Package 'mutscan'

Title: Preprocessing and Analysis of Deep Mutational Scanning Data
Description: Provides functionality for processing and statistical analysis of multiplexed assays of variant effect (MAVE) and similar data. The package contains functions covering the full workflow from raw FASTQ files to publication-ready visualizations. A broad range of library designs can be processed with a single, unified interface.
Authors: Charlotte Soneson [aut, cre] (ORCID: <https://orcid.org/0000-0003-3833-2169>), Michael Stadler [aut] (ORCID: <https://orcid.org/0000-0002-2269-4934>), Friedrich Miescher Institute for Biomedical Research [cph]
Maintainer: Charlotte Soneson <[email protected]>
License: MIT + file LICENSE
Version: 1.2.0
Built: 2026-05-29 07:35:47 UTC
Source: https://github.com/bioc/mutscan

Help Index


Calculate distances to the nearest string

Description

Given a character vector, calculate the distance for each element to the nearest neighbor amongst all the other elements.

Usage

calcNearestStringDist(x, metric = "hamming", nThreads = 1L)

Arguments

x

A character vector.

metric

A character scalar defining the string distance metric. One of "hamming" (default), "hamming_shift" or "levenshtein".

nThreads

numeric(1), number of threads to use for parallel processing.

Value

An integer vector of the same length as x.

Examples

calcNearestStringDist(c("lazy", "hazy", "crazy"))
calcNearestStringDist(c("lazy", "hazy", "crazy"), metric = "hamming_shift")
calcNearestStringDist(c("lazy", "hazy", "crazy"), metric = "levenshtein")

Calculate fitness scores.

Description

Using sequence counts before and after selection, calculate fitness scores as described by Diss and Lehner (2018).

Usage

calculateFitnessScore(
  se,
  pairingCol,
  ODCols,
  comparison,
  WTrows,
  selAssay = "counts"
)

Arguments

se

SummarizedExperiment object as returned by summarizeExperiment.

pairingCol

Name of column in colData(se) with replicate/pairing information. Samples with the same value in this column will be paired.

ODCols

Name(s) of column(s) in colData(se) with OD values (numeric), used to normalize for different numbers of cells.

comparison

3-element character vector of the form (column, numerator, denominator). column is the name of the column in colData(se) with experimental conditions. numerator and denominator define the comparison, e.g. c("cond", "output", "input") will look in the "cond" column and calculate fitness for the ratio of "output" over "input" counts.

WTrows

Vector of row names that will be used as the reference when calculating fitness scores. If more than one value is provided, the average of the corresponding fitness scores is used as a reference. If NULL, no division by WT scores will be done.

selAssay

Assay to select from se for the analysis.

Value

A numeric vector with fitness scores.

Author(s)

Michael Stadler and Charlotte Soneson

References

"The genetic landscape of a physical interaction." Diss G and Lehner B. Elife. 2018;7:e32472. doi: 10.7554/eLife.32472.

Examples

se <- readRDS(system.file("extdata", "GSE102901_cis_se.rds", 
                          package = "mutscan"))
## Check that the wildtype sequence is present in the data
stopifnot("f.0.WT" %in% rownames(se))
## Calculate PPI scores as defined in Diss & Lehner (2018)
ppis <- calculateFitnessScore(
    se = se, pairingCol = "Replicate", 
    ODCols = c("OD1", "OD2"),
    comparison = c("Condition", "cis_output", "cis_input"),
    WTrows = "f.0.WT")
## Matrix with PPI scores for each replicate
head(ppis)

Calculate logFCs relative to WT using edgeR

Description

Calculate logFCs and associated p-values for a given comparison, using either limma or the Negative Binomial quasi-likelihood framework of edgeR. The observed counts for the WT variants can be used as offsets in the model.

Usage

calculateRelativeFC(
  se,
  design,
  coef = NULL,
  contrast = NULL,
  WTrows = NULL,
  selAssay = "counts",
  pseudocount = 1,
  method = "edgeR",
  normMethod = ifelse(is.null(WTrows), "TMM", "sum")
)

Arguments

se

SummarizedExperiment object.

design

Design matrix. The rows of the design matrix must be in the same order as the columns in se.

coef

Coefficient(s) to test with edgeR or limma.

contrast

Numeric contrast to test with edgeR or limma.

WTrows

Vector of row names that will be used as the reference when calculating logFCs and statistics. If more than one value is provided, the sum of the corresponding counts is used to generate offsets. If NULL, offsets will be defined as the effective library sizes (using TMM normalization factors).

selAssay

Assay to select from se for the analysis.

pseudocount

Pseudocount to add when calculating log-fold changes.

method

Either 'edgeR' or 'limma'. If set to 'limma', voom is used to transform the counts and estimate observation weights before applying limma. In this case, the results also contain the standard errors of the logFCs.

normMethod

Character scalar indicating which normalization method should be used to calculate size factors. Should be either "TMM" or "csaw" when WTrows is NULL, and "geomean" or "sum" when WTrows is provided.

Value

A data.frame with output from the statistical testing framework (edgeR or limma).

Author(s)

Charlotte Soneson, Michael Stadler

Examples

library(SummarizedExperiment)
se <- readRDS(system.file("extdata", "GSE102901_cis_se.rds",
                          package = "mutscan"))[1:200, ]
design <- model.matrix(~ Replicate + Condition,
                       data = colData(se))
                              
## Calculate "absolute" log-fold changes with edgeR
res <- calculateRelativeFC(se, design, coef = "Conditioncis_output", 
                           method = "edgeR")
head(res)
## Calculate log-fold changes relative to the WT sequence with edgeR
stopifnot("f.0.WT" %in% rownames(se))
res <- calculateRelativeFC(se, design, coef = "Conditioncis_output", 
                           method = "edgeR", WTrows = "f.0.WT")
head(res)

## Calculate "absolute" log-fold changes with limma
res <- calculateRelativeFC(se, design, coef = "Conditioncis_output", 
                           method = "limma")
head(res)
## Calculate log-fold changes relative to the WT sequence with limma
stopifnot("f.0.WT" %in% rownames(se))
res <- calculateRelativeFC(se, design, coef = "Conditioncis_output", 
                           method = "limma", WTrows = "f.0.WT")
head(res)

Collapse mutants by similarity

Description

These functions can be used to collapse variants, either by similarity or according to a pre-defined grouping. The functions collapseMutants and collapseMutantsByAA assume that a grouping variable is available as a column in rowData(se) (collapseMutantsByAA is a convenience function for the case when this column is "mutantNameAA", and is provided for backwards compatibility). The collapseMutantsBySimilarity will generate the grouping variable based on user-provided thresholds on the sequence similarity (defined by the Hamming distance), and subsequently collapse based on the derived grouping.

Usage

collapseMutantsBySimilarity(
  se,
  assayName,
  scoreMethod = "rowSum",
  sequenceCol = "sequence",
  collapseMaxDist = 0,
  collapseMinScore = 0,
  collapseMinRatio = 0,
  verbose = TRUE
)

collapseMutantsByAA(se)

collapseMutants(se, nameCol)

Arguments

se

A SummarizedExperiment generated by summarizeExperiment

assayName

The name of the assay that will be used to calculate a "score" (typically derived from the read counts) for each variant.

scoreMethod

Character scalar giving the approach used to calculate ranking scores from the assay defined by assayName. Currently, this can be one of "rowSum" or "rowMean". All filtering criteria will be applied to these scores.

sequenceCol

Character scalar giving the name of the column in rowData(se) that contains the nucleotide sequence of the variants.

collapseMaxDist

Numeric scalar defining the tolerance for collapsing similar sequences. If the value is in [0, 1), it defines the maximal Hamming distance in terms of a fraction of sequence length: (round(collapseMaxDist * nchar(sequence))). A value greater or equal to 1 is rounded and directly used as the maximum allowed Hamming distance. Note that sequences can only be collapsed if they are all of the same length.

collapseMinScore

Numeric scalar, indicating the minimum score for the sequence to be considered for collapsing with similar sequences.

collapseMinRatio

Numeric scalar. During collapsing of similar sequences, a low-frequency sequence will be collapsed with a higher-frequency sequence only if the ratio between the high-frequency and the low-frequency scores is at least this high. The default value of 0 indicates that no such check is performed.

verbose

Logical, whether to print progress messages.

nameCol

A character scalar providing the column of rowData(se) that contains the amino acid mutant names (that will be the new row names).

Value

A SummarizedExperiment where counts have been aggregated by the mutated amino acid(s).

Author(s)

Charlotte Soneson, Michael Stadler

Examples

library(SummarizedExperiment)
se <- readRDS(system.file("extdata", "GSE102901_cis_se.rds",
                          package = "mutscan"))[1:200, ]
## The rows of this object correspond to individual codon variants
dim(se)
head(rownames(se))

## Collapse by amino acid
sec <- collapseMutantsByAA(se)
## The rows of the collapsed object correspond to amino acid variants
dim(sec)
head(rownames(sec))
## The mutantName column contains the individual codon variants that were 
## collapsed
head(rowData(sec))

## Collapse similar sequences
sec2 <- collapseMutantsBySimilarity(
    se = se, assayName = "counts", scoreMethod = "rowSum",
    sequenceCol = "sequence", collapseMaxDist = 2,
    collapseMinScore = 0, collapseMinRatio = 0)
dim(sec2)
head(rownames(sec2))
head(rowData(sec2))
## collapsed count matrix
assay(sec2, "counts")

Read, filter and digest sequences from fastq file(s).

Description

Read sequences for one or a pair of fastq files and digest them (extract umis, constant and variable parts, filter, extract mismatch information from constant and count the observed unique variable parts). Alternatively, primer sequences could be specified, in which case the sequence immediately following the primer will be considered the variable sequence.

Usage

digestFastqs(
  fastqForward,
  fastqReverse = NULL,
  mergeForwardReverse = FALSE,
  minOverlap = 0,
  maxOverlap = 0,
  minMergedLength = 0,
  maxMergedLength = 0,
  maxFracMismatchOverlap = 1,
  greedyOverlap = TRUE,
  revComplForward = FALSE,
  revComplReverse = FALSE,
  adapterForward = "",
  adapterReverse = "",
  elementsForward = "",
  elementLengthsForward = numeric(0),
  elementsReverse = "",
  elementLengthsReverse = numeric(0),
  primerForward = c(""),
  primerReverse = c(""),
  wildTypeForward = "",
  wildTypeReverse = "",
  constantForward = c(""),
  constantReverse = c(""),
  avePhredMinForward = 20,
  avePhredMinReverse = 20,
  variableNMaxForward = 0,
  variableNMaxReverse = 0,
  umiNMax = 0,
  nbrMutatedCodonsMaxForward = 1,
  nbrMutatedCodonsMaxReverse = 1,
  nbrMutatedBasesMaxForward = -1,
  nbrMutatedBasesMaxReverse = -1,
  forbiddenMutatedCodonsForward = "",
  forbiddenMutatedCodonsReverse = "",
  useTreeWTmatch = FALSE,
  collapseToWTForward = FALSE,
  collapseToWTReverse = FALSE,
  mutatedPhredMinForward = 0,
  mutatedPhredMinReverse = 0,
  mutNameDelimiter = ".",
  constantMaxDistForward = -1,
  constantMaxDistReverse = -1,
  umiCollapseMaxDist = 0,
  filteredReadsFastqForward = "",
  filteredReadsFastqReverse = "",
  maxNReads = -1,
  verbose = FALSE,
  nThreads = 1,
  chunkSize = 1e+05,
  maxReadLength = 1024
)

Arguments

fastqForward, fastqReverse

Character vectors, paths to gzipped FASTQ files corresponding to forward and reverse reads, respectively. If more than one forward/reverse sequence file is given, they need to be provided in the same order. Note that if multiple fastq files are provided, they are all assumed to correspond to the same sample, and will effectively be concatenated.

mergeForwardReverse

Logical scalar, whether to fuse the forward and reverse variable sequences.

minOverlap, maxOverlap

Numeric scalar, the minimal and maximal allowed overlap between the forward and reverse reads when merging. Only used if mergeForwardReverse is TRUE. If set to 0, only overlaps covering the full length of the shortest of the two reads will be considered.

minMergedLength, maxMergedLength

Numeric scalar, the minimal and maximal allowed total length of the merged product (if mergeForwardReverse is TRUE). If set to 0, any length is allowed.

maxFracMismatchOverlap

Numeric scalar, maximal mismatch rate in the overlap. Only used if mergeForwardReverse is TRUE.

greedyOverlap

Logical scalar. If TRUE, the first overlap satisfying minOverlap, maxOverlap, minMergedLength, maxMergedLength and maxFracMismatchOverlap will be retained. If FALSE, all valid overlaps will be scored and the one with the highest score (largest number of matches) will be retained.

revComplForward, revComplReverse

Logical scalar, whether to reverse complement the forward/reverse variable and constant sequences, respectively.

adapterForward, adapterReverse

Character scalars, the adapter sequence for forward/reverse reads, respectively. If a forward/reverse read contains the corresponding adapter sequence, the sequence pair will be filtered out. If set to NULL, no adapter filtering is performed. The number of filtered read pairs are reported in the return value.

elementsForward, elementsReverse

Character scalars representing the composition of the forward and reverse reads, respectively. The strings should consist only of the letters S (skip), C (constant), U (umi), P (primer), V (variable), and cover the full extent of the read. Most combinations are allowed (and a given letter can appear multiple times), but there can be at most one occurrence of P. If a given letter is included multiple times, the corresponding sequences will be concatenated in the output.

elementLengthsForward, elementLengthsReverse

Numeric vectors containing the lengths of each read component from elementsForward/elementsReverse, respectively. If the length of one element is set to -1, it will be inferred from the other lengths (as the remainder of the read). At most one number (or one number on each side of the primer P) can be set to -1. The indicated length of the primer is not used (instead it's inferred from the provided primer sequence) and can also be set to -1.

primerForward, primerReverse

Character vectors, representing the primer sequence(s) for forward/reverse reads, respectively. Only read pairs that contain perfect matches to both the forward and reverse primers (if given) will be retained. Multiple primers can be specified - they will be considered in order and the first match will be used.

wildTypeForward, wildTypeReverse

Character scalars or named character vectors, the wild type sequence for the forward and reverse variable region. If given as a single string, the reference sequence will be named 'f' (for forward) or 'r' (for reverse).

constantForward, constantReverse

Character vectors giving, the expected constant forward and reverse sequences. If more than one sequence is provided, they must all have the same length.

avePhredMinForward, avePhredMinReverse

Numeric scalar, the minimum average Phred score in the variable region for a read to be retained. If a read pair contains both forward and reverse variable regions, the minimum average Phred score has to be achieved in both for a read pair to be retained.

variableNMaxForward, variableNMaxReverse

Numeric scalar, the maximum number of Ns allowed in the variable region for a read to be retained.

umiNMax

Numeric scalar, the maximum number of Ns allowed in the UMI for a read to be retained.

nbrMutatedCodonsMaxForward, nbrMutatedCodonsMaxReverse

Numeric scalar, the maximum number of mutated codons that are allowed. Note that for the forward and reverse sequence, respectively, exactly one of nbrMutatedCodonsMax and nbrMutatedBasesMax must be -1, and the other must be a non-negative number. The one that is not -1 will be used to filter and name the identified mutants.

nbrMutatedBasesMaxForward, nbrMutatedBasesMaxReverse

Numeric scalar, the maximum number of mutated bases that are allowed. Note that for the forward and reverse sequence, respectively, exactly one of nbrMutatedCodonsMax and nbrMutatedBasesMax must be -1, and the other must be a non-negative number. The one that is not -1 will be used to filter and name the identified mutants.

forbiddenMutatedCodonsForward, forbiddenMutatedCodonsReverse

Character vector of codons (can contain ambiguous IUPAC characters, see IUPAC_CODE_MAP). If a read pair contains a mutated codon matching this pattern, it will be filtered out.

useTreeWTmatch

Logical scalar. Should a tree-based matching to wild type sequences be used if possible? If the number of allowed mismatches is small, and the number of wild type sequences is large, this is typically faster.

collapseToWTForward, collapseToWTReverse

Logical scalar, indicating whether to just represent the observed variable sequence by the closest wildtype sequence rather than retaining the information about the mutations.

mutatedPhredMinForward, mutatedPhredMinReverse

Numeric scalar, the minimum Phred score of a mutated base for the read to be retained. If any mutated base has a Phred score lower than mutatedPhredMin, the read (pair) will be discarded.

mutNameDelimiter

Character scalar, the delimiter used in the naming of mutants. Generally, mutants will be named as XX{.}YY{.}NNN, where XX is the closest provided reference sequence, YY is the mutated base or codon number (depending on whether nbrMutatedBases* or nbrMutatedCodons* is specified), and NNN is the mutated base or codon. Here, {.} is the provided mutNameDelimiter. The delimiter must be a single character (not "_"), and can not appear in any of the provided reference sequence names.

constantMaxDistForward, constantMaxDistReverse

Numeric scalars, the maximum allowed Hamming distance between the extracted and expected constant sequence. If multiple constant sequences are provided, the most similar one is used. Reads with a larger distance to the expected constant sequence are discarded. If set to -1, no filtering is done.

umiCollapseMaxDist

Numeric scalar defining the tolerances for collapsing similar UMI sequences. If the value is in [0, 1), it defines the maximal Hamming distance in terms of a fraction of sequence length: (round(umiCollapseMaxDist * nchar(umiSeq))). A value greater or equal to 1 is rounded and directly used as the maximum allowed Hamming distance.

filteredReadsFastqForward, filteredReadsFastqReverse

Character scalars, the names of a (pair of) FASTQ file(s) where filtered-out reads will be written. The name(s) should end in .gz (the output will always be compressed). If empty, filtered reads will not be written to a file.

maxNReads

Integer scalar, the maximum number of reads to process. The first maxNReads read (pairs) in the FASTQ file(s) will be used. If set to -1, all reads in the FASTQ file(s) will be processed.

verbose

Logical scalar, whether to print out progress messages.

nThreads

Numeric scalar, the number of threads to use for parallel processing.

chunkSize

Numeric scalar, the number of read (pairs) to keep in memory for parallel processing. Reduce from the default value if you run out of memory.

maxReadLength

Numeric scalar, the maximum allowed read length. Longer read lengths lead to higher memory allocation, and may require the chunkSize to be decreased.

Details

The processing of a read pair goes as follows:

  1. Search for perfect matches to forward/reverse adapter sequences, filter out the read pair if a match is found in either the forward or reverse read.

  2. If primer sequences are provided, search for perfect matches, and filter out the read pair if not all provided primer sequences can be found.

  3. Extract the UMI, constant and variable sequence from forward and reverse reads, based on the definition of the respective read composition.

  4. If requested, collapse forward and reverse variable regions by retaining, for each position, the base with the highest reported base quality.

  5. Filter out the read (pair) if the average quality in the variable region is below avePhredMinForward/avePhredMinReverse, in either the forward or reverse read (or the merged read).

  6. Filter out the read (pair) if the number of Ns in the variable region exceeds variableNMaxForward/variableNMaxReverse.

  7. Filter out the read (pair) if the number of Ns in the combined forward and reverse UMI sequence exceeds umiNMax

  8. If one or more wild type sequences (for the variable region) are provided, find the mismatches between the (forward/reverse) variable region and the provided wild type sequence (if more than one wild type sequence is provided, first find the one that is closest to the read).

  9. Filter out the read (pair) if any mutated base has a quality below mutatedPhredMinForward/mutatedPhredMinReverse.

  10. Filter out the read (pair) if the number of mutated codons exceeds nbrMutatedCodonsMaxForward/nbrMutatedCodonsMaxReverse.

  11. Filter out the read (pair) if any of the mutated codons match any of the codons encoded by forbiddenMutatedCodonsForward/forbiddenMutatedCodonsReverse.

  12. Assign a 'mutation name' to the read (pair). This name is a combination of parts of the form XX{.}YY{.}NNN, where XX is the name of the most similar reference sequence, YY is the mutated codon number, and NNN is the mutated codon. {.} is a delimiter, specified via mutNameDelimiter. If no wildtype sequences are provided, the variable sequence will be used as the mutation name'.

Based on the retained reads following this filtering process, count the number of reads, and the number of unique UMIs, for each variable sequence (or pair of variable sequences).

Value

A list with four entries:

summaryTable

A data.frame that contains, for each observed mutation combination, the corresponding variable region sequences (or pair of sequences), the number of observed such sequences, and the number of unique UMIs observed for the sequence. It also has additional columns: 'maxNbrReads' contains the number of reads for the most frequent observed sequence represented by the feature (only relevant if similar variable regions are collapsed). 'nbrMutBases', 'nbrMutCodons' and 'nbrMutAAs' give the number of mutated bases, codons or amino acids in each variant. Alternative variant names based on base, codon or amino acid sequence are provided in columns mutantNameBase', 'mutantNameCodon', 'mutantNameAA'. In addition, mutantNameBaseHGVS' and 'mutantNameAAHGVS' give base- and amino acid-based names following the HGVS nomenclature (https://varnomen.hgvs.org/). Please note that the provided reference sequence names are used for the HGVS sequence identifiers. It is up to the user to use appropriately named reference sequences in order to obtain valid HGVS variant names.

filterSummary

A data.frame that contains the number of input reads, the number of reads filtered out in the processing, and the number of retained reads. The filters are named according to the convention "fxx_filter", where "xx" indicates the order in which the filters were applied, and "filter" indicates the type of filter. Note that filters are applied successively, and the reads filtered out in one step are not considered for successive filtering steps.

errorStatistics

A data.frame that contains, for each Phred quality score between 0 and 99, the number of bases in the extracted constant sequences with that quality score that match/mismatch with the provided reference constant sequence.

parameters

A list with all parameter settings that were used in the processing. Also contains the version of the package and the time of processing.

Examples

## See the vignette for complete worked-out examples for different types of 
## data sets

## ---------------------------------------------------------------------- ## 
## Process a single-end data set, assume that the full read represents  
## the variable region
out <- digestFastqs(
    fastqForward = system.file("extdata", "cisInput_1.fastq.gz", 
                               package = "mutscan"), 
    elementsForward = "V", elementLengthsForward = -1
)
## Table with read counts and mutant information
head(out$summaryTable)
## Filter summary
out$filterSummary

## ---------------------------------------------------------------------- ## 
## Process a single-end data set, specify the read as a combination of 
## UMI, constant region and variable region (skip the first base)
out <- digestFastqs(
    fastqForward = system.file("extdata", "cisInput_1.fastq.gz", 
                               package = "mutscan"), 
    elementsForward = "SUCV", elementLengthsForward = c(1, 10, 18, 96), 
    constantForward = "AACCGGAGGAGGGAGCTG"
)
## Table with read counts and mutant information
head(out$summaryTable)
## Filter summary
out$filterSummary
## Error statistics
out$errorStatistics

## ---------------------------------------------------------------------- ## 
## Process a single-end data set, specify the read as a combination of 
## UMI, constant region and variable region (skip the first base), provide 
## the wild type sequence to compare the variable region to and limit the 
## number of allowed mutated codons to 1
out <- digestFastqs(
    fastqForward = system.file("extdata", "cisInput_1.fastq.gz", 
                               package = "mutscan"), 
    elementsForward = "SUCV", elementLengthsForward = c(1, 10, 18, 96), 
    constantForward = "AACCGGAGGAGGGAGCTG", 
    wildTypeForward = c(FOS = paste0(
        "ACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTC", 
        "TGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTA")),
    nbrMutatedCodonsMaxForward = 1
)
## Table with read counts and mutant information
head(out$summaryTable)
## Filter summary
out$filterSummary
## Error statistics
out$errorStatistics

## ---------------------------------------------------------------------- ## 
## Process a paired-end data set where both the forward and reverse reads 
## contain the same variable region and thus should be merged to generate 
## the final variable sequence, specify the reads as a combination of 
## UMI, constant region and variable region (skip the first and/or last
## base), provide the wild type sequence to compare the variable region to 
## and limit the number of allowed mutated codons to 1
out <- digestFastqs(
    fastqForward = system.file("extdata", "cisInput_1.fastq.gz", 
                               package = "mutscan"),
    fastqReverse = system.file("extdata", "cisInput_2.fastq.gz",
                               package = "mutscan"), 
    mergeForwardReverse = TRUE, 
    revComplForward = FALSE, revComplReverse = TRUE, 
    elementsForward = "SUCV", elementLengthsForward = c(1, 10, 18, 96),
    elementsReverse = "SUCVS", elementLengthsReverse = c(1, 7, 17, 96, -1),
    constantForward = "AACCGGAGGAGGGAGCTG", 
    constantReverse = "GAGTTCATCCTGGCAGC",
    wildTypeForward = c(FOS = paste0(
        "ACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTC", 
        "TGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTA")),
    nbrMutatedCodonsMaxForward = 1
)
## Table with read counts and mutant information
head(out$summaryTable)
## Filter summary
out$filterSummary
## Error statistics
out$errorStatistics

## ---------------------------------------------------------------------- ## 
## Process a paired-end data set where the forward and reverse reads 
## contain variable regions corresponding to different proteins, and thus 
## should not be merged, specify the reads as a combination of 
## UMI, constant region and variable region (skip the first base), provide 
## the wild type sequence to compare the variable region to and limit the 
## number of allowed mutated codons to 1
out <- digestFastqs(
    fastqForward = system.file("extdata", "transInput_1.fastq.gz", 
                               package = "mutscan"),
    fastqReverse = system.file("extdata", "transInput_2.fastq.gz",
                               package = "mutscan"), 
    mergeForwardReverse = FALSE,  
    elementsForward = "SUCV", elementLengthsForward = c(1, 10, 18, 96),
    elementsReverse = "SUCV", elementLengthsReverse = c(1, 8, 20, 96),
    constantForward = "AACCGGAGGAGGGAGCTG", 
    constantReverse = "GAAAAAGGAAGCTGGAGAGA",
    wildTypeForward = c(FOS = paste0(
        "ACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTC", 
        "TGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTA")),
    wildTypeReverse = c(JUN = paste0(
        "ATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTC", 
        "GGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTT")), 
    nbrMutatedCodonsMaxForward = 1,
    nbrMutatedCodonsMaxReverse = 1
)
## Table with read counts and mutant information
head(out$summaryTable)
## Filter summary
out$filterSummary
## Error statistics
out$errorStatistics

Generate QC report

Description

Generate QC report

Usage

generateQCReport(
  se,
  outFile,
  reportTitle = "mutscan QC report",
  forceOverwrite = FALSE,
  ...
)

Arguments

se

A SummarizedExperiment object, typically generated with summarizeExperiment().

outFile

Character string providing the name of the output file. Should have the extension .html.

reportTitle

Character string specifying the title of the QC report.

forceOverwrite

Logical scalar, indicating whether an existing file with the same name as outFile should be overwritten.

...

Additional parameters to be forwarded to render, for example quiet = TRUE.

Value

Invisibly, the path to the generated html file.

Author(s)

Charlotte Soneson

See Also

render used to render the html output file.

Examples

## Load SummarizedExperiment object
se <- readRDS(system.file("extdata", "GSE102901_cis_se.rds",
                          package = "mutscan"))
## Define output file
outfile <- tempfile(fileext = ".html")

## Generate QC report
generateQCReport(se, outfile)

Create a conversion table for collapsing similar sequences

Description

Create a conversion table for collapsing similar sequences

Usage

groupSimilarSequences(
  seqs,
  scores,
  collapseMaxDist = 0,
  collapseMinScore = 0,
  collapseMinRatio = 0,
  verbose = FALSE
)

Arguments

seqs

Character vector with nucleotide sequences (or pairs of sequences concatenated with "_") to be collapsed. The sequences must all be of the same length.

scores

Numeric vector of "scores" for the sequences. Typically the total read/UMI count. A higher score will be preferred when deciding which sequence to use as the representative for a group of collapsed sequences.

collapseMaxDist

Numeric scalar defining the tolerance for collapsing similar sequences. If the value is in [0, 1), it defines the maximal Hamming distance in terms of a fraction of sequence length: (round(collapseMaxDist * nchar(sequence))). A value greater or equal to 1 is rounded and directly used as the maximum allowed Hamming distance. Note that sequences can only be collapsed if they are all of the same length. The default value is 0.

collapseMinScore

Numeric scalar, indicating the minimum score required for a sequence to be considered as a representative for a group of similar sequences (i.e., to allow other sequences to be collapsed into it). The default value is 0.

collapseMinRatio

Numeric scalar. During collapsing of similar sequences, a low-frequency sequence will be collapsed with a higher-frequency sequence only if the ratio between the high-frequency and the low-frequency scores is at least this high. A value of 0 indicates that no such check is performed.

verbose

Logical scalar, whether to print progress messages.

Value

A data.frame with two columns, containing the input sequences and the representatives for the groups resulting from grouping similar sequences, respectively.

Author(s)

Michael Stadler, Charlotte Soneson

Examples

seqs <- c("AACGTAGCA", "ACCGTAGCA", "AACGGAGCA", "ATCGGAGCA", "TGAGGCATA")
scores <- c(5, 1, 3, 1, 8)
groupSimilarSequences(seqs = seqs, scores = scores,
                      collapseMaxDist = 1, collapseMinScore = 0,
                      collapseMinRatio = 0, verbose = FALSE)

Process an experiment with multiple variable sequences

Description

This function enables the processing of data sets with multiple variable sequences, which should potentially be handled in different ways. For example, a barcode association experiment with two variable sequences (the barcode and the biological variant) that need to be processed differently, e.g. in terms of matching to wildtype sequences or collapsing of similar sequences. In contrast, while digestFastqs allow the specification of multiple variable sequences (within each of the forward and reverse reads), they will be concatenated and processed as a single unit.

Usage

linkMultipleVariants(combinedDigestParams = list(), ...)

Arguments

combinedDigestParams

A named list of arguments to digestFastqs for the combined ("naive") run.

...

Additional arguments providing arguments to digestFastqs for the separate runs (processing each variable sequence in turn). Each argument must be a named list of arguments to digestFastqs. In addition, arguments collapseMaxDist, collapseMinScore and collapseMinRatio can be specified, and will be passed on to collapseMutantsBySimilarity.

Details

linkMultipleVariants will process the input in the following way:

  • First, run digestFastqs with the parameters provided in combinedDigestParams. Typically, this will be a "naive" counting run, where the frequencies of all observed variants are tabulated. The variable sequences within the forward and reverse reads, respectively, will be processed as a single sequence.

  • Next, run digestFastqs with each of the additional parameter sets provided (...). Each of these should correspond to a single variable sequence from the combined run (i.e., if there are two Vs in the element specifications in the combined run, there should be two additional parameter sets provided, each corresponding to the processing of one variable sequence part). It is assumed that the order of the additional arguments correspond to the order of the variable sequences in the combined run, in such a way that if the variable sequences extracted in each of the separate runs are concatenated in the order that the parameter sets are provided to linkMultipleVariants, they will form the variable sequence extracted in the combined run.

  • The result of each of the separate runs is a 'conversion table', containing the final set of identified sequence variants as well as all individual sequences corresponding to each of them. This is then combined with the count table from the combined, "naive" run in order to create an aggregated count table. More precisely, each sequence in the combined run is split into the constituent variable sequences, and each variable sequence is then matched to the output from the right separate run, from which the final feature ID (mutant name, or collapsed sequence) will be extracted and used to replace the original sequence in the combined count table. Once all the matches are done, rows with NAs (where no match could be found in the separate run) are removed and the counts are aggregated across all identical combinations of variable sequences.

In order to define the elementsForward and elementsReverse arguments for the separate runs, a strategy that often works is to simply copy the arguments from the combined run, and successively replace all but one of the 'V's by 'S'. This will effectively process one variable sequence at the time, while keeping all other elements of the reads consistent (since this can affect e.g. filtering criteria). Note that to process individual variable sequences in the reverse read, you also need to swap the 'forward' and 'reverse' specifications (since digestFastqs requires a forward read).

Value

A list with the following elements:

  • countAggregated - a tibble with columns corresponding to each of the variable sequences, and a column with the total observed read count for the combination.

  • convSeparate - a list of conversion tables from the respective separate runs.

  • outCombined - the digestFastqs output for the combined run.

Author(s)

Charlotte Soneson, Michael Stadler

Examples

fqFile <- system.file("extdata", "cisInput_1.fastq.gz", 
                      package = "mutscan")
out <- linkMultipleVariants(
    combinedDigestParams = list(fastqForward = fqFile, 
                                elementsForward = "SVCV", 
                                elementLengthsForward = c(1, 10, 18, 96)),
    # the first variable sequence is the UMI
    umi = list(fastqForward = fqFile, elementsForward = "SVCS",
               elementLengthsForward = c(1, 10, 18, 96)),
    # the second variable sequence is the amplicon variant
    var = list(fastqForward = fqFile, elementsForward = "SSCV",
               elementLengthsForward = c(1, 10, 18, 96), 
               collapseMaxDist = 3, collapseMinScore = 1)
)
# conversion tables
lapply(out$convSeparate, head)
# aggregated count table
head(out$countAggregated)

Plot distribution of observed values

Description

Plot distribution of observed values

Usage

plotDistributions(
  se,
  selAssay = "counts",
  groupBy = NULL,
  plotType = "density",
  facet = FALSE,
  pseudocount = 0
)

Arguments

se

A SummarizedExperiment object, typically generated by summarizeExperiment().

selAssay

Character scalar specifying the assay in se to use for the plotting.

groupBy

Character scalar specifying a column from colData(se) to use for coloring or stratifying the plots.

plotType

Character scalar specifying the type of plot to construct. Either 'density', 'histogram' or 'knee'.

facet

Logical scalar, indicating whether or not to facet the plot by the values specified in the groupBy column.

pseudocount

Numeric scalar, representing the number to add to the observed values in the selAssay assay before plotting.

Value

A ggplot object.

Author(s)

Charlotte Soneson

Examples

se <- readRDS(system.file("extdata", "GSE102901_cis_se.rds", 
                          package = "mutscan"))[1:200, ]
plotDistributions(se)

Visualize the filtering procedure

Description

Display the number (or fraction) of reads remaining after each step of the internal mutscan filtering.

Usage

plotFiltering(
  se,
  valueType = "reads",
  onlyActiveFilters = TRUE,
  displayNumbers = TRUE,
  numberSize = 4,
  plotType = "remaining",
  facetBy = "sample"
)

Arguments

se

A SummarizedExperiment object, e.g. from summarizeExperiment.

valueType

Either "reads" or "fractions", indicating whether to plot the number of reads, or the fraction of the total number of reads, that are retained after/filtered out in each filtering step.

onlyActiveFilters

Logical scalar, whether to only include the active filters (i.e., where any read was filtered out in any of the samples). Defaults to TRUE.

displayNumbers

Logical scalar, indicating whether to display the number (or fraction) of reads retained at every filtering step.

numberSize

Numeric scalar, indicating the size of the displayed numbers (if displayNumbers is TRUE).

plotType

Character scalar, indicating what to show in the plot. Either "remaining" or "filtered".

facetBy

Character scalar, indicating the variable by which the plots should be facetted. Either "sample" or "step".

Details

The function assumes that the number of reads filtered out in each step are provided as columns of colData(se), with column names of the form f[0-9]_filteringreason, and that all filtering columns occur between the columns named nbrTotal and nbrRetained.

Value

A ggplot object.

Author(s)

Charlotte Soneson

Examples

se <- readRDS(system.file("extdata", "GSE102901_cis_se.rds", 
                          package = "mutscan"))[1:200, ]
plotFiltering(se)

Construct an MA (mean-difference) plot

Description

Construct an MA (mean-difference) plot

Usage

plotMeanDiff(
  res,
  meanCol = NULL,
  logFCCol = NULL,
  pvalCol = NULL,
  padjCol = NULL,
  padjThreshold = 0.05,
  pointSize = "small",
  interactivePlot = FALSE,
  nTopToLabel = 0
)

Arguments

res

data.frame (typically output from calculateRelativeFC()) with columns corresponding to the average abundance (logCPM or AveExpr), log-fold change (logFC) and significance (FDR or adj.P.Val).

meanCol, logFCCol, pvalCol, padjCol

Character scalars indicating the columns from res that will be used to represent the mean value (x-axis), logFC (y-axis), nominal p-value (used to find the top features to label) and adjusted p-value (used for coloring). If NULL (default), pre-specified values will be used depending on the available columns ("logCPM" or "AveExpr", "logFC", "PValue" or "P.Value", and "FDR" or "adj.P.Val", respectively).

padjThreshold

Numeric scalar indicating the adjusted p-value threshold to use for coloring the points. All features with adjusted p-value below the treshold will be shown in red.

pointSize

Either "small" or "large", indicating which of the two available plot styles that will be used.

interactivePlot

Logical scalar, indicating whether an interactive plot should be returned, in which one can hover over the individual points and obtain further information.

nTopToLabel

Numeric scalar, indicating the number of points that should be labeled in the plot. The points will be ranked by the pvalCol column, and the top nTopToLabel values will be labeled by the corresponding row names. Only used if interactivePlot is FALSE.

Value

If interactivePlot is TRUE, a plotly object. If interactivePlot is FALSE, a ggplot2 object.

Author(s)

Charlotte Soneson

Examples

library(SummarizedExperiment)
se <- readRDS(system.file("extdata", "GSE102901_cis_se.rds",
                          package = "mutscan"))[1:200, ]
design <- model.matrix(~ Replicate + Condition,
                       data = colData(se))
res <- calculateRelativeFC(se, design, coef = "Conditioncis_output")
plotMeanDiff(res, pointSize = "large", nTopToLabel = 3)

Make pairs plot of selected assay from a SummarizedExperiment object

Description

Construct a pairs plot of all columns of a given assay. The lower-triangular panels display the scatter plots, the upper-triangular ones print out the (Pearson or Spearman) correlations, and the diagonal panels show histograms of the respective columns.

Usage

plotPairs(
  se,
  selAssay = "counts",
  doLog = TRUE,
  pseudocount = 1,
  corMethod = "pearson",
  histBreaks = 40,
  pointsType = "points",
  corSizeMult = 5,
  corSizeAdd = 2,
  pointSize = 0.1,
  pointAlpha = 0.3,
  colorByCorrelation = TRUE,
  corrColorRange = NULL,
  addIdentityLine = FALSE
)

Arguments

se

A SummarizedExperiment object, e.g. the output of summarizeExperiment

selAssay

Character scalar, the assay to use as the basis for the pairs plot.

doLog

Logical scalar, whether or not to log-transform the values before plotting.

pseudocount

Numeric scalar, the pseudocount to add to the values before log-transforming (if doLog is TRUE).

corMethod

Either "pearson" or "spearman", the type of correlation to calculate.

histBreaks

Numeric scalar, the number of breaks in the histograms to put in the diagonal panels.

pointsType

Either "points", "smoothscatter", "scattermore" or "scattermost" (the latter two require the "scattermore" package to be installed), determining the type of plots that will be made.

corSizeMult, corSizeAdd

Numeric scalars determining how the absolute correlation value is transformed into a font size. The transformation is corSizeMult * abs(corr) + corSizeAdd.

pointSize, pointAlpha

Numeric scalars determining the size and opacity of points in the plot.

colorByCorrelation

Logical scalar, indicating whether the correlation panels should be colored according to the correlation value.

corrColorRange

Numeric vector of length 2, providing the lower and upper limits of the color scale when coloring by correlation. Both values should be positive; the same range is used for negative correlations. If NULL (the default), the range is inferred from the data.

addIdentityLine

Logical scalar, indicating whether the identity line should be added (only used if pointsType = "points").

Value

A ggplot object.

Author(s)

Charlotte Soneson

Examples

se <- readRDS(system.file("extdata", "GSE102901_cis_se.rds", 
                          package = "mutscan"))[1:200, ]
plotPairs(se)

Plot the column totals of a selected assay

Description

Plot the column totals of a selected assay

Usage

plotTotals(se, selAssay = "counts", groupBy = NULL)

Arguments

se

A SummarizedExperiment object, typically generated by summarizeExperiment().

selAssay

Character scalar specifying the assay in se to use for the plotting.

groupBy

Character scalar indicating a column in rowData(se) to group the features by before calculating the column sums.

Value

A ggplot object.

Author(s)

Charlotte Soneson

Examples

se <- readRDS(system.file("extdata", "GSE102901_cis_se.rds", 
                          package = "mutscan"))[1:200, ]
plotTotals(se)

Construct a volcano plot

Description

Construct a volcano plot

Usage

plotVolcano(
  res,
  logFCCol = NULL,
  pvalCol = NULL,
  padjCol = NULL,
  padjThreshold = 0.05,
  pointSize = "small",
  interactivePlot = FALSE,
  nTopToLabel = 0
)

Arguments

res

data.frame (typically output from calculateRelativeFC()) with columns corresponding to the log-fold change (logFC), p-value (PValue or P.Value) and significance (FDR or adj.P.Val).

logFCCol, pvalCol, padjCol

Character scalars indicating the columns from res that will be used to represent the logFC (x-axis), p-value (y-axis) and adjusted p-value (used for coloring). If NULL (default), pre-specified values will be used depending on the available columns ("logFC", "PValue" or "P.Value", and "FDR" or "adj.P.Val", respectively).

padjThreshold

Numeric scalar indicating the adjusted p-value threshold to use for coloring the points. All features with adjusted p-value below the treshold will be shown in red.

pointSize

Either "small" or "large", indicating which of the two available plot styles that will be used.

interactivePlot

Logical scalar, indicating whether an interactive plot should be returned, in which one can hover over the individual points and obtain further information.

nTopToLabel

Numeric scalar, indicating the number of points that should be labeled in the plot. The points will be ranked by the pvalCol column, and the top nTopToLabel values will be labeled by the corresponding row names. Only used if interactivePlot is FALSE.

Value

If interactivePlot is TRUE, a plotly object. If interactivePlot is FALSE, a ggplot2 object.

Author(s)

Charlotte Soneson

Examples

library(SummarizedExperiment)
se <- readRDS(system.file("extdata", "GSE102901_cis_se.rds",
                          package = "mutscan"))[1:200, ]
design <- model.matrix(~ Replicate + Condition,
                       data = colData(se))
res <- calculateRelativeFC(se, design, coef = "Conditioncis_output")
plotVolcano(res, pointSize = "large", nTopToLabel = 3)

Relabel the positions of mutations in the designated ID

Description

Relabel the positions of mutations in the designated ID

Usage

relabelMutPositions(se, conversionTable, mutNameDelimiter = ".")

Arguments

se

SummarizedExperiment object, with row names of the form XX{.}AA{.}NNN, where XX is the name of the reference sequence, AA is the position of the mutated codon, and NNN is the mutated codon or amino acid. {.} is the delimiter, to be specified in the mutNameDelimiter argument. For rows corresponding to sequences with multiple mutated codons, the row names contain multiple names of the form above in a single string, separated by "_".

conversionTable

data.frame with at least three columns:

  • seqname The reference sequence name (should match XX in the mutation name)

  • position The codon position (should match AA in the mutation name)

  • name The new name for the codon (will replace AA in the mutation name, if the reference sequence matches seqname)

mutNameDelimiter

The delimiter used in the mutation name ({.} above).

Value

A SummarizedExperiment object with modified row names.

Author(s)

Charlotte Soneson

Examples

x <- readRDS(system.file("extdata", "GSE102901_cis_se.rds",
                         package = "mutscan"))
conversionTable <- data.frame(seqname = "f", position = 0:32) 
conversionTable$name = paste0((conversionTable$position - 1) %/% 7 + 1, 
                              c("", rep(letters[1:7], 6))[1:33])
out <- relabelMutPositions(x, conversionTable)

Summarize and collapse multiple mutational scanning experiments

Description

Combine multiple sequence lists (as returned by digestFastqs into a SummarizedExperiment, with observed variable sequences (sequence pairs) in rows and samples in columns.

Usage

summarizeExperiment(x, coldata, countType = "umis")

Arguments

x

A named list of objects returned by digestFastqs. Names are used to link the objects to the metadata provided in coldata.

coldata

A data.frame with at least one column "Name", which will be used to link to objects in x. A potentially subset and reordered version of coldata is stored in the colData of the returned SummarizedExperiment.

countType

Either "reads" or "umis". If "reads", the "count" assay of the returned object will contain the observed number of reads for each sequence (pair). If "umis", the "count" assay will contain the number of unique UMIs observed for each sequence (pair).

Value

A SummarizedExperiment x with

assays(x)$counts

containing the observed number of sequences or sequence pairs (if countType = "reads"), or the observed number of unique UMIs for each sequence or sequence pair (if countType = "umis").

rowData(x)

containing the unique sequences or sequence pairs.

colData(x)

containing the metadata provided by coldata.

Author(s)

Michael Stadler, Charlotte Soneson

Examples

## Input sample
inp <- digestFastqs(
    fastqForward = system.file("extdata", "cisInput_1.fastq.gz", 
                               package = "mutscan"), 
    elementsForward = "SUCV", elementLengthsForward = c(1, 10, 18, 96), 
    constantForward = "AACCGGAGGAGGGAGCTG", 
    wildTypeForward = c(FOS = paste0(
        "ACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTC", 
        "TGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTA")),
    nbrMutatedCodonsMaxForward = 1
)
## Output sample
outp <- digestFastqs(
    fastqForward = system.file("extdata", "cisOutput_1.fastq.gz", 
                               package = "mutscan"), 
    elementsForward = "SUCV", elementLengthsForward = c(1, 10, 18, 96), 
    constantForward = "AACCGGAGGAGGGAGCTG", 
    wildTypeForward = c(FOS = paste0(
        "ACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTC", 
        "TGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTA")),
    nbrMutatedCodonsMaxForward = 1
)
## Combine
se <- summarizeExperiment(
    x = list(r1inp = inp, r1outp = outp), 
    coldata = data.frame(Name = c("r1inp", "r1outp"), 
                         Condition = c("input", "output"), 
                         Replicate = c("rep1", "rep1")),
    countType = "umis"
)
se