| Title: | Identification of potential quadruplex forming sequences |
|---|---|
| Description: | Pqsfinder detects DNA and RNA sequence patterns that are likely to fold into an intramolecular G-quadruplex (G4). Unlike many other approaches, pqsfinder is able to detect G4s folded from imperfect G-runs containing bulges or mismatches or G4s having long loops. Pqsfinder also assigns an integer score to each hit that was fitted on G4 sequencing data and corresponds to expected stability of the folded G4. |
| Authors: | Jiri Hon, Dominika Labudova, Matej Lexa and Tomas Martinek |
| Maintainer: | Jiri Hon <[email protected]> |
| License: | BSD_2_clause + file LICENSE |
| Version: | 2.28.0 |
| Built: | 2026-05-29 06:08:06 UTC |
| Source: | https://github.com/bioc/pqsfinder |
Coerce to character vector
## S4 method for signature 'PQSViews' as.character(x)## S4 method for signature 'PQSViews' as.character(x)
x |
PQSViews object. |
Character vector representing PQS.
Desity vector represents numbers of PQS (potential quadruplex forming sequences) overlapping at each position in input sequence.
## S4 method for signature 'PQSViews' density(x)## S4 method for signature 'PQSViews' density(x)
x |
PQSViews object. |
Density vector.
pqs <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGAAAA")) density(pqs)pqs <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGAAAA")) density(pqs)
Get vector of maximal scores for a given object.
maxScores(x, ...)maxScores(x, ...)
x |
An object. |
... |
Additional arguments, for use in specific methods. |
Vector of maximal scores.
showMethods("maxScores")showMethods("maxScores")
For each sequence position it gives the maximal score of all PQS conformations which overlap that position.
## S4 method for signature 'PQSViews' maxScores(x)## S4 method for signature 'PQSViews' maxScores(x)
x |
PQSViews object. |
Vector of maximal scores.
pqs <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGAAAA")) maxScores(pqs)pqs <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGAAAA")) maxScores(pqs)
Function for identification of all potential intramolecular quadruplex patterns (PQS) in DNA or RNA sequence.
pqsfinder( subject, strand = "*", overlapping = FALSE, max_len = 50L, min_score = 47L, run_min_len = 2L, run_max_len = 11L, loop_min_len = 0L, loop_max_len = 30L, max_bulges = 3L, max_mismatches = 3L, max_defects = 3L, tetrad_bonus = 40L, mismatch_penalty = 28L, bulge_penalty = 20L, bulge_len_factor = 0.2, bulge_len_exponent = 1, loop_mean_factor = 6.6, loop_mean_exponent = 0.8, run_re = "G{1,10}.{0,9}G{1,10}", custom_scoring_fn = NULL, use_default_scoring = TRUE, deep = FALSE, verbose = FALSE )pqsfinder( subject, strand = "*", overlapping = FALSE, max_len = 50L, min_score = 47L, run_min_len = 2L, run_max_len = 11L, loop_min_len = 0L, loop_max_len = 30L, max_bulges = 3L, max_mismatches = 3L, max_defects = 3L, tetrad_bonus = 40L, mismatch_penalty = 28L, bulge_penalty = 20L, bulge_len_factor = 0.2, bulge_len_exponent = 1, loop_mean_factor = 6.6, loop_mean_exponent = 0.8, run_re = "G{1,10}.{0,9}G{1,10}", custom_scoring_fn = NULL, use_default_scoring = TRUE, deep = FALSE, verbose = FALSE )
subject |
DNAString or RNAString object. |
strand |
Strand specification. Allowed values are "+", "-" or "*", where the last one represents both strands. Implicitly, the input DNAString object is assumed to encode the "+" strand. |
overlapping |
If true, than all overlapping PQS will be reported. |
max_len |
Maximal lenth of PQS. |
min_score |
Minimal PQS score. The default value 52 shows the best balanced accuracy on G4 sequencing data provided by Chambers et al. 2015. |
run_min_len |
Minimal length of quadruplex run. |
run_max_len |
Maximal length of quadruplex run. |
loop_min_len |
Minimal length of quadruplex loop. Unless the default scoring system is disabled, at most one loop can have zero length. |
loop_max_len |
Maxmimal length of quadruplex loop. |
max_bulges |
Maximal number of runs with bulge. |
max_mismatches |
Maximal number of runs with mismatch. |
max_defects |
Maximum number of defects in total ( |
tetrad_bonus |
Score bonus for one complete G tetrade. |
mismatch_penalty |
Penalization for a mismatch in tetrad. |
bulge_penalty |
Penalization for a bulge in quadruplex run. |
bulge_len_factor |
Penalization factor for a bulge length. |
bulge_len_exponent |
Exponent of bulge length. |
loop_mean_factor |
Penalization factor of loop length mean. |
loop_mean_exponent |
Exponent of loop length mean. |
run_re |
Regular expression specifying one run of quadruplex. |
custom_scoring_fn |
Custom quadruplex scoring function. It takes the
following 10 arguments: |
use_default_scoring |
Enables default internal scoring system. This option is particularly useful in case you intend to radically change the default behavior and specify your own scoring function. By disabling the default scoring you will get a full control above the underlying detection algorithm. |
deep |
Perform deep search. With this option enabled,
|
verbose |
Enables detailed output. Turn it on if you want to see all
possible PQS found at each positions and not just the best one. It is
highly recommended to use this option for debugging custom quadruplex
scoring function. Each PQS is reported on separate row in the following
format: |
Use elementMetadata function to get extra PQS features
like number of tetrads (nt), bulges (nb), mismatches (nm) or loop lengths
(ll1, ll2, ll3).
PQSViews object
pv <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGTAAAA")) pv elementMetadata(pv)pv <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGTAAAA")) pv elementMetadata(pv)
User friendly constructor for PQSViews class representing potential
quadruplex forming sequences (PQS). PQSViews is a subclass of
XStringViews class and adds two more slots to store
PQS density and PQS score distribution.
PQSViews( subject, start, width, strand, score, density, max_scores, nt, nb, nm, rl1, rl2, rl3, ll1, ll2, ll3 )PQSViews( subject, start, width, strand, score, density, max_scores, nt, nb, nm, rl1, rl2, rl3, ll1, ll2, ll3 )
subject |
DNAString or RNAString object. |
start |
Start positions. |
width |
Lengths. |
strand |
Strand specifications. |
score |
Scores. |
density |
Numbers of PQS overlapping at each position in |
max_scores |
Score of the best PQS found at each position. |
nt |
Tetrad numbers. |
nb |
Bulge counts. |
nm |
Mismatch counts. |
rl1 |
Run 1 lengths. |
rl2 |
Run 2 lengths. |
rl3 |
Run 3 lengths. |
ll1 |
Loop 1 lengths. |
ll2 |
Loop 2 lengths. |
ll3 |
Loop 3 lengths. |
Use elementMetadata function to get extra PQS features
like number of tetrads, bulges, mismatches or loop lengths.
PQSViews object.
pv <- PQSViews(DNAString("GGTGGTGGTGG"), 1, 11, "+", 33, as.integer(rep(1, 11)), as.integer(rep(33, 11)), 2, 0, 0, 2, 2, 2, 1, 1, 1) start(pv) width(pv) strand(pv) score(pv) density(pv) maxScores(pv) elementMetadata(pv)pv <- PQSViews(DNAString("GGTGGTGGTGG"), 1, 11, "+", 33, as.integer(rep(1, 11)), as.integer(rep(33, 11)), 2, 0, 0, 2, 2, 2, 1, 1, 1) start(pv) width(pv) strand(pv) score(pv) density(pv) maxScores(pv) elementMetadata(pv)
Represents potential quadruplex forming sequences found by
pqsfinder function. This is a subclass of
XStringViews-class class and adds one more slot.
densityNumbers of PQS (potential quadruplex forming sequences) overlapping at each position in input sequence.
max_scoresScore of the best PQS found at each position.
Get PQS score vector
## S4 method for signature 'PQSViews' score(x)## S4 method for signature 'PQSViews' score(x)
x |
PQSViews object. |
Score vector.
pqs <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGAAAA")) score(pqs)pqs <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGAAAA")) score(pqs)
Show method
## S4 method for signature 'PQSViews' show(object)## S4 method for signature 'PQSViews' show(object)
object |
PQSViews object. |
PQSViews object printed.
Get PQS strand vector
## S4 method for signature 'PQSViews' strand(x)## S4 method for signature 'PQSViews' strand(x)
x |
PQSViews object. |
Strand vector.
pqs <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGAAAA")) strand(pqs)pqs <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGAAAA")) strand(pqs)