResult(model) ## show feature weights featureWeights(model)[1:5] ## show model offset modelOffset(model) ## End(Not run)## create kernel object for normalized spectrum kernel specK5 <- spectrumKernel(k=5) ## Not run: ## load data data(TFBS) ## perform training - feature weights are computed by default model <- kbsvm(enhancerFB, yFB, specK5, pkg="LiblineaR", svm="C-svc", cost=15, cross=10, showProgress=TRUE) showProgress=TRUE) ## show result of validation cvResult(model) ## show feature weights featureWeights(model)[1:5] ## show model offset modelOffset(model) ## End(Not run)
Train an SVM-model with a sequence kernel on biological sequences
## S4 method for signature 'BioVector' kbsvm(x, y, kernel = NULL, pkg = "auto", svm = "C-svc", explicit = "auto", explicitType = "auto", featureType = "linear", featureWeights = "auto", weightLimit = .Machine$double.eps, classWeights = numeric(0), cross = 0, noCross = 1, groupBy = NULL, nestedCross = 0, noNestedCross = 1, perfParameters = character(0), perfObjective = "ACC", probModel = FALSE, sel = integer(0), features = NULL, showProgress = FALSE, showCVTimes = FALSE, runtimeWarning = TRUE, verbose = getOption("verbose"), ...) ## S4 method for signature 'XStringSet' kbsvm(x, y, kernel = NULL, pkg = "auto", svm = "C-svc", explicit = "auto", explicitType = "auto", featureType = "linear", featureWeights = "auto", weightLimit = .Machine$double.eps, classWeights = numeric(0), cross = 0, noCross = 1, groupBy = NULL, nestedCross = 0, noNestedCross = 1, perfParameters = character(0), perfObjective = "ACC", probModel = FALSE, sel = integer(0), features = NULL, showProgress = FALSE, showCVTimes = FALSE, runtimeWarning = TRUE, verbose = getOption("verbose"), ...) ## S4 method for signature 'ExplicitRepresentation' kbsvm(x, y, kernel = NULL, pkg = "auto", svm = "C-svc", explicit = "auto", explicitType = "auto", featureType = "linear", featureWeights = "auto", weightLimit = .Machine$double.eps, classWeights = numeric(0), cross = 0, noCross = 1, groupBy = NULL, nestedCross = 0, noNestedCross = 1, perfParameters = character(0), perfObjective = "ACC", probModel = FALSE, sel = integer(0), showProgress = FALSE, showCVTimes = FALSE, runtimeWarning = TRUE, verbose = getOption("verbose"), ...) ## S4 method for signature 'KernelMatrix' kbsvm(x, y, kernel = NULL, pkg = "auto", svm = "C-svc", explicit = "no", explicitType = "auto", featureType = "linear", featureWeights = "no", classWeights = numeric(0), cross = 0, noCross = 1, groupBy = NULL, nestedCross = 0, noNestedCross = 1, perfParameters = character(0), perfObjective = "ACC", probModel = FALSE, sel = integer(0), showProgress = FALSE, showCVTimes = FALSE, runtimeWarning = TRUE, verbose = getOption("verbose"), ...)## S4 method for signature 'BioVector' kbsvm(x, y, kernel = NULL, pkg = "auto", svm = "C-svc", explicit = "auto", explicitType = "auto", featureType = "linear", featureWeights = "auto", weightLimit = .Machine$double.eps, classWeights = numeric(0), cross = 0, noCross = 1, groupBy = NULL, nestedCross = 0, noNestedCross = 1, perfParameters = character(0), perfObjective = "ACC", probModel = FALSE, sel = integer(0), features = NULL, showProgress = FALSE, showCVTimes = FALSE, runtimeWarning = TRUE, verbose = getOption("verbose"), ...) ## S4 method for signature 'XStringSet' kbsvm(x, y, kernel = NULL, pkg = "auto", svm = "C-svc", explicit = "auto", explicitType = "auto", featureType = "linear", featureWeights = "auto", weightLimit = .Machine$double.eps, classWeights = numeric(0), cross = 0, noCross = 1, groupBy = NULL, nestedCross = 0, noNestedCross = 1, perfParameters = character(0), perfObjective = "ACC", probModel = FALSE, sel = integer(0), features = NULL, showProgress = FALSE, showCVTimes = FALSE, runtimeWarning = TRUE, verbose = getOption("verbose"), ...) ## S4 method for signature 'ExplicitRepresentation' kbsvm(x, y, kernel = NULL, pkg = "auto", svm = "C-svc", explicit = "auto", explicitType = "auto", featureType = "linear", featureWeights = "auto", weightLimit = .Machine$double.eps, classWeights = numeric(0), cross = 0, noCross = 1, groupBy = NULL, nestedCross = 0, noNestedCross = 1, perfParameters = character(0), perfObjective = "ACC", probModel = FALSE, sel = integer(0), showProgress = FALSE, showCVTimes = FALSE, runtimeWarning = TRUE, verbose = getOption("verbose"), ...) ## S4 method for signature 'KernelMatrix' kbsvm(x, y, kernel = NULL, pkg = "auto", svm = "C-svc", explicit = "no", explicitType = "auto", featureType = "linear", featureWeights = "no", classWeights = numeric(0), cross = 0, noCross = 1, groupBy = NULL, nestedCross = 0, noNestedCross = 1, perfParameters = character(0), perfObjective = "ACC", probModel = FALSE, sel = integer(0), showProgress = FALSE, showCVTimes = FALSE, runtimeWarning = TRUE, verbose = getOption("verbose"), ...)
x |
multiple biological sequences in the form of a
|
y |
response vector which contains one value for each sample in 'x'. For classification tasks this can be either a character vector, a factor or a numeric vector, for regression tasks it must be a numeric vector. For numeric labels in binary classification the positive class must have the larger value, for factor or character based labels the positive label must be at the first position when sorting the labels in descendent order according to the C locale. If the parameter sel is used to perform training with a sample subset the response vector must have the same length as 'sel'. |
kernel |
a sequence kernel object or a string kernel from package kernlab. In case of grid search or model selection a list of sequence kernel objects can be passed to training. |
pkg |
name of package which contains the SVM implementation to be used
for training, e.g. |
svm |
name of the SVM used for the classification or regression task,
e.g. "C-svc". For gridSearch or model selection multiple SVMs can be passed
as character vector. For each entry in this character vector a corresponding
entry in the character vector for parameter |
explicit |
this parameter controls whether training should be performed
with the kernel matrix (see |
explicitType |
this parameter is only relevant when parameter 'explicit' is different from "no". The values "sparse" and "dense" indicate whether a sparse or dense explicit representation should be used. When the parameter is set to "auto" KeBABS selects a variant. Default="auto" |
featureType |
when the parameter is set to "linear" single features areused in the analysis (with a linear kernel matrix or a linear kernel applied to the linear explicit representation). When set to "quadratic" the analysis is based on feature pairs. For an SVM from LiblineaR (which does not support kernels) KeBABS generates a quadratic explicit representation. For the other SVMs a polynomial kernel of degree 2 is used for learning via explicit representation. In the case of learning via kernel matrix a quadratic kernel matrix (quadratic here in the sense of linear kernel matrix with each element taken to power 2) is generated. Default="linear" |
featureWeights |
with the values "no" and "yes" the user can control whether feature weights are calulated as part of the training. When the parameter is set to "auto" KeBABS selects a variant (see below). Default="auto" |
weightLimit |
the feature weight limit is a single numeric value and allows pruning of feature weights. All feature weights with an absolute value below this limit are set to 0 and are not considered in the model and for further predictions. This parameter is only relevant when featureWeights are calculated in KeBABS during training. Default=.Machine$double.eps |
classWeights |
a numeric named vector of weights for the different classes, used for asymmetric class sizes. Each element of the vector must have one of the class names but not all class names must be present. Default=1 |
cross |
an integer value K > 0 indicates that k-fold cross validation should be performed. A value -1 is used for Leave-One-Out (LOO) cross validation. (see above) Default=0 |
noCross |
an integer value larger than 0 is used to specify the number of repetitions for cross validation. This parameter is only relevant if 'cross' is different from 0. Default=1 |
groupBy |
allows a grouping of samples during cross validation. The
parameter is only relevant when 'cross' is larger than 1. It is an integer
vector or factor with the same length as the number of samples used for
training and specifies for each sample to which group it belongs. Samples
from the same group are never spread over more than one fold. (see
|
nestedCross |
in integer value K > 0 indicates that a model selection with nested cross validation should be performed with a k-fold outer cross validation. The inner cross validation is defined with the 'cross' parameter (see below), Default=0 |
noNestedCross |
an integer value larger than 0 is used to specify the number of repetitions for the nested cross validation. This parameter is only relevant if 'nestedCross' is larger than 0. Default=1 |
perfParameters |
a character vector with one or several values from the set "ACC" , "BACC", "MCC", "AUC" and "ALL". "ACC" stands for accuracy, "BACC" for balanced accuracy, "MCC" for Matthews Correlation Coefficient, "AUC" for area under the ROC curve and "ALL" for all four. This parameter defines which performance parameters are collected in cross validation, grid search and model selection for display purpose. The value "AUC" is currently not supported for multiclass classification. Default=NULL |
perfObjective |
a singe character string from the set "ACC", "BACC" and "MCC" (see previous parameter). The parameter is only relevant in grid search and model selection and defines which performance measure is used to determine the best performing parameter set. Default="ACC" |
probModel |
when setting this boolean parameter to TRUE a probability model is determined as part of the training (see below). Default=FALSE |
sel |
subset of indices into |
features |
feature subset of the specified kernel in the form of a character vector. When a feature subset is passed to the function all other features in the feature space are not considered for training (see below). A feature subset can only be used when a single kernel object is specified in the 'kernel' parameter. Default=NULL |
showProgress |
when setting this boolean parameter to TRUE the progress of a cross validation is displayed. The parameter is only relevant for cross validation. Default=FALSE |
showCVTimes |
when setting this boolean parameter to TRUE the runtimes of the cross validation runs are shown after the cross validation is finished. The parameter is only relevant for cross validation. Default=FALSE |
runtimeWarning |
when setting this boolean parameter to FALSE a warning for long runtimes will not be shown in case of large feature space dimension or large number of samples. Default=TRUE |
verbose |
boolean value that indicates whether KeBABS should print additional messages showing the internal processing logic in a verbose manner. The default value depends on the R session verbosity option. Default=getOption("verbose") |
... |
additional parameters which are passed to SVM training transparently. |
Overview
The kernel-related functionality provided in this package is specifically
centered around biological sequences, i.e. DNA-, RNA- or AA-sequences (see
also DNAStringSet, RNAStringSet and
AAStringSet) and Support Vector Machine (SVM) based methods.
Apart from the implementation of the most relevant kernels for sequence
analysis (see spectrumKernel, mismatchKernel,
gappyPairKernel and motifKernel) KeBABS also
provides a framework which allows easy interworking with existing SVM
implementations in other R packages. In the current implementation the SVMs
provided in the packages kernlab,
e1071 and
LiblineaR are in focus. Starting with
version 1.2.0 KeBABS also contains the dense implementation of LIBSVM which
is functionally equivalent to the sparse implementation of LIBSVM in package
e1071 but additionally supports dense kernel
matrices as preferred implementation for learning via kernel matrices.
This framework can be considered like a "meta-SVM", which provides
a simple and unified user interface to these SVMs for classification (binary
and multiclass) and regression tasks. The user calls the "meta-SVM" in a
classical SVM-like manner by passing sequence data, a sequence kernel with
kernel parameters and the SVM which should be used for the learning task
togehter with SVM parameters. KeBABS internally generates the relevant
representations (see getKernelMatrix or getExRep)
from the sequence data using the specified kernel, adapts parameters and
formats to the selected SVM and internally calls the actual SVM
implementation in the requested package. KeBABS unifies the
result returned from the invoked SVM and returns a unified data structure,
the KeBABS model, which also contains the SVM-specific model (see
svmModel.
The KeBABS model is used in prediction (see predict) to
predict the response for new sequence data. On user request the feature
weights are computed and stored in the Kebabs model during training (see
below). The feature weights are used for the generation of prediction
profiles (see getPredictionProfile) which show the importance
of sequence positions for a specfic learning task.
Training of biological sequences with a sequence kernel
Training is performed via the method kbsvm for classification and
regression tasks. The user passes sequence data, the response vector, a
sequence kernel object and the requested SVM along with SVM parameters
to kbsvm and receives the training results in the form of a
KeBABS model object of class KBModel. The accessor
svmModel allows to retrieve the SVM specific model from the KeBABS
model object. However, for regular operation a detailed look into the SVM
specific model is usually not necessary.
The standard data format for sequences in KeBABS are the
XStringSet-derived classes DNAStringSet,
RNAStringSet and AAStringSet.
(When repeat regions are coded as lowercase characters and should be
excluded from the analysis the sequence data can be passed as
BioVector which also supports lowercase characters
instead of XStringSet format. Please note that the
classes derived from XStringSet are much more
powerful than the BioVector derived classes and
should be used in all cases where lowercase characters are not needed).
Instead of sequences also a precomputed explicit representation or
a precomputed kernel matrix can be used for training. Examples for
training with kernel matrix and explicit representation can be found on
the help page for the prediction method predict.
Apart from SVM training kbsvm can be also used for cross
validation (see crossValidation and parameters cross and
noCross), grid search for SVM- and kernel-parameter values (see
gridSearch) and model selection (see modelSelection and
parameters nestedCross and noNestedCross).
Package and SVM selection
The user specifies the SVM implementation to be used for a learning task by
selecting the package with the pkg parameter and the SVM method in
the package with the SVM parameter. Currently the packages
kernlab, e1071 and
LiblineaR are supported. The names for
SVM methods vary from package to package and KeBABS provide following
unified names which can be selected across packages. The following table
shows the available SVM methods:
| SVM name | description |
| ----------------------- | ----------------------------------------- --------- |
| C-svc: | C classification (with L2 regularization and L1 loss) |
| l2rl2l-svc: | classif. with L2 regularization and L2 loss (dual) |
| l2rl2lp-svc: | classif. with L2 regularization and L2 loss (primal) |
| l1rl2l-svc: | classification with L1 regularization and L2 loss |
| nu-svc: | nu classification |
| C-bsvc: | bound-constraint SVM classification |
| mc-natC: | Crammer, Singer native multiclass |
| mc-natW: | Weston, Watkins native multiclass |
| one-svc: | one class classification |
| eps-svr: | epsilon regression |
| nu-svr: | nu regression |
| eps-bsvr: | bound-constraint svm regression |
Pairwise multiclass can be selected for C-svc and nu-svc if
the label vector contains more than two classes. For
LiblineaR the multiclass implementation
is always based on "one against the rest" for all SVMs except for
mc-natC which implements native multiclass according to Crammer and
Singer. The following table shows which SVM method is available in which
package:
| SVM name | kernlab | e1071 | LiblineaR |
| -------------------- | -------------- | -------------- | ------ -------- |
| C-svc: | x | x | x |
| l2rl2l-svc: | - | - | x |
| l2rl2lp-svc: | - | - | x |
| l1rl2l-svc: | - | - | x |
| nu-svc: | x | x | - |
| C-bsvc: | x | - | - |
| mc-natC: | x | - | x |
| mc-natW: | x | - | - |
| one-svc: | x | x | - |
| eps-svr: | x | x | - |
| nu-svr: | x | x | - |
| eps-bsvr: | x | - | - |
SVM parameters
To avoid unnecessary changes of parameters names when switching between SVM
implementation in different packages unified names for identical parameters
are available. They are translated by KeBABS to the SVM specific name. The
obvious example is the cost parameter for the C-svm. It is named C in
kernlab and cost in
e1071 and
LiblineaR. The unified name in KeBABS is
cost. If the parameter is passed to kbsvm in a package specific
version it is translated back to the KeBABS name internally. This applies to
following parameters - here shown with their unified names:
| parameter name | description |
| ----------------------- | ----------------------------------------- ----------- |
| cost: | cost parameter of C-SVM |
| nu: | nu parameter of nu-SVM |
| eps: | epsilon parameter of eps-SVR and nu-SVR |
| classWeights: | class weights for asymmetrical class size |
| tolerance: | tolerance as termination crit. for optimization |
| cross: | number of folds in k-fold cross validation |
Hint: If a tolerance value is specified in kbsvm the same value
should be used throughout the complete analysis to make results
comparable.
The following table shows the relevance of the SVM parameters cost, nu and
eps for the different SVMs:
| SVM name | cost | nu | eps |
| -------------------- | -------------- | -------------- | ----- --------- |
| C-svc: | x | - | - |
| l1rl2l-svc: | x | - | - |
| l1rl2lp-svc: | x | - | - |
| l1rl2l-svc: | x | - | - |
| nu-svc: | - | x | - |
| C-bsvc: | x | - | - |
| mc-natC: | x | - | - |
| mc-natW: | x | - | - |
| one-svc: | x | - | - |
| eps-svr: | - | - | x |
| nu-svr: | - | x | - |
| eps-bsvr: | - | - | x |
Hint: Please be aware that identical parameter names between different SVMs
do not necessarily mean, that their values are also identical between
packages but they depend on the actual SVM formulation which could be
different. For example the cost parameter is identical between
C-SVMs in packages kernlab,
e1071 and
LiblineaR but is for example different
from the cost parameter in l2rl2l-svc in
LiblineaR because the C-SVM
uses a linear loss but the l2rl2l-svc uses a quadratic loss.
Feature weights
On user request (see parameter featureWeights) feature weights are
computed amd stored in the model (for a detailed description see
getFeatureWeights). Pruning of feature weights can be achieved
with the parameter weightLimit which defines the cutoff for
small feature weights not stored in the model.
Hint: For training with a precomputed kernel matrix feature weights are
not available. For multiclass prediction is currently not performed via
feature weights but native in the SVM.
Cross validation, grid search and model selection
Cross validation can be controlled with the parameters cross and
noCross. For details on cross validation see crossValidation.
Grid search can be performed by passing multiple SVM parameter values as
vector instead of a single value to kbsvm. Also multiple sequence
kernel objects and multiple SVMs can be used for grid search. For details
see gridSearch. For model selection nested cross validation is used
with the parameters nestedCross and noNestedCross for the
outer and cross and noCross for the inner cross validation.
For details see modelSelection.
Training with feature subset
After performing feature selection repeating the learning task with a
feature subset can easily be achieved by specifying a feature subset
with the parameter features as character vector. The feature subset
must be a subset from the feature space of the sequence kernel passed in
the parameter kernel. Grid search and model selection with a feature
subset can only be used for a single sequence kernel object in the parameter
kernel.
Hint: For normalized kernels all features of the feature space are used for
normalization not just the feature subset. For a normalized motif kernel
(see motifKernel) only the features listed in the motif list
are part of the feature space. Therefore the motif kernel defined with the
same feature subset leads to a different result in the normalized case.
Probability model
SVMs from the packages kernlab and
e1071 support the generation of a probability
model using Platt scaling (for details see
kernlab,
predict.ksvm,
svm and
predict.svm)
allowing the computation of class probabilities during prediction. The
parameter probabilityModel controls the generation of a probability
model during training (see also parameter predictionType in
predict).
kbsvm: upon successful completion, the function returns a model of class
KBModel. Results for cross validation can be retrieved
from this model with the accessor cvResult, results for grid
search or model selection with modelSelResult. In case of
model selection the results of the outer cross validation loop can be
retrieved with with the accessor cvResult.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
predict, getKernelMatrix,
getExRep, kernelParameters-method,
spectrumKernel, mismatchKernel,
gappyPairKernel, motifKernel,
getFeatureWeights
## load transcription factor binding site data data(TFBS) enhancerFB ## we use 70 of the samples for training and the rest for test train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) test <- c(1:length(enhancerFB))[-train] ## create the kernel object for dimers without normalization specK2 <- spectrumKernel(k=2) ## show details of kernel object specK2 ## run training with kernel matrix on e1071 (via the ## dense LIBSVM implementation integrated in kebabs) model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="no") ## show KeBABS model model ## show class of KeBABS model class(model) ## show native SVM model contained in KeBABS model svmModel(model) ## show class of native SVM model class(svmModel(model)) ## Not run: ## examples for package and SVM selection ## now run the same samples with the same kernel on e1071 via ## explicit representation model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="yes") ## show KeBABS model model ## show native SVM model contained in KeBABS model svmModel(model) ## show class of native SVM model class(svmModel(model)) ## run the same samples with the same kernel on e1071 with nu-SVM model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK2, pkg="e1071", svm="nu-svc",nu=0.7, explicit="yes") ## show KeBABS model model ## training with feature weights model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="yes", featureWeights="yes") ## show feature weights dim(featureWeights(model)) featureWeights(model)[,1:5] ## training without feature weights model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="yes", featureWeights="no") ## show feature weights featureWeights(model) ## pruning of feature weights model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="yes", featureWeights="yes", weightLimit=0.5) dim(featureWeights(model)) ## training with precomputed kernel matrix ## feature weights cannot be computed for precomputed kernel matrix km <- getKernelMatrix(specK2, x=enhancerFB, selx=train) model <- kbsvm(x=km, y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="no") ## training with precomputed explicit representation exrep <- getExRep(enhancerFB, sel=train, kernel=specK2) model <- kbsvm(x=exrep, y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="yes") ## computing of probability model via Platt scaling during training ## in prediction class membership probabilities can be computed ## from this probability model model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="yes", probModel=TRUE) ## show parameters of the fitted probability model which are the parameters ## probA and probB for the fitted sigmoid function in case of classification ## and the value sigma of the fitted Laplacian in case of a regression probabilityModel(model) ## cross validation, grid search and model selection are also performed ## via the kbsvm method. Examples can be found on the respective help pages ## (see Details section) ## End(Not run)## load transcription factor binding site data data(TFBS) enhancerFB ## we use 70 of the samples for training and the rest for test train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) test <- c(1:length(enhancerFB))[-train] ## create the kernel object for dimers without normalization specK2 <- spectrumKernel(k=2) ## show details of kernel object specK2 ## run training with kernel matrix on e1071 (via the ## dense LIBSVM implementation integrated in kebabs) model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="no") ## show KeBABS model model ## show class of KeBABS model class(model) ## show native SVM model contained in KeBABS model svmModel(model) ## show class of native SVM model class(svmModel(model)) ## Not run: ## examples for package and SVM selection ## now run the same samples with the same kernel on e1071 via ## explicit representation model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="yes") ## show KeBABS model model ## show native SVM model contained in KeBABS model svmModel(model) ## show class of native SVM model class(svmModel(model)) ## run the same samples with the same kernel on e1071 with nu-SVM model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK2, pkg="e1071", svm="nu-svc",nu=0.7, explicit="yes") ## show KeBABS model model ## training with feature weights model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="yes", featureWeights="yes") ## show feature weights dim(featureWeights(model)) featureWeights(model)[,1:5] ## training without feature weights model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="yes", featureWeights="no") ## show feature weights featureWeights(model) ## pruning of feature weights model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="yes", featureWeights="yes", weightLimit=0.5) dim(featureWeights(model)) ## training with precomputed kernel matrix ## feature weights cannot be computed for precomputed kernel matrix km <- getKernelMatrix(specK2, x=enhancerFB, selx=train) model <- kbsvm(x=km, y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="no") ## training with precomputed explicit representation exrep <- getExRep(enhancerFB, sel=train, kernel=specK2) model <- kbsvm(x=exrep, y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="yes") ## computing of probability model via Platt scaling during training ## in prediction class membership probabilities can be computed ## from this probability model model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK2, pkg="e1071", svm="C-svc", C=10, explicit="yes", probModel=TRUE) ## show parameters of the fitted probability model which are the parameters ## probA and probB for the fitted sigmoid function in case of classification ## and the value sigma of the fitted Laplacian in case of a regression probabilityModel(model) ## cross validation, grid search and model selection are also performed ## via the kbsvm method. Examples can be found on the respective help pages ## (see Details section) ## End(Not run)
Collects and prints general R and package version information. If you have a question related to some KeBABS functionality or observe some unexpected behavior please call this function and send its output together with your information to the contact address specified on the title page of the package vignette. The function by default only outputs the package version of those packages which are directly related to the KeBABS functionality.
kebabsCollectInfo(onlyKebabsRelated = TRUE)kebabsCollectInfo(onlyKebabsRelated = TRUE)
onlyKebabsRelated |
if set to |
see above
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## collect KeBABS related package information kebabsCollectInfo()## collect KeBABS related package information kebabsCollectInfo()
The package contains two small sequence datasets for demonstration of the
package functionality.
TFBS is a subset of EP300/CREBBP binding data provided with the publication
Lee et al. (2011). The data is based on binding sites identified with
ChIP-seq by Visel et al. (2009). Please note that due to package
size restrictions only a small subset of the data used in Lee et al. (2011)
is included in the package. The following variables are defined:
enhancerFB contains 259 DNA sequences of tissue specific
enhancers from embryonic day 11.5 mouse embryos and 241 negative sequences
sampled from mm9 genome.
yFB contains the associated labels
CCoil is a set of heptad-annotated amino acid sequences of coiled coil
proteins forming dimers or trimers from the web site of the package
PrOCoil by Mahrenholz et. al. (2011). The data contains the sequences
with heptad annotation, the oligomerization state and group assignment for
each sequence. The grouping was performed through single linkage clustering
of sequence similarities based on pairwise ungapped alignment. Following
variables are defined:
ccseq contains 477 AA sequences of heptad-annotated amino acid
sequences with a minimum length of 8 and a maximun length of 123 AAs.
yCC contains the associated oligomerization state "DIMER" or
"TRIMER".
ccannot is a character vector with the heptad annotations for
the sequences. Characters 'a' to 'f' represent specific positions within the
coiled coil structure. The AA string set already contains the annotation
as metadata. But for demonstration purpose it is available as separate data
item.
ccgroups is a numeric vector containing the group numbers of
of the sequences.
TFBS contains the 259 positive and 241 negative sequences as DNAStringSet and the corresponding labels as numeric vector containing a value of 1 for positive and -1 for negative samples.
CCoil contains the 477 AA sequences as AAStringSet and the corresponding labels as factor. The heptad anntoation is stored as character vector and group assignment as numeric vector.
Johannes Palme
TFBS: https://www.beerlab.org/p300enhancer/
CCoil: http://www.bioinf.jku.at/software/procoil/data.html
https://github.com/UBod/kebabs
D. Lee, R. Karchin and M. A. Beer (2011) Discriminative prediction
of mammalian enhancers from DNA sequence. Genome Research,
21(12):2167-2180.
DOI: doi:10.1101/gr.121905.111.
A. Visel, M. J. Blow, Z. Li, T. Zhang, J. A. Akiyama,
A. Holt, I. Plajzer-Frick, M. Shoukry, C. Wright, F.Chen, V. Afzal,
B. Ren, E. M. Rubin and L. A. Pennacchio (2009) ChIP-seq accurately predicts
tissue-specific activity of enhancers. Nature, 457(7231):854-858.
DOI: doi:10.1038/nature07730.
C.C. Mahrenholz, I.G. Abfalter, U. Bodenhofer, R. Volkmer and
S. Hochreiter (2011) Complex networks govern coiled coil
oligomerization - predicting and profiling by means of a machine
learning approach. Mol. Cell. Proteomics, 10(5):M110.004994.
DOI: doi:10.1074/mcp.M110.004994.
KeBABS - An R package for kernel based analysis
of biological sequences
kebabsDemo()kebabsDemo()
Package Overview
The package provides functionality for kernel based analysis of DNA-, RNA- and amino acid sequences via SVM based methods. As core functionality kebabs contains following sequence kernels: spectrum kernel, mismatch kernel, gappy pair kernel and motif kernel. Apart from an efficient implementation of position independent functionality the kernels are extended in a novel way to take the position of patterns into account for the similarity measure. Because of the flexibility of the kernel formulation other kernels like the weighted degree kernel or the shifted weighted degree kernel are included as special cases. An annotation specific variant of the kernels uses annotation information placed along the sequence together with the patterns in the sequence. The package allows generation of a kernel matrix or an explicit representation for all available kernels which can be used with methods implemented in other R packages. With focus on SVM based methods kebabs provides a framework which simplifies the usage of existing SVM implementations in kernlab, e1071 and LiblineaR. Binary and multiclass classification as well as regression tasks can be used in a unified way without having to deal with the different functions, parameters and formats of the selected SVM. As support for choosing hyperparameters the package provides cross validation, grid search and model selection functions.For easier biological interpretation of the results the package computes feature weights for all SVMs and prediction profiles, which show the contribution of individual sequence positions to the prediction result and give an indication about the relevance of sequence sections for the learning result and the underlying biological functions.
see above
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## load package provided sequence dataset data(TFBS) ## display sequences enhancerFB ## display part of label vector head(yFB, 20) ## display no of samples of positive and negative class table(yFB) ## split dataset into training and test samples train <- sample(1:length(enhancerFB), 0.7*length(enhancerFB)) test <- c(1:length(enhancerFB))[-train] ## create the kernel object for the normalized spectrum kernel spec <- spectrumKernel(k=5) ## train model ## pass sequence subset, label subset, kernel object, the package and ## svm which should be used for training together with the SVM parameters model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=spec, pkg="LiblineaR", svm="C-svc", cost=10) ## predict the test samples pred <- predict(model, enhancerFB, sel=test) ## evaluate the prediction result evaluatePrediction(pred, yFB[test], allLabels=unique(yFB))## load package provided sequence dataset data(TFBS) ## display sequences enhancerFB ## display part of label vector head(yFB, 20) ## display no of samples of positive and negative class table(yFB) ## split dataset into training and test samples train <- sample(1:length(enhancerFB), 0.7*length(enhancerFB)) test <- c(1:length(enhancerFB))[-train] ## create the kernel object for the normalized spectrum kernel spec <- spectrumKernel(k=5) ## train model ## pass sequence subset, label subset, kernel object, the package and ## svm which should be used for training together with the SVM parameters model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=spec, pkg="LiblineaR", svm="C-svc", cost=10) ## predict the test samples pred <- predict(model, enhancerFB, sel=test) ## evaluate the prediction result evaluatePrediction(pred, yFB[test], allLabels=unique(yFB))
Kernel Matrix Class
Instances of this class are used in KeBABS for storing a kernel matrix. The hidden data part ".Data" contains the matrix.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
KernelMatrix Accessors
## S4 method for signature 'KernelMatrix,index,missing,ANY' x[i] ## S4 method for signature 'matrix' as.KernelMatrix(x, center = FALSE)## S4 method for signature 'KernelMatrix,index,missing,ANY' x[i] ## S4 method for signature 'matrix' as.KernelMatrix(x, center = FALSE)
x |
kernel matrix of class |
i |
numeric vector with indicies or character with element names |
center |
when set to |
see above
x[i, ]return as KernelMatrix object that only contains the rows selected
with the subsetting parameter i. This parameter can be a numeric vector
with indices or a character vector which is matched against the names of
x.
x[, j]return a KernelMatrix object that only contains the columns selected
with the subsetting parameter j. This parameter can be a numeric vector
with indices or a character vector which is matched against the names of
x.
x[i, j]return a KernelMatrix object that only contains the rows selected
with the subsetting parameter i and columns selected by j. Both parameters
can be a numeric vector with indices or a character vector which is matched
against the names of x.
In the code snippets below, x is a kernel matrix.
as.KernelMatrix(x, center=FALSE)centers the kernel matrix dependent on the center parameter and coerce
it to class KernelMatrix .
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## create kernel object for normalized spectrum kernel specK5 <- spectrumKernel(k=5) ## Not run: ## load data data(TFBS) km <- specK5(enhancerFB) km1to5 <- km[1:5,1:5] km1to5 ## End(Not run)## create kernel object for normalized spectrum kernel specK5 <- spectrumKernel(k=5) ## Not run: ## load data data(TFBS) km <- specK5(enhancerFB) km1to5 <- km[1:5,1:5] km1to5 ## End(Not run)
Create a dense or sparse kernel matrix from an explicit representation
linearKernel(x, y = NULL, selx = integer(0), sely = integer(0), sparse = FALSE, triangular = TRUE, diag = TRUE, lowerLimit = 0)linearKernel(x, y = NULL, selx = integer(0), sely = integer(0), sparse = FALSE, triangular = TRUE, diag = TRUE, lowerLimit = 0)
x |
a dense or sparse explicit representation. |
y |
a dense or sparse explicit representation. If |
selx |
a numeric or character vector for defining a subset of
|
sely |
a numeric or character vector for defining a subset of
|
sparse |
boolean indicating whether returned kernel matrix
should be sparse or dense. For value |
triangular |
boolean indicating whether just the lower triangular or the full sparse matrix should be returned. This parameter is only relevant for a sparse symmetric kernel matrix. Default=TRUE |
diag |
boolean indicating whether the diagonal should be included
in a sparse triangular matrix. This parameter is only relevant when
parameter |
lowerLimit |
a numeric value for a similarity threshold. The parameter is relevant for sparse kernel matrices only. If set to a value larger than 0 only similarity values larger than this threshold will be included in the sparse kernel matrix. Default=0 |
linearKernel:
kernel matrix as class KernelMatrix or sparse
kernel matrix of class dgCMatrix
dependent on parameter sparse
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## load sequence data and change sample names data(TFBS) names(enhancerFB) <- paste("S", 1:length(enhancerFB), sep="_") ## create the kernel object for dimers with normalization speck <- spectrumKernel(k=5) ## generate sparse explicit representation ers <- getExRep(enhancerFB, speck) ## compute dense kernel matrix (as currently used in SVM based learning) km <- linearKernel(ers) km[1:5, 1:5] ## compute sparse kernel matrix ## because it is symmetric just the lower diagonal ## is computed to save storage km <- linearKernel(ers, sparse=TRUE) km[1:5, 1:5] ## compute full sparse kernel matrix km <- linearKernel(ers, sparse=TRUE, triangular=FALSE) km[1:5, 1:5] ## compute triangular sparse kernel matrix without diagonal km <- linearKernel(ers, sparse=TRUE, triangular=TRUE, diag=FALSE) km[1:5, 1:5] ## plot histogram of similarity values hist(as(km, "numeric"), breaks=30) ## compute sparse kernel matrix with similarities above 0.5 only km <- linearKernel(ers, sparse=TRUE, lowerLimit=0.5) km[1:5, 1:5]## load sequence data and change sample names data(TFBS) names(enhancerFB) <- paste("S", 1:length(enhancerFB), sep="_") ## create the kernel object for dimers with normalization speck <- spectrumKernel(k=5) ## generate sparse explicit representation ers <- getExRep(enhancerFB, speck) ## compute dense kernel matrix (as currently used in SVM based learning) km <- linearKernel(ers) km[1:5, 1:5] ## compute sparse kernel matrix ## because it is symmetric just the lower diagonal ## is computed to save storage km <- linearKernel(ers, sparse=TRUE) km[1:5, 1:5] ## compute full sparse kernel matrix km <- linearKernel(ers, sparse=TRUE, triangular=FALSE) km[1:5, 1:5] ## compute triangular sparse kernel matrix without diagonal km <- linearKernel(ers, sparse=TRUE, triangular=TRUE, diag=FALSE) km[1:5, 1:5] ## plot histogram of similarity values hist(as(km, "numeric"), breaks=30) ## compute sparse kernel matrix with similarities above 0.5 only km <- linearKernel(ers, sparse=TRUE, lowerLimit=0.5) km[1:5, 1:5]
Assign position related metadata and reate a kernel object with position dependency
linWeight(d, sigma = 1) expWeight(d, sigma = 1) gaussWeight(d, sigma = 1) swdWeight(d) ## S4 method for signature 'XStringSet' ## positionMetadata(x) <- value ## S4 method for signature 'BioVector' ## positionMetadata(x) <- value ## S4 method for signature 'XStringSet' positionMetadata(x) ## S4 method for signature 'BioVector' positionMetadata(x)linWeight(d, sigma = 1) expWeight(d, sigma = 1) gaussWeight(d, sigma = 1) swdWeight(d) ## S4 method for signature 'XStringSet' ## positionMetadata(x) <- value ## S4 method for signature 'BioVector' ## positionMetadata(x) <- value ## S4 method for signature 'XStringSet' positionMetadata(x) ## S4 method for signature 'BioVector' positionMetadata(x)
d |
a numeric vector of distance values |
sigma |
a positive numeric value defining the peak width or in case of gaussWeight the width of the bell function (details see below) |
x |
biological sequences in the form of a
|
value |
for assignment of position metadata the value is an integer vector with gives the offset to the start position 1 for each sequence. Positive and negative offset values are possible. Without position metadata all sequences must be aligned and start at position 1. For deletion of position metadata set value to NULL. |
Position Dependent Kernel
For the standard spectrum kernel kmers are considered independent of their
position in the calculation of the similarity value between two sequences.
For position dependent kernels the position of a kmer/pattern is also of
importance. Position information for a pair of sequences can be used in
a sequenceKernel in three different ways representing the
full range of position dependency:
Position independent kernel: ignores the position of patterns and
just takes the number of their occurances or their presence (see parameter
presence in functions spectrumKernel,
gappyPairKernel, motifKernel) in the sequences
into account for similarity determination.
Distance weighted kernel: uses the position related distance between the occurance of the same pattern in the two sequences in weighted form as contribution to the similarity value (see below under Distance Weighted kernel)
Position specific kernel: considers patterns only if they occur at the same position in the two sequences (see below under Position Specific Kernel)
Position dependency is available in all kernels except the mismatch
kernel.
Distance Weighted Kernel
These kernels weight the contribution to the similarity value
based on the distance of their start positions in the two sequences. The
user can define the distance weights either through passing a distance
weighting function or a weight vector to the kernel. Through this weighting
the degree of locality in the similarity consideration between two sequences
can be adjusted flexibly. Such a position dependent kernel can be used in
the same way as the normal position independent kernel variant. Distance
weighting can be used for all kernels in this package except the mismatch
kernel. The package defines four predefined weighting functions (see also
examples):
linWeigth: a weighting function with linear decrease
expWeight: a weighting function with exponential decrease
gaussWeigth: a bell-shaped weighting function with a decrease similar to a gaussian distribution
swdWeight: the distance weighting function used in the Shifted Weighted Degree (SWD) kernel which is similar to an exponential decrease but it has a smaller peak and larger tails
Also user-defined functions can be used for distance weighting.
(see below)
Position Specific Kernel
One variant of position dependent kernels is the position specific kernel.
This kernel takes patterns into account only if they are located at
identical positions in the two sequences. This kernel can be selected
through passing a distance weight value of 1 to the kernel indicating that
the neighborhood of a pattern in the other sequence is irrelevant for the
similarity consideration. This kernel is in fact one end of the
spectrum (sic!) where locality is reduced to the exact location and the
normal position independent kernel is at the other end - not caring about
position at all. Through adjustment of sigma in the predefined functions
a continous blending between these two extremes is possible for the degree
of locality. Evaluation of position information is controlled through
setting the parameter distWeight to 1 in the functions
spectrumKernel, gappyPairKernel, motifKernel.
This parameter value is in fact interpreted as a numeric vector with 1 for
zero distance and 0 for all other distances.
Positive Definiteness
The standard SVMs only support positive definite kernels / kernel matrices.
This means that the distance weighting function must must be chosen such
that the resulting kernel is positive definite. For positive definiteness
also symmetry of the distance weighting function is important. Unlike usual
distances the relative distance value here can have positive and negative
values dependent on whether the pattern in the second sequence is located
at higher or lower positions than the pattern in the first sequence. The
predefined distance weighting functions except for swdWeight deliver a
positive definite kernel for all parameter settings. According to Sonnenburg
et al. 2005 the SWD kernel has empirically shown positive definiteness but
it is not proved for this kernel. If a weight vector with predefined weights
per distance is passed to the kernel instead of a distance weighting
function positive definiteness of the kernel must also be ensured by
adequate selection of the weight values.
User-Defined Distance Function
For user defined distance functions symmetry and positive definitness of
the resulting kernel are important. Such a function gets a numeric distance
vector 'x' as input (and possibly other parameters controlling the weighting
behavior) and returns a weight vector of identical length. When
called with a missing parameter x all other parameters must be supplied or
have appropriate default values. In this case the function must return a
new function with just the single parameter x which calls the original user
defined function with x and all the other parameters set to the values passed
in the call.
This behavior is needed for assignment of the function with missing
parameter x to the distWeight parameter in the kernel. At the time of kernel
definition the actual distance values are not available. Later when
sequence data is passed to this kernel for generation of a kernel matrix or
an explicit representation this single argument function is called to get
the distance dependent weights. The code for the predefined expWeight
function in the example section below shows how a user-specific
function can be set up.
Offset
To allow flexible alignment of sequence positions without redefining the
XStringSet or BioVector an additional metadata element named offset can be
assigned to the sequence set via positionMetadata<- (see example
below). Position metadata is a numeric vector with the same number of
elements as the sequence set and gives for each sequence an offset to
position 1. When positions metadata is not assigned to a sequence set the
position 1 is associated with the first character in each sequence of the
sequence set., i.e. in this case the sequences should be aligned such that
all have the same starting positions with respect to the learning task
(e.g. all sequences start at a transcription start site). Offset information
is only evaluated in position dependent kernel variants.
The distance weighting functions return a numerical vector with distance weights.
Johannes Palme
https://github.com/UBod/kebabs
U. Bodenhofer, K. Schwarzbauer, M. Ionescu, and
S. Hochreiter (2009)
Modelling position specificity in sequence kernels by fuzzy
equivalence relations. Proc. Joint 13th IFSA World Congress and 6th
EUSFLAT Conference, pp. 1376-1381, Lisbon.
S. Sonnenburg, G. Raetsch, and B. Schoelkopf (2005)
Large scale genomic sequence SVM classifiers.
Proc. 22nd Int. Conf. on Machine learning, pp. 848-855.
DOI: doi:10.1145/1102351.1102458.
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
spectrumKernel, gappyPairKernel,
motifKernel, annotationMetadata,
metadata, mcols
## plot predefined weighting functions for sigma=10 curve(linWeight(x, sigma=10), from=-20, to=20, xlab="pattern distance", ylab="weight", main="Predefined Distance Weighting Functions", col="green") curve(expWeight(x, sigma=10), from=-20, to=20, col="blue", add=TRUE) curve(gaussWeight(x, sigma=10), from=-20, to=20, col="red", add=TRUE) curve(swdWeight(x), from=-20, to=20, col="orange", add=TRUE) legend('topright', inset=0.03, title="Weighting Functions", c("linWeight", "expWeight", "gaussWeight", "swdWeight"), fill=c("green", "blue", "red", "orange")) text(14, 0.70, "sigma = 10") ## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created ## RNA- or AA-sequences can be used as well with the motif kernel dnaseqs <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC")) names(dnaseqs) <- paste("S", 1:length(dnaseqs), sep="") ## create a distance weighted spectrum kernel with linear decrease of ## weights in a range of 20 bases spec20 <- spectrumKernel(k=3, distWeight=linWeight(sigma=20)) ## show details of kernel object kernelParameters(spec20) ## this kernel can be now be used in a classification or regression task ## in the usual way or a kernel matrix can be generated for use with ## another learning method km <- spec20(x=dnaseqs, selx=1:5) km[1:5,1:5] ## Not run: ## instead of a distance weighting function also a weight vector can be ## passed in the distWeight parameter but the values must be chosen such ## that they lead to a positive definite kernel ## ## in this example only patterns within a 5 base range are considered with ## slightly decreasing weights specv <- spectrumKernel(k=3, distWeight=c(1,0.95,0.9,0.85,0.8)) km <- specv(dnaseqs) km[1:5,1:5] ## position specific spectrum kernel specps <- spectrumKernel(k=3, distWeight=1) km <- specps(dnaseqs) km[1:5,1:5] ## get position specific kernel matrix km <- specps(dnaseqs) km[1:5,1:5] ## example with offset to align sequence positions (e.g. the ## transcription start site), the value gives the offset to position 1 positionOne <- c(9,6,3,1,6) positionMetadata(dnaseqs) <- positionOne ## show position metadata positionMetadata(dnaseqs) ## generate kernel matrix with position-specific spectrum kernel km1 <- specps(dnaseqs) km1[1:5,1:5] ## example for a user defined weighting function ## please stick to the order as described in the comments below and ## make sure that the resulting kernel is positive definite expWeightUserDefined <- function(x, sigma=1) { ## check presence and validity of all parameters except for x if (!isSingleNumber(sigma)) stop("'sigma' must be a number") ## if x is missing the function returns a closure where all parameters ## except for x have a defined value if (missing(x)) return(function(x) expWeightUserDefined(x, sigma=sigma)) ## pattern distance vector x must be numeric if (!is.numeric(x)) stop("'x' must be a numeric vector") ## create vector of distance weights from the ## input vector of pattern distances x exp(-abs(x)/sigma) } ## define kernel object with user defined weighting function specud <- spectrumKernel(k=3, distWeight=expWeightUserDefined(sigma=5), normalized=FALSE) ## End(Not run)## plot predefined weighting functions for sigma=10 curve(linWeight(x, sigma=10), from=-20, to=20, xlab="pattern distance", ylab="weight", main="Predefined Distance Weighting Functions", col="green") curve(expWeight(x, sigma=10), from=-20, to=20, col="blue", add=TRUE) curve(gaussWeight(x, sigma=10), from=-20, to=20, col="red", add=TRUE) curve(swdWeight(x), from=-20, to=20, col="orange", add=TRUE) legend('topright', inset=0.03, title="Weighting Functions", c("linWeight", "expWeight", "gaussWeight", "swdWeight"), fill=c("green", "blue", "red", "orange")) text(14, 0.70, "sigma = 10") ## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created ## RNA- or AA-sequences can be used as well with the motif kernel dnaseqs <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC")) names(dnaseqs) <- paste("S", 1:length(dnaseqs), sep="") ## create a distance weighted spectrum kernel with linear decrease of ## weights in a range of 20 bases spec20 <- spectrumKernel(k=3, distWeight=linWeight(sigma=20)) ## show details of kernel object kernelParameters(spec20) ## this kernel can be now be used in a classification or regression task ## in the usual way or a kernel matrix can be generated for use with ## another learning method km <- spec20(x=dnaseqs, selx=1:5) km[1:5,1:5] ## Not run: ## instead of a distance weighting function also a weight vector can be ## passed in the distWeight parameter but the values must be chosen such ## that they lead to a positive definite kernel ## ## in this example only patterns within a 5 base range are considered with ## slightly decreasing weights specv <- spectrumKernel(k=3, distWeight=c(1,0.95,0.9,0.85,0.8)) km <- specv(dnaseqs) km[1:5,1:5] ## position specific spectrum kernel specps <- spectrumKernel(k=3, distWeight=1) km <- specps(dnaseqs) km[1:5,1:5] ## get position specific kernel matrix km <- specps(dnaseqs) km[1:5,1:5] ## example with offset to align sequence positions (e.g. the ## transcription start site), the value gives the offset to position 1 positionOne <- c(9,6,3,1,6) positionMetadata(dnaseqs) <- positionOne ## show position metadata positionMetadata(dnaseqs) ## generate kernel matrix with position-specific spectrum kernel km1 <- specps(dnaseqs) km1[1:5,1:5] ## example for a user defined weighting function ## please stick to the order as described in the comments below and ## make sure that the resulting kernel is positive definite expWeightUserDefined <- function(x, sigma=1) { ## check presence and validity of all parameters except for x if (!isSingleNumber(sigma)) stop("'sigma' must be a number") ## if x is missing the function returns a closure where all parameters ## except for x have a defined value if (missing(x)) return(function(x) expWeightUserDefined(x, sigma=sigma)) ## pattern distance vector x must be numeric if (!is.numeric(x)) stop("'x' must be a numeric vector") ## create vector of distance weights from the ## input vector of pattern distances x exp(-abs(x)/sigma) } ## define kernel object with user defined weighting function specud <- spectrumKernel(k=3, distWeight=expWeightUserDefined(sigma=5), normalized=FALSE) ## End(Not run)
Create a mismatch kernel object and the kernel matrix
mismatchKernel(k = 3, m = 1, r = 1, normalized = TRUE, exact = TRUE, ignoreLower = TRUE, presence = FALSE) ## S4 method for signature 'MismatchKernel' getFeatureSpaceDimension(kernel, x)mismatchKernel(k = 3, m = 1, r = 1, normalized = TRUE, exact = TRUE, ignoreLower = TRUE, presence = FALSE) ## S4 method for signature 'MismatchKernel' getFeatureSpaceDimension(kernel, x)
k |
length of the substrings also called kmers; this parameter defines the size of the feature space, i.e. the total number of features considered in this kernel is |A|^k, with |A| as the size of the alphabet (4 for DNA and RNA sequences and 21 for amino acid sequences). Default=3 |
m |
number of maximal mismatch per kmer. The allowed value range is between 1 and k-1. The processing effort for this kernel is highly dependent on the value of m and only small values will allow efficient processing. Default=1 |
r |
exponent which must be > 0 (see details section in spectrumKernel). Default=1 |
normalized |
a kernel matrix or explicit representation generated with this kernel will be normalized(details see below). Default=TRUE |
exact |
use exact character set for the evaluation (details see below). Default=TRUE |
ignoreLower |
ignore lower case characters in the sequence. If the parameter is not set lower case characters are treated like uppercase. Default=TRUE |
presence |
if this parameter is set only the presence of a kmers will be considered, otherwise the number of occurances of the kmer is used. Default=FALSE |
kernel |
a sequence kernel object |
x |
one or multiple biological sequences in the form of a
|
Creation of kernel object
The function 'mismatchKernel' creates a kernel object for the mismatch
kernel. This kernel object can then be used with a set of DNA-, RNA- or
AA-sequences to generate a kernel matrix or an explicit representation for
this kernel. For values different from 1 (=default value) parameter
r leads to a transfomation of similarities by taking each element of
the similarity matrix to the power of r. If normalized=TRUE, the
feature vectors are scaled to the unit sphere before computing the
similarity value for the kernel matrix. For two samples with the feature
vectors x and y the similarity is computed as:
For an explicit representation generated with the feature map of a
normalized kernel the rows are normalized by dividing them through their
Euclidean norm. For parameter exact=TRUE the sequence characters
are interpreted according to an exact character set. If the flag is not
set ambigous characters from the IUPAC characterset are also evaluated.
The annotation specific variant (for details see positionMetadata)
and the position dependent variant (for details see
annotationMetadata) are not available for this kernel.
Creation of kernel matrix
The kernel matrix is created with the function getKernelMatrix
or via a direct call with the kernel object as shown in the examples below.
mismatchKernel: upon successful completion, the function returns a kernel
object of class MismatchKernel.
of getDimFeatureSpace: dimension of the feature space as numeric value
Johannes Palme
https://github.com/UBod/kebabs
C.S. Leslie, E. Eskin, J. Weston, and W.S. Noble.
Mismatch string kernels for discriminative protein classification.
Bioinformatics, 1:1-10.
DOI: doi:10.1093/bioinformatics/btg431.
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
kernelParameters, getKernelMatrix,
getExRep, spectrumKernel,
gappyPairKernel, motifKernel,
MismatchKernel
## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created ## RNA- or AA-sequences can be used as well with the mismatch kernel dnaseqs <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC")) names(dnaseqs) <- paste("S", 1:length(dnaseqs), sep="") ## create the kernel object with one mismatch per kmer mm <- mismatchKernel(k=2, m=1, normalized=FALSE) ## show details of kernel object mm ## generate the kernel matrix with the kernel object km <- mm(dnaseqs) dim(km) km[1:5, 1:5] ## alternative way to generate the kernel matrix km <- getKernelMatrix(mm, dnaseqs) km[1:5,1:5] ## Not run: ## plot heatmap of the kernel matrix heatmap(km, symm=TRUE) ## End(Not run)## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created ## RNA- or AA-sequences can be used as well with the mismatch kernel dnaseqs <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC")) names(dnaseqs) <- paste("S", 1:length(dnaseqs), sep="") ## create the kernel object with one mismatch per kmer mm <- mismatchKernel(k=2, m=1, normalized=FALSE) ## show details of kernel object mm ## generate the kernel matrix with the kernel object km <- mm(dnaseqs) dim(km) km[1:5, 1:5] ## alternative way to generate the kernel matrix km <- getKernelMatrix(mm, dnaseqs) km[1:5,1:5] ## Not run: ## plot heatmap of the kernel matrix heatmap(km, symm=TRUE) ## End(Not run)
Mismatch Kernel Class
Instances of this class represent a kernel object for the mismatch kernel. The class is derived from SequenceKernel.
klength of the substrings considered by the kernel
mmaximum number of mismatches
rexponent (for details see mismatchKernel)
annSpecnot used for mismatch kernel
distWeightnot used for mismatch kernel
normalizeddata generated with this kernel object is normalized
exactuse exact character set for evaluation
ignoreLowerignore lower case characters in the sequence
presenceconsider only the presence of kmers not their counts
revComplementnot used for mismatch kernel
mixCoefnot used for mismatch kernel
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
Model Selection Result Class
Instances of this class store the result of grid search or model selection.
crossnumber of folds for cross validation
noCrossnumber of CV runs
groupBygroup assignment of samples
nestedCrossnumber of folds for outer CV
noNestedCrossnumber of runs of outer CV
perfParameterscollected performance parameters
perfObjectiveperformance criterion for grid search / model selection
gridRowsrows in grid search (i.e. kernels)
gridColscolumns in grid search
gridErrorsgrid errors
gridACCgrid accuracy
gridBACCgrid balanced accuracy
gridMCCgrid Matthews correlation coefficient
gridAUCgrid area under the ROC curve
gridNoSVgrid number of support vectors
gridSumAlphasgrid sum of alphas
smallestCVErrorsmallest CV error
selGridRowgrid row of best result
selGridColgrid col of best result
fullModelfull model for best result
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
ModelSelectionResult Accessors
## S4 method for signature 'ModelSelectionResult' gridRows(object)## S4 method for signature 'ModelSelectionResult' gridRows(object)
object |
a model selection result object (can be extracted from
KeBABS model with accessor |
gridRows: returns a list of kernel objectsgridColumns: returns a DataFrame object with grid column
parametersgridErrors: returns a matrix with grid errorsperformance: returns a list of matrices with performance values
selGridRow: returns the selected kernel
selGridCol: returns the selected SVM and/or hyperparameter(s)
fullModel: returns a kebabs model of class
KBModel
In all descriptions below, object is an object of class
ModelSelectionResult.
gridRows(object)returns the grid rows containing the kernels.
gridColumns(object)returns the grid columns.
gridErrors(object)returns the grid CV errors.
performance(object)return the collected performance parameters.
selGridRow(object)returns the selected grid row.
selGridCol(object)returns the selected grid column.
fullModel(object)returns the full model.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## create kernel object for normalized spectrum kernel specK5 <- spectrumKernel(k=5) ## Not run: ## load data data(TFBS) ## perform training - feature weights are computed by default model <- kbsvm(enhancerFB, yFB, specK5, pkg="LiblineaR", svm="C-svc", cost=c(1,15,50,100), cross=10, perfParameters="ALL", showProgress=TRUE) ## show model selection result mres <- modelSelResult(model) mres ## extract grid errors gridErrors(mres) ## extract other performance parameters performance(mres) ## End(Not run)## create kernel object for normalized spectrum kernel specK5 <- spectrumKernel(k=5) ## Not run: ## load data data(TFBS) ## perform training - feature weights are computed by default model <- kbsvm(enhancerFB, yFB, specK5, pkg="LiblineaR", svm="C-svc", cost=c(1,15,50,100), cross=10, perfParameters="ALL", showProgress=TRUE) ## show model selection result mres <- modelSelResult(model) mres ## extract grid errors gridErrors(mres) ## extract other performance parameters performance(mres) ## End(Not run)
Create a motif kernel object and the kernel matrix
motifKernel(motifs, r = 1, annSpec = FALSE, distWeight = numeric(0), normalized = TRUE, exact = TRUE, ignoreLower = TRUE, presence = FALSE) ## S4 method for signature 'MotifKernel' getFeatureSpaceDimension(kernel, x)motifKernel(motifs, r = 1, annSpec = FALSE, distWeight = numeric(0), normalized = TRUE, exact = TRUE, ignoreLower = TRUE, presence = FALSE) ## S4 method for signature 'MotifKernel' getFeatureSpaceDimension(kernel, x)
motifs |
a set of motif patterns specified as character vector. The order in which the patterns are passed for creation of the kernel object also determines the order of the features in the explicit representation. Lowercase characters in motifs are always converted to uppercase. For details concerning the definition of motif patterns see below and in the examples section. |
r |
exponent which must be > 0 (see details section in spectrumKernel). Default=1 |
annSpec |
boolean that indicates whether sequence annotation should
be taken into account (details see on help page for
|
distWeight |
a numeric distance weight vector or a distance weighting
function (details see on help page for |
normalized |
generated data from this kernel will be normalized (details see below). Default=TRUE |
exact |
use exact character set for the evaluation (details see below). Default=TRUE |
ignoreLower |
ignore lower case characters in the sequence. If the parameter is not set lower case characters are treated like uppercase. default=TRUE |
presence |
if this parameter is set only the presence of a motif will be considered, otherwise the number of occurances of the motif is used; Default=FALSE |
kernel |
a sequence kernel object |
x |
one or multiple biological sequences in the form of a
|
Creation of kernel object
The function 'motif' creates a kernel object for the motif kernel for a set
of given DNA-, RNA- or AA-motifs. This kernel object can then be used to
generate a kernel matrix or an explicit representation for this kernel.
The individual patterns in the set of motifs are built similar to regular
expressions through concatination of following elements in arbitrary order:
a specific character from the used character set - e.g. 'A' or 'G' in DNA patterns for matching a specific character
the wildcard character '.' which matches any valid character of the character set except '-'
a substitution group specified by a collection of characters from the character set enclosed in square brackets - e.g. [AG] - which matches any of the listed characters; with a leading '^' the character list is inverted and matching occurs for all characters of the character set which are not listed except '-'
For values different from 1 (=default value) parameter r leads
to a transfomation of similarities by taking each element of the similarity
matrix to the power of r. For the annotation specific variant of this
kernel see annotationMetadata, for the distance weighted
variants see positionMetadata. If normalized=TRUE, the
feature vectors are scaled to the unit sphere before computing the
similarity value for the kernel matrix. For two samples with the feature
vectors x and y the similarity is computed as:
For an explicit representation generated with the feature map of a
normalized kernel the rows are normalized by dividing them through their
Euclidean norm. For parameter exact=TRUE the sequence characters
are interpreted according to an exact character set. If the flag is not
set ambigous characters from the IUPAC characterset are also evaluated.
The annotation specific variant (for details see annotationMetadata) and the position dependent variants (for details see positionMetadata) either in the form of a position specific or a distance weighted kernel are supported for the motif kernel. The generation of an explicit representation is not possible for the position dependent variants of this kernel.
Hint: For a normalized motif kernel with a feature subset of a normalized
spectrum kernel the explicit representation will not be identical to the
subset of an explicit representation for the spectrum kernel because
the motif kernel is not aware of the other kmers which are used in the
spectrum kernel additionally for normalization.
Creation of kernel matrix
The kernel matrix is created with the function getKernelMatrix
or via a direct call with the kernel object as shown in the examples below.
motif: upon successful completion, the function returns a kernel
object of class MotifKernel.
of getDimFeatureSpace: dimension of the feature space as numeric value
Johannes Palme
https://github.com/UBod/kebabs
A. Ben-Hur and D. Brutlag () Remote homology detection:
a motif based approach. Bioinformatics, 19:26-33.
DOI: doi:10.1093/bioinformatics/btg1002.
U. Bodenhofer, K. Schwarzbauer, M. Ionescu, and
S. Hochreiter (2009)
Modelling position specificity in sequence kernels by fuzzy
equivalence relations. Proc. Joint 13th IFSA World Congress and 6th
EUSFLAT Conference, pp. 1376-1381, Lisbon.
C.C. Mahrenholz, I.G. Abfalter, U. Bodenhofer, R. Volkmer and
S. Hochreiter (2011) Complex networks govern coiled coil
oligomerization - predicting and profiling by means of a machine
learning approach. Mol. Cell. Proteomics, 10(5):M110.004994.
DOI: doi:10.1074/mcp.M110.004994.
UJ. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
kernelParameters-method,
getKernelMatrix, getExRep,
spectrumKernel, mismatchKernel,
gappyPairKernel
## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created ## RNA- or AA-sequences can be used as well with the motif kernel dnaseqs <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC")) names(dnaseqs) <- paste("S", 1:length(dnaseqs), sep="") ## create the kernel object with the motif patterns mot <- motifKernel(c("A[CG]T","C.G","G[^A][AT]"), normalized=FALSE) ## show details of kernel object mot ## generate the kernel matrix with the kernel object km <- mot(dnaseqs) dim(km) km ## alternative way to generate the kernel matrix km <- getKernelMatrix(mot, dnaseqs) ## Not run: ## plot heatmap of the kernel matrix heatmap(km, symm=TRUE) ## generate rectangular kernel matrix km <- mot(x=dnaseqs, selx=1:3, y=dnaseqs, sely=4:5) dim(km) km ## End(Not run)## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created ## RNA- or AA-sequences can be used as well with the motif kernel dnaseqs <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC")) names(dnaseqs) <- paste("S", 1:length(dnaseqs), sep="") ## create the kernel object with the motif patterns mot <- motifKernel(c("A[CG]T","C.G","G[^A][AT]"), normalized=FALSE) ## show details of kernel object mot ## generate the kernel matrix with the kernel object km <- mot(dnaseqs) dim(km) km ## alternative way to generate the kernel matrix km <- getKernelMatrix(mot, dnaseqs) ## Not run: ## plot heatmap of the kernel matrix heatmap(km, symm=TRUE) ## generate rectangular kernel matrix km <- mot(x=dnaseqs, selx=1:3, y=dnaseqs, sely=4:5) dim(km) km ## End(Not run)
Motif Kernel Class
Instances of this class represent a kernel object for the motif kernel. The class is derived from SequenceKernel. The motif character vector is not stored in the kernel object.
rexponent (for details see motifKernel)
annSpecwhen set the kernel evaluates annotation information
distWeightdistance weighting function or vector
normalizeddata generated with this kernel object is normalized
exactuse exact character set for evaluation
ignoreLowerignore lower case characters in the sequence
presenceconsider only the presence of motifs not their counts
revComplementconsider a kmer and its reverse complement as the same feature
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
Perform cross validation as k-fold cross validation, Leave-One-Out cross validation(LOOCV) or grouped cross validation (GCV).
## kbsvm(......, cross=0, noCross=1, .....) ## please use kbsvm for cross validation and do not call the ## performCrossValidation method directly ## S4 method for signature 'ExplicitRepresentation' performCrossValidation(object, x, y, sel, model, cross, noCross, groupBy, perfParameters, verbose)## kbsvm(......, cross=0, noCross=1, .....) ## please use kbsvm for cross validation and do not call the ## performCrossValidation method directly ## S4 method for signature 'ExplicitRepresentation' performCrossValidation(object, x, y, sel, model, cross, noCross, groupBy, perfParameters, verbose)
object |
a kernel matrix or an explicit representation |
x |
an optional set of sequences |
y |
a response vector |
sel |
sample subset for which cross validation should be performed |
model |
KeBABS model |
cross |
an integer value K > 0 indicates that k-fold cross validation should be performed. A value -1 is used for Leave-One-Out (LOO) cross validation. (see above) Default=0 |
noCross |
an integer value larger than 0 is used to specify the number of repetitions for cross validation. This parameter is only relevant if 'cross' is different from 0. Default=1 |
groupBy |
allows a grouping of samples during cross validation. The parameter is only relevant when 'cross' is larger than 1. It is an integer vector or factor with the same length as the number of samples used for training and specifies for each sample to which group it belongs. Samples from the same group are never spread over more than one fold. Grouped cross validation can also be used in grid search for each grid point. Default=NULL |
perfParameters |
a character vector with one or several values from the set "ACC" , "BACC", "MCC", "AUC" and "ALL". "ACC" stands for accuracy, "BACC" for balanced accuracy, "MCC" for Matthews Correlation Coefficient, "AUC" for area under the ROC curve and "ALL" for all four. This parameter defines which performance parameters are collected in cross validation for display purpose. The summary values are computed as mean of the fold values. AUC computation from pooled decision values requires a calibrated classifier output and is currently not supported. Default=NULL |
verbose |
boolean value that indicates whether KeBABS should print additional messages showing the internal processing logic in a verbose manner. The default value depends on the R session verbosity option. Default=getOption("verbose") this parameter is not relevant for cross validation because
the method |
Overview
Cross validation (CV) provides an estimate for the generalization
performance of a model based on repeated training on different subsets of
the data and evaluating the prediction performance on the remaining data
not used for training. Dependent on the strategy of splitting the data
different variants of cross validation exist. KeBABS implements k-fold cross
validation, Leave-One-Out cross validation and Leave-Group-Out cross
validation which is a specific variant of k-fold cross validation. Cross
validation is invoked with kbsvm through setting the
parameters cross and noCross. It can either
be used for a given kernel and specific values of the SVM hyperparameters to
compute the cross validation error of a single model or in conjuction with
grid search (see gridSearch) and model selection (see
modelSelection) to determine the performance of multiple models.
k-fold Cross Validation and Leave-One-Out Cross Validation(LOOCV)
For k-fold cross validation the data is split into k roughly equal sized
subsets called folds. Samples are assigned to the folds randomly. In k
successive training runs one of the folds is kept in round-robin manner
for predicting the performance while using the other k-1 folds together as
training data. Typical values for the number of folds k are 5 or 10
dependent on the number of samples used for CV. For LOOCV the fold size
decreases to 1 and only a single sample is kept as hold out fold for
performance prediction requiring the same number of training runs in one
cross validation run as the number of sequences used for CV.
Grouped Cross Validation (GCV)
For grouped cross validation samples are assigned to groups by the
user before running cross validation, e.g. via clustering the sequences.
The predefined group assignment is passed to CV with the parameter
groupBy in kbsvm. GCV is a special version of k-fold
cross validation which respects group boundaries by avoiding to distribute
samples of one group over multiple folds. In this way the group(s) in the
test fold do not occur during training and learning is forced to concentrate
on more complex features instead of the simple features splitting the
groups. For GCV the parameter cross must be smaller than or equal to the
number of groups.
Cross Validation Result
The cross validation error, which is the average of the predicition errors
in all held out folds, is used as an estimate for the generalization error
of the model assiciated with the cross validation run. For classification
the fraction of incorrectly classified samples and for regression the mean
squared error (MSE) is used as prediction error. Multiple cross validation
runs can be performed through setting the parameter noCross. The
cross validation result can be extracted from the model object returned by
cross validation with the cvResult accessor. It contains the
mean CV error over all runs, the CV errors of the single runs and the
CV error for each fold. The CV result object can be plotted with the method
plot showing the variation of the CV error for the different
runs as barplot. With the parameter perfParameters in
kbsvm the accuracy, the balanced accuracy and the Matthews
correlation coefficient can be requested as additional performance
parameters to be recorded in the CV result object which might be of interest
especially for unbalanced datasets.
cross validation stores the cross validation results in the
KeBABS model object returned by . They can be retrieved with the accessor
cvResult returned by kbsvm.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## load transcription factor binding site data data(TFBS) enhancerFB ## select a few samples for training - here for demonstration purpose ## normally you would use 70 or 80% of the samples for training and ## the rest for test ## train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) ## test <- c(1:length(enhancerFB))[-train] train <- sample(1:length(enhancerFB), 50) ## create a kernel object for the gappy pair kernel with normalization gappy <- gappyPairKernel(k=1, m=4) ## show details of kernel object gappy ## run cross validation with the kernel on C-svc in LiblineaR for cost=10 model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="LiblineaR", svm="C-svc", cost=10, cross=3) ## show cross validation result cvResult(model) ## Not run: ## perform tive cross validation runs model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="LiblineaR", svm="C-svc", cost=10, cross=10, noCross=5) ## show cross validation result cvResult(model) ## plot cross validation result plot(cvResult(model)) ## run Leave-One-Out cross validation model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="LiblineaR", svm="C-svc", cost=10, cross=-1) ## show cross validation result cvResult(model) ## run gouped cross validation with full data ## on coiled coil dataset ## ## In this example the groups were determined through single linkage ## clustering of sequence similarities derived from ungapped heptad-specific ## pairwise alignment of the sequences. The variable {\tt ccgroup} contains ## the pre-calculated group assignments for the individual sequences. data(CCoil) ccseq head(yCC) head(ccgroups) gappyK1M6 <- gappyPairKernel(k=1, m=4) ## run k-fold CV without groups model <- kbsvm(x=ccseq, y=as.numeric(yCC), kernel=gappyK1M6, pkg="LiblineaR", svm="C-svc", cost=10, cross=3, noCross=2, perfObjective="BACC",perfParameters=c("ACC", "BACC")) ## show result without groups cvResult(model) ## run grouped CV model <- kbsvm(x=ccseq, y=as.numeric(yCC), kernel=gappyK1M6, pkg="LiblineaR", svm="C-svc", cost=10, cross=3, noCross=2, groupBy=ccgroups, perfObjective="BACC", perfParameters=c("ACC", "BACC")) ## show result with groups cvResult(model) ## For grouped CV the samples in the held out fold are from a group which ## is not present in training on the other folds. The simimar CV error ## with and without groups shows that learning is not just assigning ## labels based on similarity within the groups but is focusing on features ## that are indicative for the class also in the CV without groups. For the ## GCV no information about group membership for the samples in the held ## out fold is present in the model. This example should show how GCV ## is performed. Because of package size limitations no specific dataset is ## available in this package where GCV is necessary. ## End(Not run)## load transcription factor binding site data data(TFBS) enhancerFB ## select a few samples for training - here for demonstration purpose ## normally you would use 70 or 80% of the samples for training and ## the rest for test ## train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) ## test <- c(1:length(enhancerFB))[-train] train <- sample(1:length(enhancerFB), 50) ## create a kernel object for the gappy pair kernel with normalization gappy <- gappyPairKernel(k=1, m=4) ## show details of kernel object gappy ## run cross validation with the kernel on C-svc in LiblineaR for cost=10 model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="LiblineaR", svm="C-svc", cost=10, cross=3) ## show cross validation result cvResult(model) ## Not run: ## perform tive cross validation runs model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="LiblineaR", svm="C-svc", cost=10, cross=10, noCross=5) ## show cross validation result cvResult(model) ## plot cross validation result plot(cvResult(model)) ## run Leave-One-Out cross validation model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="LiblineaR", svm="C-svc", cost=10, cross=-1) ## show cross validation result cvResult(model) ## run gouped cross validation with full data ## on coiled coil dataset ## ## In this example the groups were determined through single linkage ## clustering of sequence similarities derived from ungapped heptad-specific ## pairwise alignment of the sequences. The variable {\tt ccgroup} contains ## the pre-calculated group assignments for the individual sequences. data(CCoil) ccseq head(yCC) head(ccgroups) gappyK1M6 <- gappyPairKernel(k=1, m=4) ## run k-fold CV without groups model <- kbsvm(x=ccseq, y=as.numeric(yCC), kernel=gappyK1M6, pkg="LiblineaR", svm="C-svc", cost=10, cross=3, noCross=2, perfObjective="BACC",perfParameters=c("ACC", "BACC")) ## show result without groups cvResult(model) ## run grouped CV model <- kbsvm(x=ccseq, y=as.numeric(yCC), kernel=gappyK1M6, pkg="LiblineaR", svm="C-svc", cost=10, cross=3, noCross=2, groupBy=ccgroups, perfObjective="BACC", perfParameters=c("ACC", "BACC")) ## show result with groups cvResult(model) ## For grouped CV the samples in the held out fold are from a group which ## is not present in training on the other folds. The simimar CV error ## with and without groups shows that learning is not just assigning ## labels based on similarity within the groups but is focusing on features ## that are indicative for the class also in the CV without groups. For the ## GCV no information about group membership for the samples in the held ## out fold is present in the model. This example should show how GCV ## is performed. Because of package size limitations no specific dataset is ## available in this package where GCV is necessary. ## End(Not run)
Perform grid search with one or multiple sequence kernels on one or multiple SVMs with one or multiple SVM parameter sets.
## kbsvm(...., kernel=list(kernel1, kernel2), pkg=pkg1, svm=svm1, ## cost=cost1, ...., cross=0, noCross=1, ....) ## kbsvm(...., kernel=kernel1, pkg=pkg1, svm=svm1, ## cost=c(cost1, cost2), ...., cross=0, noCross=1, ....) ## kbsvm(...., kernel=kernel1, pkg=c(pkg1, pkg1, pkg1), ## svm=c(svm1, svm2, svm3), cost=c(cost1, cost2, cost3), ...., ## cross=0, noCross=1, ....) ## kbsvm(...., kernel=kernel1, pkg=c(pkg1, pkg2, pkg3), ## svm=c(svm1, svm2, svm3), cost=c(cost1, cost2, cost3), ...., ## cross=0, noCross=1, ....) ## kbsvm(...., kernel=list(kernel1, kernel2, kernel3), pkg=c(pkg1, pkg2), ## svm=c(svm1, svm2), cost=c(cost1, cost2), ...., cross=0, ## noCross=1, ....) ## for details see below## kbsvm(...., kernel=list(kernel1, kernel2), pkg=pkg1, svm=svm1, ## cost=cost1, ...., cross=0, noCross=1, ....) ## kbsvm(...., kernel=kernel1, pkg=pkg1, svm=svm1, ## cost=c(cost1, cost2), ...., cross=0, noCross=1, ....) ## kbsvm(...., kernel=kernel1, pkg=c(pkg1, pkg1, pkg1), ## svm=c(svm1, svm2, svm3), cost=c(cost1, cost2, cost3), ...., ## cross=0, noCross=1, ....) ## kbsvm(...., kernel=kernel1, pkg=c(pkg1, pkg2, pkg3), ## svm=c(svm1, svm2, svm3), cost=c(cost1, cost2, cost3), ...., ## cross=0, noCross=1, ....) ## kbsvm(...., kernel=list(kernel1, kernel2, kernel3), pkg=c(pkg1, pkg2), ## svm=c(svm1, svm2), cost=c(cost1, cost2), ...., cross=0, ## noCross=1, ....) ## for details see below
kernel |
and other parameters see |
Overview
To simplify the selection of an appropriate sequence kernel (including
setting of the kernel parameters), SVM implementation and setting of SVM
hyperparameters KeBABS provides grid search functionality. In
addition to the possibility of running the same learning tasks for
different settings of the SVM hyperparameters the concept of grid search
is seen here in the broader context of finding good values for all major
variable parts of the learning task which includes:
selection of the sequence kernel and standard kernel parameters: spectrum, mismatch, gappy pair or motif kernel
selection of the kernel variant: regular, annotation-specific, position-specific or distance weighted kernel variants
selection of the SVM implementation via package and SVM
selection of the SVM hyperparameters for the SVM implementation
KeBABS supports the joint variation of any combination of these learning
aspects together with cross validation (CV) to find the best selection based
on cross validation performance. After the grid search the performance
values of the different settings and the best setting of the grid search
run can be retrieved from the KeBABS model with the accessor
modelSelResult.
Grid search is started with the method kbsvm by passing
multiple values to parameters for which in regular training only a single
parameter value is used. Multiple values can be passed for the parameter
kernel as list of kernel objects and for the parameters pkg,
svm and the hyperparameters of the used SVMs as vectors (numeric or
integer vector dependent on the hyperparameter). The parameter cost in the
usage section above is just one representative of SVM hyperparameters that
can be varied in grid search. Following types of grid search are supported
(for examples see below):
variation of one or multiple hyperparameter(s) for a given SVM implementation and one specific kernel by passing hyperparameter values as vectors
variation of the kernel parameters of a single kernel:
for the sequence kernels in addition to the standard kernel parameters
like k for spectrum or m for gappy pair analysis can be performed in a
position-independent or position-dependent manner with multiple
distance weighting functions and different parameter settings for the
distance weighting functions (see positionMetadata) or
with or without annotation specific functionality (see
annotationMetadata using one specific or multiple
annotations resulting in considerable variation possibilities on the
kernel side. The kernel objects for the different parameter settings
of the kernel must be precreated and are passed as list to
kbsvm. Usually each kernel has the best performance
at differernt hyperparameter values. Therefore in general just varying
the kernel parameters without varying the hyperparameter values does
not make sense but both must be varied together as described below.
variation of multiple SVMs from the same or different R packages with identical or different SVM hyperparameters (dependent on the formulation of the SVM objective) for one specific kernel
combination of the previous three variants as far as runtime allows (see also runtime hints below)
For collecting performance values grid search is organized in a matrix
like manner with different kernel objects representing the rows and
different hyperparameter settings or SVM and hyperparameter settings as
columns of the matrix. If multiple hyperparameters are used on a single
SVM the same entry in all hyperparameter vectors is used as one parameter
set corresponding to a single column in the grid matrix. The same
applies to multiple SVMs, i.e. when multiple SVMs are used from the same
package the pkg parameter still must have one entry for each entry
in the svm parameter (see examples below). The best performing
setting is reported dependent on the performance objective.
Instead of a single training and test cycle for each grid point cross
validation should be used to get more representative results. In this case
CV is executed for each parameter setting. For larger datasets or kernels
with higher complexity the runtime for the full grid search should be
limited through adequate selection of the parameter cross.
Performance measures and performance objective
The usual performance measure for grid search is the cross validation error
which is stored by default for each grid point. For e.g. non-symmetrical
class distribution of the dataset other performance measures can be more
expressive. For such sitations also the accuracy, the balanced accuracy and
the Matthews correlation coefficient can be stored for a grid point (see
parameter perfParameters in kbsvm. (The accuracy
corresponds fully to the CV error because it is just the inverted measure.
It is included for easier comparability with the balanced accuracy). The
performance values can be retrieved from the model selection result object
with the accessor performance. The objective for selecting the
best performing paramters settings is by default the CV error. With the
parameter perfObjective in kbsvm one of the other
above mentioned performance parameters can be chosen as objective for the
best settings instead of the cross validation error.
Runtime Hints
When parameter showCVTimes in kbsvm is set to TRUE the
runtime for the individual cross validation runs is shown for each grid
point. In this way quick runtime estimates can be gathered through running
the grid search for a reduced grid and extrapolating the runtimes to the
full grid. Display of a progress indication in grid search is available
with the parameter showProgress in kbsvm.
Dependent on the number of sequences, the complexity of the kernel
processing, the type of chosen cross validation and the degree of variation
of parameters in grid search the runtime can grow drastically.
One possible strategy for reducing the runtime could be a stepwise
approach searching for areas with good performance in a first coarse grid
search run and then refining the areas of good performance with additional
more fine grained grid searches.
The implementation of the sequence kernels was done with a strong focus on
runtime performance which brings a considerable improvement compared to
other implementations. In KeBABS also an interface to the very fast SVM
implementations in package LiblineaR is available. Beyond these performance
improvements KeBABS also supports the generation of sparse explicit
representations for every sequence kernel which can be used instead of the
kernel matrix for learning. In many cases especially with a large number of
samples where the kernel matrix would become too large this alternative
provides additional dynamical benefits. The current implementation of grid
search does not make use of multi-core infrastructures, the entire
processing is done on a single core.
grid search stores the results in the KeBABS model. They can be
retrieved with the accessor modelSelResult{KBModel}.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
kbsvm,
spectrumKernel, mismatchKernel,
gappyPairKernel, motifKernel,
positionMetadata, annotationMetadata,
performModelSelection
## load transcription factor binding site data data(TFBS) enhancerFB ## The C-svc implementation from LiblineaR is chosen for most of the ## examples because it is the fastest SVM implementation. With SVMs from ## other packages slightly better results could be achievable. ## To get a realistic image of possible performance values, kernel behavior ## and speed of grid search together with 10-fold cross validation a ## resonable number of sequences is needed which would exceed the runtime ## restrictions for automatically executed examples. Therefore the grid ## search examples must be run manually. In these examples we use the full ## dataset for grid search. train <- sample(1:length(enhancerFB), length(enhancerFB)) ## grid search with single kernel object and multiple hyperparameter values ## create gappy pair kernel with normalization gappyK1M3 <- gappyPairKernel(k=1, m=3) ## show details of single gappy pair kernel object gappyK1M3 ## grid search for a single kernel object and multiple values for cost pkg <- "LiblineaR" svm <- "C-svc" cost <- c(0.01,0.1,1,10,100,1000) model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappyK1M3, pkg=pkg, svm=svm, cost=cost, explicit="yes", cross=3) ## show grid search results modelSelResult(model) ## Not run: ## create the list of spectrum kernel objects with normalization and ## kernel parameters values for k from 1 to 5 specK15 <- spectrumKernel(k=1:5) ## show details of the four spectrum kernel objects specK15 ## run grid search with several kernel parameter settings for the ## spectrum kernel with a single SVM parameter setting ## ATTENTION: DO NOT USE THIS VARIANT! ## This variant does not bring comparable performance for the different ## kernel parameter settings because usually the best performing ## hyperparameter values could be quite different for different kernel ## parameter settings or between different kernels, grid search for ## multiple kernel objects should be done as shown in the next example pkg <- "LiblineaR" svm <- "C-svc" cost <- 2 model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK15, pkg=pkg, svm=svm, cost=cost, explicit="yes", cross=10) ## show grid search results modelSelResult(model) ## grid search with multiple kernel objects and multiple values for ## hyperparameter cost pkg <- "LiblineaR" svm <- "C-svc" cost <- c(0.01,0.1,1,10,50,100,150,200,500,1000) model <- kbsvm(x=enhancerFB, sel=train, y=yFB[train], kernel=specK15, pkg=pkg, svm=svm, cost=cost, explicit="yes", cross=10, showProgress=TRUE) ## show grid search results modelSelResult(model) ## grid search for a single kernel object with multiple SVMs ## from different packages ## here with display of cross validation runtimes for each grid point ## pkg, svm and cost vectors must have same length and the corresponding ## entry in each of these vectors are one SVM + SVM hyperparameter setting pkg <- rep(c("kernlab", "e1071", "LiblineaR"),3) svm <- rep("C-svc", 9) cost <- rep(c(0.01,0.1,1),each=3) model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappyK1M3, pkg=pkg, svm=svm, cost=cost, explicit="yes", cross=3, showCVTimes=TRUE) ## show grid search results modelSelResult(model) ## run grid search for a single kernel with multiple SVMs from same package ## here all from LiblineaR: C-SVM, L2 regularized SVM with L2 loss and ## SVM with L1 regularization and L2 loss ## attention: for different formulation of the SMV objective use different ## values for the hyperparameters even if they have the same name pkg <- rep("LiblineaR", 9) svm <- rep(c("C-svc","l2rl2l-svc","l1rl2l-svc"), each=3) cost <- c(1,150,1000,1,40,100,1,40,100) model <- kbsvm(x=enhancerFB, sel=train, y=yFB[train], kernel=gappyK1M3, pkg=pkg, svm=svm, cost=cost, explicit="yes", cross=3) ## show grid search results modelSelResult(model) ## create the list of kernel objects for gappy pair kernel gappyK1M15 <- gappyPairKernel(k=1, m=1:5) ## show details of kernel objects gappyK1M15 ## run grid search with progress indication with ten kernels and ten ## hyperparameter values for cost and 10 fold cross validation on full ## dataset (500 samples) pkg <- rep("LiblineaR", 10) svm <- rep("C-svc", 10) cost <- c(0.0001,0.001,0.01,0.1,1,10,100,1000,10000,100000) model <- kbsvm(x=enhancerFB, y=yFB, kernel=c(specK15, gappyK1M15), pkg=pkg, svm=svm, cost=cost, cross=10, explicit="yes", showCVTimes=TRUE, showProgress=TRUE) ## show grid search results modelSelResult(model) ## End(Not run)## load transcription factor binding site data data(TFBS) enhancerFB ## The C-svc implementation from LiblineaR is chosen for most of the ## examples because it is the fastest SVM implementation. With SVMs from ## other packages slightly better results could be achievable. ## To get a realistic image of possible performance values, kernel behavior ## and speed of grid search together with 10-fold cross validation a ## resonable number of sequences is needed which would exceed the runtime ## restrictions for automatically executed examples. Therefore the grid ## search examples must be run manually. In these examples we use the full ## dataset for grid search. train <- sample(1:length(enhancerFB), length(enhancerFB)) ## grid search with single kernel object and multiple hyperparameter values ## create gappy pair kernel with normalization gappyK1M3 <- gappyPairKernel(k=1, m=3) ## show details of single gappy pair kernel object gappyK1M3 ## grid search for a single kernel object and multiple values for cost pkg <- "LiblineaR" svm <- "C-svc" cost <- c(0.01,0.1,1,10,100,1000) model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappyK1M3, pkg=pkg, svm=svm, cost=cost, explicit="yes", cross=3) ## show grid search results modelSelResult(model) ## Not run: ## create the list of spectrum kernel objects with normalization and ## kernel parameters values for k from 1 to 5 specK15 <- spectrumKernel(k=1:5) ## show details of the four spectrum kernel objects specK15 ## run grid search with several kernel parameter settings for the ## spectrum kernel with a single SVM parameter setting ## ATTENTION: DO NOT USE THIS VARIANT! ## This variant does not bring comparable performance for the different ## kernel parameter settings because usually the best performing ## hyperparameter values could be quite different for different kernel ## parameter settings or between different kernels, grid search for ## multiple kernel objects should be done as shown in the next example pkg <- "LiblineaR" svm <- "C-svc" cost <- 2 model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=specK15, pkg=pkg, svm=svm, cost=cost, explicit="yes", cross=10) ## show grid search results modelSelResult(model) ## grid search with multiple kernel objects and multiple values for ## hyperparameter cost pkg <- "LiblineaR" svm <- "C-svc" cost <- c(0.01,0.1,1,10,50,100,150,200,500,1000) model <- kbsvm(x=enhancerFB, sel=train, y=yFB[train], kernel=specK15, pkg=pkg, svm=svm, cost=cost, explicit="yes", cross=10, showProgress=TRUE) ## show grid search results modelSelResult(model) ## grid search for a single kernel object with multiple SVMs ## from different packages ## here with display of cross validation runtimes for each grid point ## pkg, svm and cost vectors must have same length and the corresponding ## entry in each of these vectors are one SVM + SVM hyperparameter setting pkg <- rep(c("kernlab", "e1071", "LiblineaR"),3) svm <- rep("C-svc", 9) cost <- rep(c(0.01,0.1,1),each=3) model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappyK1M3, pkg=pkg, svm=svm, cost=cost, explicit="yes", cross=3, showCVTimes=TRUE) ## show grid search results modelSelResult(model) ## run grid search for a single kernel with multiple SVMs from same package ## here all from LiblineaR: C-SVM, L2 regularized SVM with L2 loss and ## SVM with L1 regularization and L2 loss ## attention: for different formulation of the SMV objective use different ## values for the hyperparameters even if they have the same name pkg <- rep("LiblineaR", 9) svm <- rep(c("C-svc","l2rl2l-svc","l1rl2l-svc"), each=3) cost <- c(1,150,1000,1,40,100,1,40,100) model <- kbsvm(x=enhancerFB, sel=train, y=yFB[train], kernel=gappyK1M3, pkg=pkg, svm=svm, cost=cost, explicit="yes", cross=3) ## show grid search results modelSelResult(model) ## create the list of kernel objects for gappy pair kernel gappyK1M15 <- gappyPairKernel(k=1, m=1:5) ## show details of kernel objects gappyK1M15 ## run grid search with progress indication with ten kernels and ten ## hyperparameter values for cost and 10 fold cross validation on full ## dataset (500 samples) pkg <- rep("LiblineaR", 10) svm <- rep("C-svc", 10) cost <- c(0.0001,0.001,0.01,0.1,1,10,100,1000,10000,100000) model <- kbsvm(x=enhancerFB, y=yFB, kernel=c(specK15, gappyK1M15), pkg=pkg, svm=svm, cost=cost, cross=10, explicit="yes", showCVTimes=TRUE, showProgress=TRUE) ## show grid search results modelSelResult(model) ## End(Not run)
Perform model selection with one or multiple sequence kernels on one or multiple SVMs with one or multiple SVM parameter sets.
## kbsvm(...., kernel=..., pkg=..., svm=..., cost=..., ...., ## cross=0, noCross=1, ...., nestedCross=0, noNestedCross=1, ....) ## For details see below. With parameter nestedCross > 1 model selection is ## performed, the other parameters are handled identical to grid search.## kbsvm(...., kernel=..., pkg=..., svm=..., cost=..., ...., ## cross=0, noCross=1, ...., nestedCross=0, noNestedCross=1, ....) ## For details see below. With parameter nestedCross > 1 model selection is ## performed, the other parameters are handled identical to grid search.
nestedCross |
for this and other parameters see |
Overview
Model selection in KeBABS is based on nested k-fold cross validation (CV)
(for details see performCrossValidation). The inner cross
validation is used to determine the best parameters settings (kernel
parameters and SVM parameters) and the outer cross validation to verify
the performance on data that was not included in the selection of the
best model. The training folds of the outer CV are used to run a grid
search with the inner cross validation running for each point of the
grid (see performGridSearch to find the best performing model.
Once this model is selected the performance of this model on the held out
fold of the outer CV is determined. Different model parameters settings
could occur for different held out folds of the outer CV. This means that
model selection does not deliver a performance estimate for a single
best model but for the complete model selection process.
For each run of the outer CV KeBABS stores the selected parameter setting
for the best performing model. The default performance objective for
selecting the best parameters setting is based on minimizing the CV error
on the inner CV. With the parameter perfObjective in
kbsvm the balanced accuracy or the Matthews correlation
coefficient can be used instead for which the parameter setting with the
maximal value is selected. The parameter setting of the best performing
model for each fold in the outer CV can be retrieved from the KeBABS model
with the accessor modelSelResult. The performance values on
the outer CV are retrieved from the model with the accessor
cvResult.
Model selection is invoked through the method kbsvm through
setting parameter nestedCross > 1. For the parameters kernel,
pkg, svm and SVM hyperparameters the handling is identical to grid search
(see performGridSearch). The parameter cost in the usage
section above is just one representative of SVM hyperparameters to indicate
their relevance for model selection. The complete model selection process
can be repeated multiple times through setting noNestedCross to the
number of desired repetitions. Nested cross validation used in model
selection is dynamically more demanding than grid search. Concerning runtime
please see the runtime hints for performGridSearch.
model selection stores the results in the KeBABS model. They can be
retrieved with the accessor modelSelResult{KBModel}. Results
from the outer cross validation are extracted from the model with the
accessorcvResult.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
kbsvm, performGridSearch,
modelSelResult,
cvResult
## load transcription factor binding site data data(TFBS) enhancerFB ## The C-svc implementation from LiblineaR is chosen for most of the ## examples because it is the fastest SVM. With SVMs from other packages ## slightly better results could be achievable. Because of the higher ## runtime needed for nested cross validation please run the examples ## below manually. All samples of the data set are used in the examples. train <- sample(1:length(enhancerFB), length(enhancerFB)) ## model selection with single kernel object and multiple ## hyperparameter values, 5 fold inner CV and 3 fold outer CV ## create gappy pair kernel with normalization gappyK1M3 <- gappyPairKernel(k=1, m=3) ## show details of single gappy pair kernel object gappyK1M3 pkg <- "LiblineaR" svm <- "C-svc" cost <- c(50,100,150,200,250,300) model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappyK1M3, pkg=pkg, svm=svm, cost=cost, explicit="yes", cross=3, nestedCross=2, showProgress=TRUE) ## show best parameter settings modelSelResult(model) ## show model selection result which is the result of the outer CV cvResult(model) ## Not run: ## repeated model selection pkg <- "LiblineaR" svm <- "C-svc" cost <- c(50,100,150,200,250,300) model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappyK1M3, pkg=pkg, svm=svm, cost=cost, explicit="yes", cross=10, nestedCross=3, noNestedCross=3, showProgress=TRUE) ## show best parameter settings modelSelResult(model) ## show model selection result which is the result of the outer CV cvResult(model) ## plot CV result plot(cvResult(model)) ## End(Not run)## load transcription factor binding site data data(TFBS) enhancerFB ## The C-svc implementation from LiblineaR is chosen for most of the ## examples because it is the fastest SVM. With SVMs from other packages ## slightly better results could be achievable. Because of the higher ## runtime needed for nested cross validation please run the examples ## below manually. All samples of the data set are used in the examples. train <- sample(1:length(enhancerFB), length(enhancerFB)) ## model selection with single kernel object and multiple ## hyperparameter values, 5 fold inner CV and 3 fold outer CV ## create gappy pair kernel with normalization gappyK1M3 <- gappyPairKernel(k=1, m=3) ## show details of single gappy pair kernel object gappyK1M3 pkg <- "LiblineaR" svm <- "C-svc" cost <- c(50,100,150,200,250,300) model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappyK1M3, pkg=pkg, svm=svm, cost=cost, explicit="yes", cross=3, nestedCross=2, showProgress=TRUE) ## show best parameter settings modelSelResult(model) ## show model selection result which is the result of the outer CV cvResult(model) ## Not run: ## repeated model selection pkg <- "LiblineaR" svm <- "C-svc" cost <- c(50,100,150,200,250,300) model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappyK1M3, pkg=pkg, svm=svm, cost=cost, explicit="yes", cross=10, nestedCross=3, noNestedCross=3, showProgress=TRUE) ## show best parameter settings modelSelResult(model) ## show model selection result which is the result of the outer CV cvResult(model) ## plot CV result plot(cvResult(model)) ## End(Not run)
Functions for visualizing prediction profiles, cross validation result, grid search performance parameters and receiver operating characteristics
## S4 method for signature 'PredictionProfile,missing' plot(x, sel = NULL, col = c("red", "blue"), standardize = TRUE, shades = NULL, legend = "default", legendPos = "topright", ylim = NULL, xlab = "", ylab = "weight", lwd.profile = 1, lwd.axis = 1, las = 1, heptads = FALSE, annotate = FALSE, markOffset = TRUE, windowSize = 1, ...) ## S4 method for signature 'CrossValidationResult,missing' plot(x, col = "springgreen") ## S4 method for signature 'ModelSelectionResult,missing' plot(x, sel = c("ACC", "BACC", "MCC", "AUC")) ## S4 method for signature 'ROCData,missing' plot(x, lwd = 2, aucDigits = 3, cex = 0.8, side = 1, line = -3, adj = 0.9, ...)## S4 method for signature 'PredictionProfile,missing' plot(x, sel = NULL, col = c("red", "blue"), standardize = TRUE, shades = NULL, legend = "default", legendPos = "topright", ylim = NULL, xlab = "", ylab = "weight", lwd.profile = 1, lwd.axis = 1, las = 1, heptads = FALSE, annotate = FALSE, markOffset = TRUE, windowSize = 1, ...) ## S4 method for signature 'CrossValidationResult,missing' plot(x, col = "springgreen") ## S4 method for signature 'ModelSelectionResult,missing' plot(x, sel = c("ACC", "BACC", "MCC", "AUC")) ## S4 method for signature 'ROCData,missing' plot(x, lwd = 2, aucDigits = 3, cex = 0.8, side = 1, line = -3, adj = 0.9, ...)
x |
for the first method above a prediction profile object of class
|
sel |
an integer vector with one or two entries to select samples of the prediction profile matrix for plotting, if this parameter is not supplied by the user the frist one or two samples are selected. |
col |
a character vector with one or two color names used for plotting the samples. Default=c("red", "blue"). |
standardize |
logical. If |
shades |
vector of at least two color specifications; If not NULL,
the background area above and below the base line |
legend |
a character vector with one or two character strings containing the legend/description of the profile. If set to an empty vector or to NULL, no legend is displayed. |
legendPos |
position specification for the legend(if |
ylim |
argument that allows the user to preset the y-range of the profile plot. |
xlab |
label of horizontal axis, empty by default. |
ylab |
label of vertical axis, defaults to "weight". |
lwd.profile |
profile line width as described for parameter |
lwd.axis |
axis line width as described for parameter |
las |
see |
heptads |
logical indicating whether for proteins with heptad annotation (i.e. characters a to g, usually in periodic repetition) the heptad structure should be indicated through vertical lightgray lines each heptad. Default=FALSE |
annotate |
logical indicating whether annotation information should be shown in the center of the plot; Default=FALSE |
markOffset |
logical indicating whether the start positions in the
sequences according to the assigned offset elmement metadata values should
be shown near the sequence characters; for the upper sequence the first
position is marked by |
windowSize |
length of sliding window. When the parameter is set to
the default value 1 the contributions of each position are plotted
as step function. For kernels with multiple patterns at one position
(mismatch, gappy pair and motif kernel) the weight contributions of all
patterns at the position are summed up. Values larger than 1 define the
length of a sliding window. All contributions within the window are
averaged and the resulting value is displayed at the center position of
the window. For positions within half of the window size from the start
and end of the sequence the averaging cannot be performed over the full
window but just the remaining positions. This means that the variation
of the averaged weight contributions is higher in these border regions.
If an even value is specified for this parameter one is added to the
parameter value. When the parameter is set to |
... |
all other arguments are passed to the standard
|
lwd |
see |
aucDigits |
number of decimal places of AUC to be printed into the ROC plot. If this parameter is set to 0 the AUC will not be added to the plot. Default=3 |
cex |
see |
side |
see |
line |
see |
adj |
see |
Plotting of Prediction Profiles
The first variant of the plot method mentioned in the usage section
displays one or two prediction profiles as a step
function with the steps connected by vertical lines. The parameter
sel allows to select the sample(s) if the prediction profile object
contains the profiles of more than two samples. The alignment of the
step functions is impacted by offset metadata assigned to the sequences.
When offset values are assigned one sequence if shifted horizontally to
align the start position 1 pointed to by the offset value for each sequence.
(see also parameter markOffset). If no offset metadata is available
for the sequences both step functions start at their first position on the
left side of the plot. The vertical plot range can be determined by the
rng argument. If the plot is generated for one profile, the sequence
is is visualized above the plot, for two sequences the first sequence is
shown above, the second sequence below the plot. Matching characters at a
position are shown in the same color (by default in "black", the
non-matching characters in the sample-specific colors (see parameter
col). Annotation information can also be visualized along with the
step function. A call with two prediction profiles should facilitate the
comparison of profiles (e.g. wild type versus mutated sequence).
The baseline for the step function of a single sample represents the offset b of the model distributed equally to all sequence positions according to the following reformulation of the discriminant function
For standardized plots (see parameter standardize this baseline value
is subtracted from the weight contribution at each position. When sequences
of different length are plotted together only a standardized plot gives
compareable y ranges for both step functions. For sequences of equal length
the visualization can be done in non-standardized or standardized form
showing the lightgray horizontal baseline at positon or at
. If the area between the step function and the baseline lying
above the baseline is larger than the area below the baseline the sample
is predicted as belonging to the class assciated with positive values
of the discrimination function, otherwise to the opposite class. (For
multiclass problems prediction profiles can only be generated from the
feature weights related to one of the classifiers in the pairwise or
one-against-rest approaches leaving only two classes for the profile
plot.)
When plotting to a pdf it is recommended to use a height to width ratio
of around 1:(max sequence length/25), e.g. for a maximum sequence length
of 500 bases or amino acids select height=10 and width=200 when opening the
pdf document for plotting.
Plotting of CrossValidation Result
The second variant of plot method shown in the usage section
displays the cross validation result as boxplot.
Plotting of Grid Performance Values
The third variant of plot method shown in the usage section
plots grid performance data as grid with the color of each rectange
corresponding to the preformance value of the grid point.
Plotting of Receiver Operating Characteristics (ROC)
The fourth variant of plot method shown in the usage section
plots the receiver operating characteristics for the given ROC data.
see details above
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
getPredictionProfile,
positionDependentKernel, mcols,
spectrumKernel, mismatchKernel,
gappyPairKernel, motifKernel
## set seed for random generator, included here only to make results ## reproducable for this example set.seed(456) ## load transcription factor binding site data data(TFBS) enhancerFB ## select 70% of the samples for training and the rest for test train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) test <- c(1:length(enhancerFB))[-train] ## create the kernel object for gappy pair kernel with normalization gappy <- gappyPairKernel(k=1, m=3) ## show details of kernel object gappy ## run training with explicit representation model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="LiblineaR", svm="C-svc", cost=80, explicit="yes", featureWeights="yes") ## compute and plot ROC for test sequences preddec <- predict(model, enhancerFB[test], predictionType="decision") rocdata <- computeROCandAUC(preddec, yFB[test], allLabels=unique(yFB)) plot(rocdata) ## generate prediction profile for the first three test sequences predProf <- getPredictionProfile(enhancerFB, gappy, featureWeights(model), modelOffset(model), sel=test[1:3]) ## show prediction profiles predProf ## plot prediction profile to pdf ## As sequences are usually very long select a ratio of height to width ## for the pdf which takes care of the maximum sequence length which is ## plotted. Only single or pairs of prediction profiles can be plotted. ## Plot profile for window size 1 (default) and 50. Load package Biobase ## for openPDF ## Not run: library(Biobase) pdf(file="PredictionProfile1_w1.pdf", height=10, width=200) plot(predProf, sel=c(1,3)) dev.off() openPDF("PredictionProfile1_w1.pdf") pdf(file="PredictionProfile1_w50.pdf", height=10, width=200) plot(predProf, sel=c(1,3), windowSize=50) dev.off() openPDF("PredictionProfile1_w50.pdf") pdf(file="PredictionProfile2_w1.pdf", height=10, width=200) plot(predProf, sel=c(2,3)) dev.off() openPDF("PredictionProfile2_w1.pdf") pdf(file="PredictionProfile2_w50.pdf", height=10, width=200) plot(predProf, sel=c(2,3), windowSize=50) dev.off() openPDF("PredictionProfile2_w50.pdf") ## End(Not run)## set seed for random generator, included here only to make results ## reproducable for this example set.seed(456) ## load transcription factor binding site data data(TFBS) enhancerFB ## select 70% of the samples for training and the rest for test train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) test <- c(1:length(enhancerFB))[-train] ## create the kernel object for gappy pair kernel with normalization gappy <- gappyPairKernel(k=1, m=3) ## show details of kernel object gappy ## run training with explicit representation model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="LiblineaR", svm="C-svc", cost=80, explicit="yes", featureWeights="yes") ## compute and plot ROC for test sequences preddec <- predict(model, enhancerFB[test], predictionType="decision") rocdata <- computeROCandAUC(preddec, yFB[test], allLabels=unique(yFB)) plot(rocdata) ## generate prediction profile for the first three test sequences predProf <- getPredictionProfile(enhancerFB, gappy, featureWeights(model), modelOffset(model), sel=test[1:3]) ## show prediction profiles predProf ## plot prediction profile to pdf ## As sequences are usually very long select a ratio of height to width ## for the pdf which takes care of the maximum sequence length which is ## plotted. Only single or pairs of prediction profiles can be plotted. ## Plot profile for window size 1 (default) and 50. Load package Biobase ## for openPDF ## Not run: library(Biobase) pdf(file="PredictionProfile1_w1.pdf", height=10, width=200) plot(predProf, sel=c(1,3)) dev.off() openPDF("PredictionProfile1_w1.pdf") pdf(file="PredictionProfile1_w50.pdf", height=10, width=200) plot(predProf, sel=c(1,3), windowSize=50) dev.off() openPDF("PredictionProfile1_w50.pdf") pdf(file="PredictionProfile2_w1.pdf", height=10, width=200) plot(predProf, sel=c(2,3)) dev.off() openPDF("PredictionProfile2_w1.pdf") pdf(file="PredictionProfile2_w50.pdf", height=10, width=200) plot(predProf, sel=c(2,3), windowSize=50) dev.off() openPDF("PredictionProfile2_w50.pdf") ## End(Not run)
predict response values for new biological sequences from a
model trained with kbsvm
## S4 method for signature 'KBModel' predict(object, x, predictionType = "response", sel = NULL, raw = FALSE, native = FALSE, predProfiles = FALSE, verbose = getOption("verbose"), ...)## S4 method for signature 'KBModel' predict(object, x, predictionType = "response", sel = NULL, raw = FALSE, native = FALSE, predProfiles = FALSE, verbose = getOption("verbose"), ...)
object |
|
x |
multiple biological sequences in the form of a
|
predictionType |
one character string of either "response",
"probabilities" or "decision" which indicates the type of data returned by
prediction: predicted response, class probabilities or decision values. Class
probabilities can only be computed if a probability model was generated
during the training (for details see parameter |
sel |
subset of indices into |
raw |
when setting this boolean parameter to TRUE the prediction result is returned in raw form, i.e. in the SVM specific format. Default=FALSE |
native |
when setting this boolean parameter to TRUE the prediction is not preformed via feature weights in the KeBABS model but native in the SVM. Default=FALSE |
predProfiles |
when this boolean parameter is set to TRUE the
prediction profiles are computed for the samples passed to |
verbose |
boolean value that indicates whether KeBABS should print additional messages showing the internal processing logic in a verbose manner. The default value depends on the R session verbosity option. Default=getOption("verbose") |
... |
additional parameters which are passed to SVM prediction transparently. |
Prediction for KeBABS models
For the samples passed to the predict method the response (which
corresponds to the predicted label in case of classification or the predicted
target value in case of regression), the decision value (which is the value
of decision function separating the classes in classification) or the
class probability (probability for class membership in classification) is
computed for the given model of class KBModel. (see
also parameter predictionType). For sequence data this includes the
generation of an explicit representation or kernel matrix dependent on the
processing variant that was chosen for the training of the model. When
feature weights were computed during training (see parameter
featureWeights in kbsvm) the response is computed
entirely in KeBABS via the feature weights in the model object. The
prediction performance can be evaluated with the function
evaluatePrediction.
If feature weights are not available in the model then native prediction
is performed via the SVM which was used for training. The parameter
native enforces native prediction even when feature weights are
available. Instead of sequence data also a precomputed kernel matrix or a
precomputed explicit representation can be passed to predict.
Prediction via feature weights is not supported for kernel variants which
do not support the generation of an explicit representation, e.g. the
position dependent kernel variants.
Prediction with precomputed kernel matrix
When training was performed with a precomputed kernel matrix also in
prediction a precomputed kernel matrix must be passed to the predict
method. In contrast to the quadratic and symmetric kernel matrix used
in training the kernel matrix for prediction is rectangular and contains
the similarities of test samples (rows) against support vectors (columns).
support vector indices can be read from the model with the accessor SVindex.
Please not that these indices refer to the sample subset used in training.
An example for training and prediction via precomputed kernel matrix is
shown below.
Generation of prediction profiles
The parameter predProfiles controls whether prediction profiles
(for details see getPredictionProfile) are generated during
the prediction process for all predicted samples. They show the contribution
of the individual sequence positions to the response value. For a subset of
sequences prediction profiles can also be computed independent from
predicition via the function getPredictionProfile.
predict.kbsvm: upon successful completion, dependent on the parameter
predictionType the function returns either response values,
decision values or probability values for class membership. When prediction
profiles are also generated a list containing predictions and prediction
profiles is passed back to the user.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
KBModel, evaluatePrediction,
kbsvm, getPredictionProfile,
PredictionProfile
## load transcription factor binding site data data(TFBS) enhancerFB ## select 70% of the samples for training and the rest for test train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) test <- c(1:length(enhancerFB))[-train] ## create the kernel object for gappy pair kernel with normalization gappy <- gappyPairKernel(k=1, m=1) ## show details of kernel object gappy ## run training with explicit representation model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="LiblineaR", svm="C-svc", cost=10) ## show feature weights in KeBABS model featureWeights(model)[1:8] ## predict the test sequences pred <- predict(model, enhancerFB[test]) evaluatePrediction(pred, yFB[test], allLabels=unique(yFB)) pred[1:10] ## output decision values instead pred <- predict(model, enhancerFB[test], predictionType="decision") pred[1:10] ## Not run: ## example for training and prediction via precomputed kernel matrix ## compute quadratic kernel matrix of training samples kmtrain <- getKernelMatrix(gappy, x=enhancerFB, selx=train) ## train model with kernel matrix model <- kbsvm(x=kmtrain, y=yFB[train], kernel=gappy, pkg="e1071", svm="C-svc", cost=10) ## compute rectangular kernel matrix of test samples versus ## support vectors kmtest <- getKernelMatrix(gappy, x=enhancerFB, y=enhancerFB, selx=test, sely=train) ## predict with kernel matrix pred <- predict(model, kmtest) evaluatePrediction(pred, yFB[test], allLabels=unique(yFB)) ## example for probability model generation during training ## compute probability model via Platt scaling during training ## and predict class membership probabilities model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="e1071", svm="C-svc", cost=10, probModel=TRUE) ## show parameters of the fitted probability model which are the parameters ## probA and probB for the fitted sigmoid function in case of classification ## and the value sigma of the fitted Laplacian in case of a regression probabilityModel(model) ## predict class probabilities prob <- predict(model, enhancerFB[test], predictionType="probabilities") prob[1:10] ## End(Not run)## load transcription factor binding site data data(TFBS) enhancerFB ## select 70% of the samples for training and the rest for test train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) test <- c(1:length(enhancerFB))[-train] ## create the kernel object for gappy pair kernel with normalization gappy <- gappyPairKernel(k=1, m=1) ## show details of kernel object gappy ## run training with explicit representation model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="LiblineaR", svm="C-svc", cost=10) ## show feature weights in KeBABS model featureWeights(model)[1:8] ## predict the test sequences pred <- predict(model, enhancerFB[test]) evaluatePrediction(pred, yFB[test], allLabels=unique(yFB)) pred[1:10] ## output decision values instead pred <- predict(model, enhancerFB[test], predictionType="decision") pred[1:10] ## Not run: ## example for training and prediction via precomputed kernel matrix ## compute quadratic kernel matrix of training samples kmtrain <- getKernelMatrix(gappy, x=enhancerFB, selx=train) ## train model with kernel matrix model <- kbsvm(x=kmtrain, y=yFB[train], kernel=gappy, pkg="e1071", svm="C-svc", cost=10) ## compute rectangular kernel matrix of test samples versus ## support vectors kmtest <- getKernelMatrix(gappy, x=enhancerFB, y=enhancerFB, selx=test, sely=train) ## predict with kernel matrix pred <- predict(model, kmtest) evaluatePrediction(pred, yFB[test], allLabels=unique(yFB)) ## example for probability model generation during training ## compute probability model via Platt scaling during training ## and predict class membership probabilities model <- kbsvm(x=enhancerFB[train], y=yFB[train], kernel=gappy, pkg="e1071", svm="C-svc", cost=10, probModel=TRUE) ## show parameters of the fitted probability model which are the parameters ## probA and probB for the fitted sigmoid function in case of classification ## and the value sigma of the fitted Laplacian in case of a regression probabilityModel(model) ## predict class probabilities prob <- predict(model, enhancerFB[test], predictionType="probabilities") prob[1:10] ## End(Not run)
Prediction Profile Class
This class stores prediction profiles generated for a set of biological sequences from a trained model. Prediction profiles show the relevance of individual sequence positions for the prediction result.
sequencessequence information for the samples with profiles
baselinesbaselines generated from the offset in the model spread
to all sequence positions
profilesprediction profile information stored as dense matrix with
the rows as samples and the columns as positions in the sample
kernelkernel used for training the model on which these prediction
profiles are based
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
PredictionProfile Accessors
## S4 method for signature 'PredictionProfile' sequences(object)## S4 method for signature 'PredictionProfile' sequences(object)
object |
a prediction profile object |
sequences: sequences for which profiles were generatedprofiles: prediction profilesbaselines: baselines for the plot, this is the model offset
distributed to all sequence positions
In the descriptions below, object and x are objects of class
PredictionProfile.
sequences(object)returns the sequences.
profiles(object)return the prediction profiles.
baselines(object)return the baselines.
x[i]return a PredictionProfile object that only contains the
prediction profiles selected with the subsetting parameter i. This
parameter can be a numeric vector with indices or a character vector with
sample names.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## create kernel object for gappy pair kernel gappy <- gappyPairKernel(k=1,m=11, annSpec=TRUE) ## Not run: ## load data data(CCoil) ## perform training - feature weights are computed by default model <- kbsvm(ccseq, yCC, gappya, pkg="LiblineaR", svm="C-svc", cost=15) ## compute prediction profiles predProf <- getPredictionProfile(ccseq, gappya, featureWeights(model), modelOffset(model)) predProf15 <- predProf[c(1,5),] sequences(predProf15) profiles(predProf15) baselines(predProf15) ## End(Not run)## create kernel object for gappy pair kernel gappy <- gappyPairKernel(k=1,m=11, annSpec=TRUE) ## Not run: ## load data data(CCoil) ## perform training - feature weights are computed by default model <- kbsvm(ccseq, yCC, gappya, pkg="LiblineaR", svm="C-svc", cost=15) ## compute prediction profiles predProf <- getPredictionProfile(ccseq, gappya, featureWeights(model), modelOffset(model)) predProf15 <- predProf[c(1,5),] sequences(predProf15) profiles(predProf15) baselines(predProf15) ## End(Not run)
Functions for SVM access (used only for testing purpose)
predictSVM.KernelMatrix(x, model, predictionType, verbose, ...) ## S4 method for signature 'missing' predictSVM(x, model, predictionType, verbose, ...) ## S4 method for signature 'ExplicitRepresentation' predictSVM(x, model, predictionType, verbose, ...) ## S4 method for signature 'KernelMatrix' trainSVM(x, y = NULL, svmInfo, verbose, ...) ## S4 method for signature 'ExplicitRepresentation' trainSVM(x, y = NULL, svmInfo, verbose, ...)predictSVM.KernelMatrix(x, model, predictionType, verbose, ...) ## S4 method for signature 'missing' predictSVM(x, model, predictionType, verbose, ...) ## S4 method for signature 'ExplicitRepresentation' predictSVM(x, model, predictionType, verbose, ...) ## S4 method for signature 'KernelMatrix' trainSVM(x, y = NULL, svmInfo, verbose, ...) ## S4 method for signature 'ExplicitRepresentation' trainSVM(x, y = NULL, svmInfo, verbose, ...)
x |
kernel matrix or explicit representation |
model |
KeBABS model |
predictionType |
type of prediction |
verbose |
controlling verbosity |
... |
additional arguments to be passed to the selected SVM |
y |
label vector |
svmInfo |
SVM related info |
These methods are exported only for test purpose and are not meant to be generally used.
trainSVM: returns the SVM specific modelpredictSVM: returns the prediction in native format
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## this function is exported only for testing purpose ## use function kbsvm instead for examples see help page of kbsvm data(TFBS)## this function is exported only for testing purpose ## use function kbsvm instead for examples see help page of kbsvm data(TFBS)
ROC Data Class
This class stores receiver operating characteristics (ROC) data.
AUCarea under ROC curve
TPRtrue positive rate for varying threshold
FPRfalse positive rate for varying threshold
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
ROCData Accessors
## S4 method for signature 'ROCData' auc(object)## S4 method for signature 'ROCData' auc(object)
object |
an object of class |
auc: returns a numeric valuetpr: returns a numeric vectorfpr: returns a numeric vector
In the descriptions below, object is an object of class
ROCData.
auc(object)returns the area under the ROC curve.
tpr(object)returns the true positive rate values as numeric vector.
fpr(object)returns the false positive rate values as numeric vector.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## create kernel object for normalized spectrum kernel specK5 <- spectrumKernel(k=5) ## Not run: ## load data data(TFBS) ## select 70% of the samples for training and the rest for test train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) test <- c(1:length(enhancerFB))[-train] ## perform training - feature weights are computed by default model <- kbsvm(enhancerFB[train], yFB[train], specK5, pkg="LiblineaR", svm="C-svc", cost=15) preddec <- predict(model, enhancerFB[test], predictionType="decision") rocdata <- computeROCandAUC(preddec, yFB[test], allLabels=unique(yFB)) ## accessor for auc auc(rocdata) ## End(Not run)## create kernel object for normalized spectrum kernel specK5 <- spectrumKernel(k=5) ## Not run: ## load data data(TFBS) ## select 70% of the samples for training and the rest for test train <- sample(1:length(enhancerFB), length(enhancerFB) * 0.7) test <- c(1:length(enhancerFB))[-train] ## perform training - feature weights are computed by default model <- kbsvm(enhancerFB[train], yFB[train], specK5, pkg="LiblineaR", svm="C-svc", cost=15) preddec <- predict(model, enhancerFB[test], predictionType="decision") rocdata <- computeROCandAUC(preddec, yFB[test], allLabels=unique(yFB)) ## accessor for auc auc(rocdata) ## End(Not run)
Create the kernel matrix for a kernel object
Retrieve kernel parameters from the kernel object
seqKernelAsChar(from) getKernelMatrix(kernel, x, y, selx, sely) ## S4 method for signature 'SpectrumKernel' kernelParameters(object) ## S4 method for signature 'MismatchKernel' kernelParameters(object) ## S4 method for signature 'GappyPairKernel' kernelParameters(object) ## S4 method for signature 'MotifKernel' kernelParameters(object) ## S4 method for signature 'SymmetricPairKernel' kernelParameters(object) ## S4 method for signature 'SequenceKernel' isUserDefined(object)seqKernelAsChar(from) getKernelMatrix(kernel, x, y, selx, sely) ## S4 method for signature 'SpectrumKernel' kernelParameters(object) ## S4 method for signature 'MismatchKernel' kernelParameters(object) ## S4 method for signature 'GappyPairKernel' kernelParameters(object) ## S4 method for signature 'MotifKernel' kernelParameters(object) ## S4 method for signature 'SymmetricPairKernel' kernelParameters(object) ## S4 method for signature 'SequenceKernel' isUserDefined(object)
from |
a sequence kernel object |
kernel |
one kernel object of class |
x |
one or multiple biological sequences in the form of a
|
y |
one or multiple biological sequences in the form of a
|
selx |
subset of indices into |
sely |
subset of indices into |
object |
a sequence kernel object |
Sequence Kernel
A sequence kernel is used for determination of similarity values between
biological sequences based on patterns occuring in the sequences. The
kernels in this package were specifically written for the biological domain.
The corresponding term in the kernlab package is string kernel which is a
domain independent implementation of the same functionality which often
used in other domains, for example in text classification. For the
sequence kernels in this package DNA-, RNA- or AA-acid sequences are used
as input with a reduced character set compared to regular text.
In string kernels the actual position of a pattern in the sequence/text is
irrelevant just the number of occurances of the pattern is important for
the similarity consideration. The kernels provided in this package can be
created in a position-independent or position-dependent way. Position
dependent kernels are using the postion of patterns on the pair of sequences
to determine the contribution of a pattern match to the similarity value.
For details see help page for positionMetadata. As second
method of specializing similarity consideration in a kernel is to use
annotation information which is placed along the sequences. For details see
annotationMetadata.
Following kernels are available:
spectrum kernel
mismatch kernel
gappy pair kernel
motif kernel
These kernels are provided in a position-independent variant. For all
kernels except the mismatch also the position-dependent and the
annotation-specific variants of the kernel are supported. In addition
the spectrum and gappy pair kernel can be created as mixture kernels with
the weighted degree kernel and shifted weighted degree kernel being two
specific examples of such mixture kernels. The functions described below
apply for any kind of kernel in this package.
Retrieving kernel paramters from the kernel object
The function 'kernelParameters' retrieves the kernel parameters and returns
them as list. The function 'seqKernelAsChar' converts a sequnce kernel
object into a character string.
Generation of kernel matrix
The function getKernelMatrix creates a kernel matrix for the
specified kernel and one or two given sets of sequences. It contains
similarity values between pairs of samples. If one set of sequences is used
the square kernel matrix contains pairwise similarity values for this set.
For two sets of sequences the similarities are calculated between these sets
resulting in a rectangular kernel matrix. The kernel matrix is always
created as dense matrix of the class KernelMatrix.
Alternatively the kernel matrix can also be generated via a direct function
call with the kernel object. (see examples below)
Generation of explicit representation
With the function getExRep an explicit representation for
a specified kernel and a given set of sequences can be generated in sparse
or dense form. Applying the linear kernel to the explicit representation
with the function linearKernel also generates a dense kernel
matrix.
getKernelMatrix: upon successful completion, the function returns a kernel
matrix of class KernelMatrix which contains similarity
values between pairs of the biological sequences.
kernelParameters: the kernel parameters as list
isUserDefined: boolean indicating whether kernel is user-defined or not
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
as.KernelMatrix, KernelMatrix,
spectrumKernel, mismatchKernel,
gappyPairKernel, motifKernel
## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created ## RNA- or AA-sequences can be used as well with the motif kernel dnaseqs <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC")) names(dnaseqs) <- paste("S", 1:length(dnaseqs), sep="") ## create the kernel object with the spectrum kernel spec <- spectrumKernel(k=3, normalized=FALSE) ## generate the kernel matrix km <- getKernelMatrix(spec, dnaseqs) dim(km) km[1:5,1:5] ## alternative way to generate the kernel matrix km <- spec(dnaseqs) km[1:5,1:5] ## generate rectangular kernel matrix km <- getKernelMatrix(spec, x=dnaseqs, selx=1:3, y=dnaseqs, sely=4:5) dim(km) km[1:3,1:2] ## generate a sparse explicit representation er <- getExRep(dnaseqs, spec) er[1:5, 1:8] ## generate kernel matrix from explicit representation km <- linearKernel(er) km[1:5,1:5]## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created ## RNA- or AA-sequences can be used as well with the motif kernel dnaseqs <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC")) names(dnaseqs) <- paste("S", 1:length(dnaseqs), sep="") ## create the kernel object with the spectrum kernel spec <- spectrumKernel(k=3, normalized=FALSE) ## generate the kernel matrix km <- getKernelMatrix(spec, dnaseqs) dim(km) km[1:5,1:5] ## alternative way to generate the kernel matrix km <- spec(dnaseqs) km[1:5,1:5] ## generate rectangular kernel matrix km <- getKernelMatrix(spec, x=dnaseqs, selx=1:3, y=dnaseqs, sely=4:5) dim(km) km[1:3,1:2] ## generate a sparse explicit representation er <- getExRep(dnaseqs, spec) er[1:5, 1:8] ## generate kernel matrix from explicit representation km <- linearKernel(er) km[1:5,1:5]
Sequence Kernel Class
This class represents the parent class for all sequence kernels. It is an abstract class and must not be instantiated.
.Datathe kernel function is stored in this slot. It is executed when the kernel matrix is created through invoking the kernel object.
.userDefKernelindicates whether kernel is user defined or not.
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
Display methods for BioVector, SpectrumKernel, MismatchKernel, GappyPairKernel, MotifKernel, SymmetricPairKernel, ExplicitRepresentationDense, ExplicitRepresentationSparse, PredictionProfile, CrossValidationResult, ModelSelectionResult, SVMInformation and KBModel objects
show.BioVector(object) ## S4 method for signature 'PredictionProfile' show(object) ## S4 method for signature 'SpectrumKernel' show(object) ## S4 method for signature 'MismatchKernel' show(object) ## S4 method for signature 'MotifKernel' show(object) ## S4 method for signature 'GappyPairKernel' show(object) ## S4 method for signature 'SymmetricPairKernel' show(object) ## S4 method for signature 'ExplicitRepresentationDense' show(object) ## S4 method for signature 'ExplicitRepresentationSparse' show(object) ## S4 method for signature 'CrossValidationResult' show(object) ## S4 method for signature 'ModelSelectionResult' show(object) ## S4 method for signature 'SVMInformation' show(object) ## S4 method for signature 'KBModel' show(object) ## S4 method for signature 'ROCData' show(object)show.BioVector(object) ## S4 method for signature 'PredictionProfile' show(object) ## S4 method for signature 'SpectrumKernel' show(object) ## S4 method for signature 'MismatchKernel' show(object) ## S4 method for signature 'MotifKernel' show(object) ## S4 method for signature 'GappyPairKernel' show(object) ## S4 method for signature 'SymmetricPairKernel' show(object) ## S4 method for signature 'ExplicitRepresentationDense' show(object) ## S4 method for signature 'ExplicitRepresentationSparse' show(object) ## S4 method for signature 'CrossValidationResult' show(object) ## S4 method for signature 'ModelSelectionResult' show(object) ## S4 method for signature 'SVMInformation' show(object) ## S4 method for signature 'KBModel' show(object) ## S4 method for signature 'ROCData' show(object)
object |
object of class BioVector, PredictionProfile, SpectrumKernel, MismatchKernel, GappyPairKernel, MotifKernel, SymmetricPairKernel, ExplicitRepresentation, ExplicitRepresentationSparse, PredictionProfile, CrossValidationResult, ModelSelectionResult, SVMInformation or KBModel to be displayed |
show displays on overview of the selected object.
show: show returns an invisible NULL
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
## load coiled coil data data(CCoil) ## show amino acid sequences ccseq ## define spectrum kernel object specK1 <- spectrumKernel(k=1, normalized=FALSE) ## show kernel object show(specK1) ## compute explicit representation for the first 5 sequences ## in dense format er <- getExRep(ccseq, specK1, sel=1:5, sparse=FALSE) ## show dense explicit representation show(er)## load coiled coil data data(CCoil) ## show amino acid sequences ccseq ## define spectrum kernel object specK1 <- spectrumKernel(k=1, normalized=FALSE) ## show kernel object show(specK1) ## compute explicit representation for the first 5 sequences ## in dense format er <- getExRep(ccseq, specK1, sel=1:5, sparse=FALSE) ## show dense explicit representation show(er)
Assign annotation metadata to sequences and create a kernel
object which evaluates annotation information
Show biological sequence together with annotation
showAnnotatedSeq(x, sel = 1, ann = TRUE, pos = TRUE, start = 1, end = width(x)[sel], width = NA) ## S4 method for signature 'XStringSet' ## annotationMetadata(x, annCharset= ...) <- value ## S4 method for signature 'BioVector' ## annotationMetadata(x, annCharset= ...) <- value ## S4 replacement method for signature 'BioVector' annotationMetadata(x, ...) <- value ## S4 method for signature 'XStringSet' annotationMetadata(x) ## S4 method for signature 'BioVector' annotationMetadata(x) ## S4 method for signature 'XStringSet' annotationCharset(x) ## S4 method for signature 'BioVector' annotationCharset(x)showAnnotatedSeq(x, sel = 1, ann = TRUE, pos = TRUE, start = 1, end = width(x)[sel], width = NA) ## S4 method for signature 'XStringSet' ## annotationMetadata(x, annCharset= ...) <- value ## S4 method for signature 'BioVector' ## annotationMetadata(x, annCharset= ...) <- value ## S4 replacement method for signature 'BioVector' annotationMetadata(x, ...) <- value ## S4 method for signature 'XStringSet' annotationMetadata(x) ## S4 method for signature 'BioVector' annotationMetadata(x) ## S4 method for signature 'XStringSet' annotationCharset(x) ## S4 method for signature 'BioVector' annotationCharset(x)
x |
biological sequences in the form of a
|
sel |
single index into x for displaying a specific sequence. Default=1 |
ann |
show annotation information along with the sequence |
pos |
show position information |
start |
first postion to be displayed, by default the full sequence is shown |
end |
last position to be displayed or use parameter 'width' |
width |
number of positions to be displayed or use parameter 'end' |
... |
additional parameters which are passed transparently. |
value |
character vector with annotation strings with same length as the number of sequences. Each anntation string must have the same number of characters as the corresponding sequence. In addition to the characters defined in the annotation character set the character "-" can be used in the annotation strings for masking sequence parts. |
annCharset |
character string listing all characters used in annotation sorted ascending according to the C locale, up to 32 characters are possible |
Annotation information for sequences
For the annotation specific kernel additional annotation information is
added to the sequence data. The annotation for one sequence consist of a
character string with a single annotation character per position, i.e.
the annotation sequence has the same length as the sequence. The character
set used for annotation is defined user specific on XStringSet level
with up to 32 different characters. Each biological sequence needs
an associated annotation sequence assigned consisting of characters from
this character set. The evaluation of annotation information as part of
the kernel processing during generation of a kernel matrix or an explict
representation can be activated per kernel object.
Assignment of annotation information
The annotation characterset consists of a character string listing all
allowed annotation characters in alphabetical order. Any single byte ASCII
character from the decimal range between 32 and 126, except 45, is allowed.
The character '-' (ASCII dec. 45) is used for masking sequence parts which
should not be evaluated. As it has assigned this special masking function
it must not be used in annotation charactersets.
The annotation characterset is assigned to the sequence set with the
annotationMetadata function (see below). It is stored in the
metadata list as named element annotationCharset and can be stored
along with other metadata assigned to the sequence set. The annotation
strings for the individual sequences are represented as a character vector
and can be assigned to the XStringSet together with the assignment of the
annotation characterset as element related metadata. Element related
metadata is stored in a DataFrame and the columns of this data frame
represent the different types of metadata that can be assigned in parallel.
The column name for the sequence related annotation information is
"annotation". (see Example section for an example of annotation metadata
assignment) Annotation metadata can be assigned together with position
metadata (see positionMetadata to a sequence set.
Annotation Specific Kernel Processing
The annotation specific kernel variant of a kernel, e.g. the spectrum kernel
appends the annotation characters corresponding to a specific kmer to this
kmer and treats the resulting pattern as one feature - the basic unit for
similarity determination. The full feature space of an annotation specific
spectrum kernel is the cartesian product of the set of all possible sequence
patterns with the set of all possible anntotions patterns. Dependent on the
number of characters in the annotation character set the feature space
increases drastically compared to the normal spectrum kernel. But through
annotation the similarity consideration between two sequences can be split
into independent parts considered separately, e.g. coding/non-coding,
exon/intron, etc... . For amino acid sequences e.g. a heptad annotation
(consisting of a usually periodic pattern of 7 characters (a to g) can be
used as annotation like in prediction of coiled coil structures. (see
reference Mahrenholz, 2011)
The flag annSpec passed during creation of a kernel object controls
whether annotation information is evaluated by the kernel. (see functions
spectrumKernel, gappyPairKernel, motifKernel)
In this way sequences with annotation can be evaluated annotation specific
and without annotation through using two different kernel objects. (see
examples below) The annotation specific kernel variant is available for all
kernels in this package except for the mismatch kernel.
annotationMetadata function
With this function annotation metadata can be assigned to sequences defined
as XStringSet (or BioVector). The sequence annotation strings are stored
as element related information and can be retrieved with the method
mcols. The characters used for anntation are stored as
annotation characterset for the sequence set and can be retrieved
with the method metadata. For the assignment of annotation
metadata to biological sequences this function should be used instead of the
lower level functions metadata and mcols. The function
annotationMetadata performs several checks and also takes care
that other metadata or element metadata assigned to the object is kept.
Annotation metadata are deleted if the parameters annCharset and
annotation are set to NULL.
showAnnotatedSeq function
This function displays individual sequences aligned with the annotation
string with 50 positions per line. The two header lines show the start
postion for each bock of 10 characters.
Accessor-like methods
The method annotationMetadata<- assigns annotation metadata to a sequence
set. In the assignment also the annotation characterset must be specified.
Annotation characters which are not listed in the characterset are treated
like invalid sequence characters. They interrupt open patterns and lead
to a restart of the pattern search at this position.
annotationMetadata: a character vector with the annotation
strings
annotationCharset: a character vector with the annotation
Johannes Palme
https://github.com/UBod/kebabs
C.C. Mahrenholz, I.G. Abfalter, U. Bodenhofer, R. Volkmer and
S. Hochreiter (2011) Complex networks govern coiled coil
oligomerization - predicting and profiling by means of a machine
learning approach. Mol. Cell. Proteomics, 10(5):M110.004994
DOI: doi:10.1074/mcp.M110.004994.
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
spectrumKernel, gappyPairKernel,
motifKernel, positionMetadata,
metadata, mcols
## create a set of annotated DNA sequences ## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created x <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC")) names(x) <- paste("S", 1:length(x), sep="") ## define the character set used in annotation ## the masking character '-' is is not part of the character set anncs <- "ei" ## annotation strings for each sequence as character vector ## in the third and fourth sample a part of the sequence is masked annotStrings <- c("eeeeeeeeeeeeiiiiiiiiieeeeeeeeeeeeeeeeiiiiiiiiii", "eeeeeeeeeiiiiiiiiiiiiiiiiiiieeeeeeeeeeeeeeeeeee", "---------eeeeeeeeeeeeeeeeiiiiiiiiiiiiiiiiiiiiii", "eeeeeeeeeeeeeeeeeeeeeeeiiiiiiiiiiiiiiiiiiii----", "eeeeeeeeeeeeiiiiiiiiiiiiiiiiiiiiiiieeeeeeeeeeee") ## assign metadata to DNAString object annotationMetadata(x, annCharset=anncs) <- annotStrings ## show annotation annotationMetadata(x) annotationCharset(x) ## show sequence 3 aligned with annotation string showAnnotatedSeq(x, sel=3) ## create annotation specific spectrum kernel speca <- spectrumKernel(k=3, annSpec=TRUE, normalized=FALSE) ## show details of kernel object kernelParameters(speca) ## this kernel object can be now be used in a classification or regression ## task in the usual way or you can use the kernel for example to generate ## the kernel matrix for use with another learning method in another R ## package. kma <- speca(x) kma[1:5,1:5] ## generate a dense explicit representation for annotation-specific kernel era <- getExRep(x, speca, sparse=FALSE) era[1:5,1:8] ## when a standard spectrum kernel is used with annotated ## sequences the anntotation information is not evaluated spec <- spectrumKernel(k=3, normalized=FALSE) km <- spec(x) km[1:5,1:5] ## finally delete annotation metadata if no longer needed annotationMetadata(x) <- NULL ## show empty metadata annotationMetadata(x) annotationCharset(x)## create a set of annotated DNA sequences ## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created x <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC")) names(x) <- paste("S", 1:length(x), sep="") ## define the character set used in annotation ## the masking character '-' is is not part of the character set anncs <- "ei" ## annotation strings for each sequence as character vector ## in the third and fourth sample a part of the sequence is masked annotStrings <- c("eeeeeeeeeeeeiiiiiiiiieeeeeeeeeeeeeeeeiiiiiiiiii", "eeeeeeeeeiiiiiiiiiiiiiiiiiiieeeeeeeeeeeeeeeeeee", "---------eeeeeeeeeeeeeeeeiiiiiiiiiiiiiiiiiiiiii", "eeeeeeeeeeeeeeeeeeeeeeeiiiiiiiiiiiiiiiiiiii----", "eeeeeeeeeeeeiiiiiiiiiiiiiiiiiiiiiiieeeeeeeeeeee") ## assign metadata to DNAString object annotationMetadata(x, annCharset=anncs) <- annotStrings ## show annotation annotationMetadata(x) annotationCharset(x) ## show sequence 3 aligned with annotation string showAnnotatedSeq(x, sel=3) ## create annotation specific spectrum kernel speca <- spectrumKernel(k=3, annSpec=TRUE, normalized=FALSE) ## show details of kernel object kernelParameters(speca) ## this kernel object can be now be used in a classification or regression ## task in the usual way or you can use the kernel for example to generate ## the kernel matrix for use with another learning method in another R ## package. kma <- speca(x) kma[1:5,1:5] ## generate a dense explicit representation for annotation-specific kernel era <- getExRep(x, speca, sparse=FALSE) era[1:5,1:8] ## when a standard spectrum kernel is used with annotated ## sequences the anntotation information is not evaluated spec <- spectrumKernel(k=3, normalized=FALSE) km <- spec(x) km[1:5,1:5] ## finally delete annotation metadata if no longer needed annotationMetadata(x) <- NULL ## show empty metadata annotationMetadata(x) annotationCharset(x)
Create a spectrum kernel object
spectrumKernel(k = 3, r = 1, annSpec = FALSE, distWeight = numeric(0), normalized = TRUE, exact = TRUE, ignoreLower = TRUE, presence = FALSE, revComplement = FALSE, mixCoef = numeric(0)) ## S4 method for signature 'SpectrumKernel' getFeatureSpaceDimension(kernel, x)spectrumKernel(k = 3, r = 1, annSpec = FALSE, distWeight = numeric(0), normalized = TRUE, exact = TRUE, ignoreLower = TRUE, presence = FALSE, revComplement = FALSE, mixCoef = numeric(0)) ## S4 method for signature 'SpectrumKernel' getFeatureSpaceDimension(kernel, x)
k |
length of the substrings (also called kmers). This parameter defines the size of the feature space, i.e. the total number of features considered in this kernel is |A|^k, with |A| as the size of the alphabet (4 for DNA and RNA sequences and 21 for amino acid sequences). When multiple kernels with different k values should be generated e.g. for model selection a range e.g. k=3:5 can be specified. In this case a list of kernel objects with the individual k values from the range is generated as result. Default=3 |
r |
exponent which must be > 0 (details see below). Default=1 |
annSpec |
boolean that indicates whether sequence annotation should
be taken into account (details see on help page for
|
distWeight |
a numeric distance weight vector or a distance weighting
function (details see on help page for |
normalized |
a kernel matrix or explicit representation generated with this kernel will be normalized(details see below). Default=TRUE |
exact |
use exact character set for the evaluation (details see below). Default=TRUE |
ignoreLower |
ignore lower case characters in the sequence. If the parameter is not set lower case characters are treated like uppercase. Default=TRUE |
presence |
if this parameter is set only the presence of a kmers will be considered, otherwise the number of occurances of the kmer is used. Default=FALSE |
revComplement |
if this parameter is set a kmer and its reverse complement are treated as the same feature. Default=FALSE |
mixCoef |
mixing coefficients for the mixture variant of the spectrum kernel. A numeric vector of length k is expected for this parameter with the unused components in the mixture set to 0. Default=numeric(0) |
kernel |
a sequence kernel object |
x |
one or multiple biological sequences in the form of a
|
Creation of kernel object
The function 'spectrumKernel' creates a kernel object for the spectrum
kernel. This kernel object can then be used with a set of DNA-, RNA- or
AA-sequences to generate a kernel matrix or an explicit representation for
this kernel. The spectrum kernel uses all subsequences for length k (also
called kmers). For sequences shorter than k the self similarity (i.e. the
value on the main diagonal in the square kernel matrix) is 0. The explicit
representation contains only zeros for such a sample. Dependent on the
learning task it might make sense to remove such sequences from the data
set as they do not contribute to the model but still influence performance
values.
For values different from 1 (=default value) parameter r
leads to a transfomation of similarities by taking each element of the
similarity matrix to the power of r. Only integer values larger than 1
should be used for r in context with SVMs requiring positive definite
kernels. If normalized=TRUE, the feature vectors are scaled to the
unit sphere before computing the similarity value for the kernel matrix.
For two samples with the feature vectors x and y the
similarity is computed as:
For an explicit representation generated with the feature map of a
normalized kernel the rows are normalized by dividing them through their
Euclidean norm. For parameter exact=TRUE the sequence characters
are interpreted according to an exact character set. If the flag is not
set ambigous characters from the IUPAC characterset are also evaluated.
For sequences shorter than k the self similarity (i.e. the value on the
main diagonal in the square kernel matrix) is 0.
The annotation specific variant (for details see
annotationMetadata) and the position dependent variants (for
details see positionMetadata) either in the form of a position
specific or a distance weighted kernel are supported for the spectrum
kernel. The generation of an explicit representation is not possible for
the position dependent variants of this kernel.
Creation of kernel matrix
The kernel matrix is created with the function getKernelMatrix
or via a direct call with the kernel object as shown in the examples below.
spectrumKernel: upon successful completion, the function returns a kernel
object of class SpectrumKernel.
of getDimFeatureSpace: dimension of the feature space as numeric value
Johannes Palme
https://github.com/UBod/kebabs
C.S. Leslie, E. Eskin and W.S. Noble (2002) The spectrum kernel:
a string kernel for SVM protein classification.
Proc. Pacific Symposium on Biocomputing, pp. 566-575.
U. Bodenhofer, K. Schwarzbauer, M. Ionescu, and
S. Hochreiter (2009)
Modelling position specificity in sequence kernels by fuzzy
equivalence relations. Proc. Joint 13th IFSA World Congress and 6th
EUSFLAT Conference, pp. 1376-1381, Lisbon.
C.C. Mahrenholz, I.G. Abfalter, U. Bodenhofer, R. Volkmer and
S. Hochreiter (2011) Complex networks govern coiled coil
oligomerization - predicting and profiling by means of a machine
learning approach. Mol. Cell. Proteomics, 10(5):M110.004994.
DOI: doi:10.1074/mcp.M110.004994.
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
kernelParameters-method,
getKernelMatrix, getExRep,
mismatchKernel, motifKernel,
gappyPairKernel, SpectrumKernel
## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created ## RNA- or AA-sequences can be used as well with the spectrum kernel dnaseqs <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC")) names(dnaseqs) <- paste("S", 1:length(dnaseqs), sep="") ## create the kernel object for dimers without normalization speck <- spectrumKernel(k=2, normalized=FALSE) ## show details of kernel object speck ## generate the kernel matrix with the kernel object km <- speck(dnaseqs) dim(km) km[1:5,1:5] ## alternative way to generate the kernel matrix km <- getKernelMatrix(speck, dnaseqs) km[1:5,1:5] ## Not run: ## plot heatmap of the kernel matrix heatmap(km, symm=TRUE) ## End(Not run)## instead of user provided sequences in XStringSet format ## for this example a set of DNA sequences is created ## RNA- or AA-sequences can be used as well with the spectrum kernel dnaseqs <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC", "CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC", "GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC", "ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC")) names(dnaseqs) <- paste("S", 1:length(dnaseqs), sep="") ## create the kernel object for dimers without normalization speck <- spectrumKernel(k=2, normalized=FALSE) ## show details of kernel object speck ## generate the kernel matrix with the kernel object km <- speck(dnaseqs) dim(km) km[1:5,1:5] ## alternative way to generate the kernel matrix km <- getKernelMatrix(speck, dnaseqs) km[1:5,1:5] ## Not run: ## plot heatmap of the kernel matrix heatmap(km, symm=TRUE) ## End(Not run)
Spectrum Kernel Class
Instances of this class represent a kernel object for the spectrum kernel. The class is derived from SequenceKernel.
klength of the substrings considered by the kernel
rexponent (for details see spectrumKernel)
annSpecwhen set the kernel evaluates annotation information
distWeightdistance weighting function or vector
normalizeddata generated with this kernel object is normalized
exactuse exact character set for evaluation
ignoreLowerignore lower case characters in the sequence
presenceconsider only the presence of kmers not their counts
revComplementconsider a kmer and its reverse complement as the same feature
mixCoefmixing coefficients for mixture kernel
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
SVM Information Class
Instances of this class store SVM related information.
availPackagesinstalled SVM packages
reqSVMuser requested SVM implementation
reqPackageuser requested package
reqSVMParuser requested SVM parameters
reqKerneluser requested kernel
reqExplicituser requested indictor of expl. rep. processing
reqExplicitTypeuser requested expl. rep. type
reqFeatureTypeuser requested feature type
selSVMselected SVM implementation
selPackageselected package
selSVMParselected SVM parameters
selKernelselected kernel
selExplicitselected indictor of expl. rep. processing
explicitKernelkernel for explicit representation
featureWeightsindicator for feature weights
weightLimitcutoff value for feature weights
probModelindicator for probability model
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
Create a symmetric pair kernel object
symmetricPairKernel(siKernel, kernelType = c("mean", "TPPK"), r = 1)symmetricPairKernel(siKernel, kernelType = c("mean", "TPPK"), r = 1)
siKernel |
kernel for single instances |
kernelType |
defines the type of pair kernel. It specifies in which way the similarity between two pairs of sequences are computed. Allowed values are "mean", and "TPPK" (see also details section). Default="mean" |
r |
exponent which must be > 0 (details see below). Default=1 |
Creation of kernel object
The function 'symmetricPairKernel' creates a kernel object for the symmetric
pair kernel. This kernel is an example for multiple instance learning and
can be used for learning based on pairs of sequences. The single instance
kernel passed to the symmetric pair kernel computes a similarity between
two individual sequences giving a similarity for one pair of sequences.
The symmetric pair kernel function gets as input two pairs of sequences and
computes a similarity value between the two pairs. This similarity is
computed dependent on the value of the argument kernelType from the
similarities delivered by the single instance kernel in the following
way:
mean (arithmetic mean):
k(<a,b>, <c,d>) = 1/4 * (k(a,c) + k(a,d) + k(b,c) + k(b,d))
TPKK (tensor pairwise product kernel):
k(<a,b>, <c,d>) = (k(a,c) * k(b,d) + k(a,d) * k(b,c))
Every sequence kernel available in KeBABS can be used as single instance kernel for the symmetric pair kernel allowing to create similarity measures between two pairs of sequences based on different similarity measures between individual sequences.
The row names and column names of a kernel matrix generated from a symmetric pair kernel object describe the sequence pair with the names of the individual sequences in the pair separated by the underscore character.
For values different from 1 (=default value) parameter r
leads to a transfomation of similarities by taking each element of the
similarity matrix to the power of r. Only integer values larger than 1
should be used for r in context with SVMs requiring positive definite
kernels.
The symmetricPairKernel can be used in sequence based learning like any single instance kernel. Label values are defined against pairs of sequences in this case. Explicit representation, feature weights and prediction profiles are not available for the symmetric pair kernel. As kernels computed through sums and products of postive definite kernels all variants of this kernel are positive definite.
symmetricPairKernel: upon successful completion, the function returns a
kernel object of class SymmetricPairKernel.
Johannes Palme
https://github.com/UBod/kebabs
M. Hue and J.-P.Vert (2010) On learning with kernels for unordered
pairs. Proc. 27th Int. Conf. on Machine Learning, pp. 463-470.
A. Ben-Hur and W.S. Noble (2005) Kernel methods for predicting
protein-protein interactions.
T. Gaertner, P.A. Flach, A. Kowalczyk, and A.J. Smola (2002)
Multi-instance kernels. Proc. 19th Int. Conf. on Machine Learning,
pp. 179-186.
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.
kernelParameters-method,
getKernelMatrix, spectrumKernel,
mismatchKernel, motifKernel,
gappyPairKernel, SymmetricPairKernel
## load sample sequences from transcription factor binding dataset data(TFBS) ## in this example we just use the first 30 sequences and rename samples x <- enhancerFB[1:30] names(x) <- paste("S", 1:length(x), sep="") ## create the single instance kernel object specK5 <- spectrumKernel(k=5) ## show details of single instance kernel object specK5 ## create the symmetric pair kernel object for the single instance kernel tppk <- symmetricPairKernel(siKernel=specK5, kernelType="TPPK") ## generate the kernel matrix with the symmetric pair kernel object which ## contains similarity values between two pairs of sequences. ## Hint: The kernel matrix for the single instance kernel is computed ## internally. km <- tppk(x) dim(km) km[1:5,1:5] ## Not run: ## plot heatmap of the kernel matrix heatmap(km, symm=TRUE) ## End(Not run)## load sample sequences from transcription factor binding dataset data(TFBS) ## in this example we just use the first 30 sequences and rename samples x <- enhancerFB[1:30] names(x) <- paste("S", 1:length(x), sep="") ## create the single instance kernel object specK5 <- spectrumKernel(k=5) ## show details of single instance kernel object specK5 ## create the symmetric pair kernel object for the single instance kernel tppk <- symmetricPairKernel(siKernel=specK5, kernelType="TPPK") ## generate the kernel matrix with the symmetric pair kernel object which ## contains similarity values between two pairs of sequences. ## Hint: The kernel matrix for the single instance kernel is computed ## internally. km <- tppk(x) dim(km) km[1:5,1:5] ## Not run: ## plot heatmap of the kernel matrix heatmap(km, symm=TRUE) ## End(Not run)
Symmetric Pair Kernel Class
Instances of this class represent a kernel object for the symmetric pair kernel. The kernel does not compute similarity between single samples but between two pairs of samples based on a regular sequence kernel for single samples. The class is derived from SequenceKernel.
siKernelsingle instance kernel
kernelTypetype of pair kernel
rexponent (for details see gappyPairKernel)
Johannes Palme
https://github.com/UBod/kebabs
J. Palme, S. Hochreiter, and U. Bodenhofer (2015) KeBABS: an R package
for kernel-based analysis of biological sequences.
Bioinformatics, 31(15):2574-2576.
DOI: doi:10.1093/bioinformatics/btv176.