rmelting
The R package rmelting is an interface to
the MELTING
5 program (Le Novère, 2001; Dumousseau et
al., 2012) to compute melting temperatures of nucleic acid
duplexes (DNA/DNA, DNA/RNA, RNA/RNA or 2’-O-MeRNA/RNA) along with other
thermodynamic parameters such as hybridisation enthalpy and entropy.
Melting temperatures are computed by Nearest-neighbour methods for short sequences or approximative estimation formulae for long sequences. Apart from these, multiple corrections are available to take into account the presence of Cations (Na, Tris, K and Mg) or denaturing agents (DMSO and formamide).
The package can be installed from Bioconductor as follows.
if (!"BiocManager" %in% rownames(installed.packages()))
install.packages("BiocManager")
BiocManager::install("rmelting")The development version can be installed from github as follows.
if (!require('devtools')) install.packages('devtools')
devtools::install_github("aravind-j/rmelting")Then the package can be loaded as follows.
Melting temperatures are computed in rmelting through
the core function melting which takes a number of arguments
(see ?melting). The following are the essential arguments
which are mandatory for computation.
sequence
Table 1: Recognized sequences
| Code | Type |
|---|---|
| A | Adenine |
| C | Cytosine |
| G | Guanine |
| T | Thymine |
| U | Uracil |
| I | Inosine |
| X_C | Trans azobenzenes |
| X_T | Cis azobenzenes |
| A* | Hydroxyadenine |
| AL | Locked nucleic acid |
| TL | ’’ |
| GL | ’’ |
| CL | ’’ |
Comp.sequence
sequence. Self-complementarity in
sequence is detected even though there may be (are)
dangling end(s) and comp.sequence is computed.nucleic.acid.conc
Na.conc, Mg.conc, Tris.conc, K.conc
hybridisation.type
Table 2: Hybridisation type options
| Option | Sequence | Complementary sequence |
|---|---|---|
dnadna |
DNA | DNA |
rnarna |
RNA | RNA |
dnarna |
DNA | RNA |
rnadna |
RNA | DNA |
mrnarna |
2-o-methyl RNA | RNA |
rnamrna |
RNA | 2-o-methyl RNA |
With these arguments, the melting temperature can be computed as follows.
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)## [1] 73.35168
Only the melting temperature is given as a console output. However, the output can be assigned to an object which contains the details of the environment, options and the thermodynamics results as a list.
# Get output as list
out <- melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)
# Environment output
out$Environment## $Sequence
## [1] "CAGTGAGACAGCAATGGTCG"
##
## $`Complementary sequence`
## [1] "GTCACTCTGTCGTTACCAGC"
##
## $`Nucleic acid concentration (M)`
## [1] 2e-06
##
## $`Hybridization type`
## [1] "dnadna"
##
## $`Na concentration (M)`
## [1] 1
##
## $`Mg concentration (M)`
## [1] 0
##
## $`Tris concentration (M)`
## [1] 0
##
## $`K concentration (M)`
## [1] 0
##
## $`dNTP concentration (M)`
## [1] 0
##
## $`DMSO concentration (%)`
## [1] 0
##
## $`Formamide concentration (M or %)`
## [1] 0
##
## $`Self complementarity`
## [1] FALSE
##
## $`Correction factor`
## [1] 4
## $`Approximative formula`
## [1] NA
##
## $`Nearest neighbour model`
## [1] NA
##
## $`GU model`
## [1] NA
##
## $`Single mismatch model`
## [1] NA
##
## $`Tandem mismatch model`
## [1] NA
##
## $`Single dangling end model`
## [1] NA
##
## $`Double dangling end model`
## [1] NA
##
## $`Long dangling end model`
## [1] NA
##
## $`Internal loop model`
## [1] NA
##
## $`Single bulge loop model`
## [1] NA
##
## $`Long bulge loop model`
## [1] NA
##
## $`CNG repeats model`
## [1] NA
##
## $`Inosine bases model`
## [1] NA
##
## $`Hydroxyadenine bases model`
## [1] NA
##
## $`Azobenzenes model`
## [1] NA
##
## $`Locked nucleic acids model`
## [1] NA
##
## $`Ion correction method`
## [1] NA
##
## $`Na equivalence correction method`
## [1] NA
##
## $`DMSO correction method`
## [1] NA
##
## $`Formamide correction method`
## [1] NA
##
## $Mode
## [1] NA
## $`Enthalpy (cal)`
## [1] -159000
##
## $`Entropy (cal)`
## [1] -430
##
## $`Enthalpy (J)`
## [1] -664620
##
## $`Entropy (J)`
## [1] -1797.4
##
## $`Melting temperature (C)`
## [1] 73.35168
The command for the MELTING 5 java version is saved as an attribute
in the list out and can be retrieved as follows.
## [1] "-S CAGTGAGACAGCAATGGTCG -H dnadna -P 2e-06 -E Na=1 -T 60"
Melting temperature is computed by either approximative or nearest
neighbour methods according to the length of the oligonucleotide
sequences. For longer sequences (longer than the threshold value, the
threshold value set by size.threshold with the default
value 60) approximative method is used, while for others, nearest
neighbour method is used.
The approximative method for computation can be specified by the
argument method.approx. The available methods are given in
Table 3.
Table 3: Details of approximative methods
| Formula | Type | Limits/Remarks | Reference |
|---|---|---|---|
ahs01 |
DNA | No mismatch | Ahsen et al. (2001) |
che93 |
DNA | No mismatch; Na=0, Mg=0.0015, Tris=0.01, K=0.05 | Marmur and Doty (1962) |
che93corr |
DNA | No mismatch; Na=0, Mg=0.0015, Tris=0.01, K=0.05 | Marmur and Doty (1962) |
schdot |
DNA | No mismatch | Wetmur (1991), Marmur and Doty (1962), Chester and Marshak (1993), Schildkraut and Lifson (1965), Wahl et al. (1987), Britten et al. (1974), Hall et al. (1980) |
owe69 |
DNA | No mismatch | Owen et al. (1969), Frank-Kamenetskii (1971), Blake (1996), Blake and Delcourt (1998) |
san98 |
DNA | No mismatch | SantaLucia (1998), Ahsen et al. (2001) |
wetdna91* |
DNA | Wetmur (1991) | |
wetrna91* |
RNA | Wetmur (1991) | |
wetdnarna91* |
DNA/RNA | Wetmur (1991) |
Examples
DNA:TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DNA:AGATTACACGACAATCTACATAGGTCTCTATCGGCTCGTATTTGAAGTTGTGTGCTCTGCAACTAACCTAAATTGGTATC
RNA:UUAAUCUCCGUCAUCUUUAAGCCGUGGAGAGACUGUAGACUUGAACAGGGGUAAGCGGAGGCACGUAGGAUUCACAUCAU
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RNA:AAUUAGAGGCAGUAGAAAUUCGGCACCUCUCUGACAUCUGAACUUGUCCCCAUUCGCCUCCGUGCAUCCUAAGUGUAGUA
DNA:TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RNA:AGAUUACACGACAAUCUACAUAGGUCUCUAUCGGCUCGUAUUUGAAGUUGUGUGCUCUGCAACUAACCUAAAUUGGUAUC
# Long Nucleotide sequence
DNAseq <- c("TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG")
RNAseq <- c("UUAAUCUCCGUCAUCUUUAAGCCGUGGAGAGACUGUAGACUUGAACAGGGGUAAGCGGAGGCACGUAGGAUUCACAUCAU")
# Approximative method - default (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)## [1] 87.82455
# Approximative method - wetdna91 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "wetdna91")## [1] 87.82455
# Approximative method - ahs01 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "ahs01")## [1] 87.325
# Approximative method - che93 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "che93")## [1] 77.575
# Approximative method - che93corr (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "che93corr")## [1] 79.0125
# Approximative method - schdot (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "schdot")## [1] 89.4625
# Approximative method - owe69 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "owe69")## [1] 100.96
# Approximative method - san98 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "san98")## [1] 86.9
# Approximative method - default (RNA/RNA)
melting(sequence = RNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1)## [1] 101.1745
# Approximative method - wetrna91 (RNA/RNA)
melting(sequence = RNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1,
method.approx = "wetrna91")## [1] 101.1745
# Approximative method - wetdnarna91 (DNA/RNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnarna", Na.conc = 1)## [1] 88.92455
# Approximative method - wetdnarna91 (DNA/RNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnarna", Na.conc = 1,
method.approx = "wetdnarna91")## [1] 88.92455
The nearest neighbour model for computation in case of perfectly
matching sequences can be specified by the argument
method.nn. The available methods are given in Table
4.
Table 4: Details of nearest neighbour methods for perfectly matching sequences
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
all97* |
DNA | Allawi and SantaLucia (1997) | |
bre86 |
DNA | Breslauer et al. (1986) | |
san04 |
DNA | SantaLucia and Hicks (2004) | |
san96 |
DNA | SantaLucia et al. (1996) | |
sug96 |
DNA | Sugimoto et al. (1996) | |
tan04 |
DNA | Tanaka et al. (2004) | |
fre86 |
RNA | Freier et al. (1986) | |
xia98* |
RNA | Xia et al. (1998) | |
sug95* |
DNA/ RNA | SantaLucia et al. (1996) | |
tur06* |
2’-O-MeRNA/ RNA | A sodium correction (san04) is
automatically applied to convert the entropy (Na = 0.1M) into the
entropy (Na = 1M) |
Kierzek et al. (2006) |
Examples
DNA:CAGTGAGACAGCAATGGTCG
||||||||||||||||||||
DNA:GTCACTCTGTCGTTACCAGC
RNA:CAGUGAGACAGCAAUGGUCG
||||||||||||||||||||
RNA:GUCACUCUGUCGUUACCAGC
DNA:CAGTGAGACAGCAATGGTCG
||||||||||||||||||||
RNA:GUCACUCUGUCGUUACCAGC
# Nearest neighbour method - default (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)## [1] 73.35168
# Nearest neighbour method - all97 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "all97")## [1] 73.35168
# Nearest neighbour method - bre86 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "bre86")## [1] 83.2203
# Nearest neighbour method - san04 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san04")## [1] 73.30191
# Nearest neighbour method - san96 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san96")## [1] 75.7102
# Nearest neighbour method - sug96 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "sug96")## [1] 78.17556
# Nearest neighbour method - tan04 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "tan04")## [1] 71.31413
# Nearest neighbour method - default (RNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1)## [1] 86.77685
# Nearest neighbour method - xia98 (RNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1, method.nn = "xia98")## [1] 86.77685
# Nearest neighbour method - fre86 (RNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1, method.nn = "fre86")## [1] 83.81257
# Nearest neighbour method - default (mRNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "mrnarna", Na.conc = 1)## [1] 99.01986
# Nearest neighbour method - tur06 (mRNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "mrnarna", Na.conc = 1, method.nn = "tur06")## [1] 99.01986
# Nearest neighbour method - default (DNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnarna", Na.conc = 1)## [1] 66.77049
# Nearest neighbour method - sug95 (DNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnarna", Na.conc = 1, method.nn = "sug95")## [1] 66.77049
Self complementarity for perfect matching sequences or sequences with
dangling ends is detected automatically. However it can be enforced by
the argument force.self = TRUE.
Examples
DNA:CATATGGCCATATG
||||||||||||||
DNA:GTATACCGGTATAC
RNA:AUGUACAU
||||||||
RNA:UACAUGUA
# Nearest neighbour method - default (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)## [1] 56.00644
# Nearest neighbour method - all97 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "all97")## [1] 56.00644
# Nearest neighbour method - bre86 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "bre86")## [1] 63.44605
# Nearest neighbour method - san04 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san04")## [1] 57.80792
# Nearest neighbour method - san96 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san96")## [1] 55.0921
# Nearest neighbour method - sug96 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "sug96")## [1] 59.06213
# Nearest neighbour method - tan04 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "tan04")## [1] 55.65824
# Nearest neighbour method - default (RNA/RNA: Self-Complimentarity)
melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1)## [1] 30.27015
# Nearest neighbour method - xia98 (RNA/RNA: Self-Complimentarity)
melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1, method.nn = "xia98")## [1] 30.27015
# Nearest neighbour method - fre86 (RNA/RNA: Self-Complimentarity)
melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1, method.nn = "fre86")## [1] 31.48175
The nearest neighbour model for computation in case of sequences with
GU wobble base pairs can be specified by the argument
method.GU. The available methods are given in Table
5.
Table 5: Details of methods for sequences with GU wobble base pairs
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
tur99 |
RNA | Mathews et al. (1999) | |
ser12* |
RNA | Chen et al. (2012) |
Examples
RNA:CCAGCGUCCU
||||||||||
RNA:GGTCGCAGGA
# GU wobble base pairs effect - default (RNA/RNA)
melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001,
hybridisation.type = "rnarna", Na.conc = 1)## [1] 79.46955
# GU wobble base pairs effect - ser12 (RNA/RNA)
melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001,
hybridisation.type = "rnarna", Na.conc = 1, method.GU = "ser12")## [1] 79.46955
# GU wobble base pairs effect - tur99 (RNA/RNA)
melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001,
hybridisation.type = "rnarna", Na.conc = 1, method.GU = "tur99")## [1] 79.46955
The nearest neighbour model for computation in case of sequences with
a single mismatch can be specified by the argument
method.singleMM. The available methods are given in
Table 6.
Table 6: Details of methods for sequences with single mismatch
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
allsanpey* |
DNA | Allawi and SantaLucia (1997), Allawi and SantaLucia (1998a), Allawi and SantaLucia (1998b), Allawi and SantaLucia (1998c), Peyret et al. (1999) | |
wat11* |
DNA/RNA | Watkins et al. (2011) | |
tur06 |
RNA | Lu et al. (2006) | |
zno07* |
RNA | Davis and Znosko (2007) | |
zno08 |
RNA | At least one adjacent GU base pair. | Davis and Znosko (2008) |
Examples
DNA:CAACTTGATATTAATA
|||||||| |||||||
DNA:GTTGAACTCTAATTAT
RNA:GACAGGCUG
|||| ||||
RNA:CUGUGCGAC
DNA:CCATAACTACC
|||| ||||||
RNA:GGUAAUGAUGG
# Single mismatch effect - default (DNA/DNA)
melting(sequence = "CAACTTGATATTAATA", comp.sequence = "GTTGAACTCTAATTAT",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1)## [1] 51.97499
# Single mismatch effect - allsanpey (DNA/DNA)
melting(sequence = "CAACTTGATATTAATA", comp.sequence = "GTTGAACTCTAATTAT",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.singleMM = "allsanpey")## [1] 51.97499
# Single mismatch effect - default (RNA/RNA)
melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1)## [1] 54.40363
# Single mismatch effect - zno07 (RNA/RNA)
melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.singleMM = "zno07")## [1] 54.40363
# Single mismatch effect - zno08 (RNA/RNA)
melting(sequence = "CAGUACGUC", comp.sequence = "GUCGGGCAG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.singleMM = "zno08")## [1] 38.26298
# Single mismatch effect - tur06 (RNA/RNA)
melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.singleMM = "tur06")## [1] 58.27825
# Single mismatch effect - default (DNA/RNA)
melting(sequence = "CCATAACTACC", comp.sequence = "GGUAAUGAUGG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnarna", Na.conc = 1)## [1] 40.32976
# Single mismatch effect - wat11 (DNA/RNA)
melting(sequence = "CCATAACTACC", comp.sequence = "GGUAAUGAUGG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnarna",
Na.conc = 1, method.singleMM = "wat11")## [1] 40.32976
The nearest neighbour model for computation in case of sequences with
tandem mismatches can be specified by the argument
method.tandemMM. The available methods are given in
Table 7.
Table 7: Details of methods for sequences with tandem mismatches
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
allsanpey* |
DNA | Only GT mismatches and TA/TG mismatches. | Allawi and SantaLucia (1997), Allawi and SantaLucia (1998a), Allawi and SantaLucia (1998b), Allawi and SantaLucia (1998c), Peyret et al. (1999) |
tur99* |
RNA | No adjacent GU or UG base pairs. | Mathews et al. (1999), Lu et al. (2006) |
Examples
DNA:GACGTTGGAC
|||| ||||
DNA:CTGCGGCCTG
RNA:GAGCGGAG
||| |||
RNA:CUCCACUC
# Tandem mismatches effect - default (DNA/DNA)
melting(sequence = "GACGTTGGAC", comp.sequence = "CTGCGGCCTG",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1)## [1] 50.20175
# Tandem mismatches effect - allsanpey (DNA/DNA)
melting(sequence = "GACGTTGGAC", comp.sequence = "CTGCGGCCTG",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.tandemMM = "allsanpey")## [1] 50.20175
# Tandem mismatches effect - default (RNA/RNA)
melting(sequence = "GAGCGGAG", comp.sequence = "CUCCACUC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1)## [1] 21.07224
# Tandem mismatches effect - tur06 (RNA/RNA)
melting(sequence = "GAGCGGAG", comp.sequence = "CUCCACUC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.tandemMM = "tur99")## [1] 21.07224
The nearest neighbour model for computation in case of sequences with
a single dangling end can be specified by the argument
method.single.dangle. The available methods are given in
Table 8.
Table 8: Details of methods for sequences with single dangling end
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
bom00* |
DNA | Bommarito et al. (2000) | |
sugdna02 |
DNA | Only terminal poly A self complementary sequences. | Ohmichi et al. (2002) |
sugrna02 |
RNA | Only terminal poly A self complementary sequences. | Ohmichi et al. (2002) |
ser08* |
RNA | Only 3’ UA, GU and UG terminal base pairs only 5’ UG and GU terminal base pairs. | O’Toole et al. (2006), Miller et al. (2008) |
Examples
DNA:-GTAGCTACA
||||||||
DNA:ACATCGATG-
RNA:-GGCGCUG
|||||||
RNA: CCGCGAC
DNA:-GGCGCUG
|||||||
RNA: CCGCGAC
# Single dangling end effect - default (DNA/DNA)
melting(sequence = "-GTAGCTACA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 52.58935
# Single dangling end effect - bom00 (DNA/DNA)
melting(sequence = "-GTAGCTACA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.single.dangle = "bom00")## [1] 52.58935
# Single dangling end effect - sugdna02 (DNA/DNA)
melting(sequence = "-GTAGCTACA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.single.dangle = "sugdna02")## [1] 50.78548
# Single dangling end effect - default (RNA/RNA)
melting(sequence = "-GGCGCUG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 65.7647
# Single dangling end effect - ser08 (RNA/RNA)
melting(sequence = "-GGCGCUG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.single.dangle = "ser08")## [1] 65.7647
# Single dangling end effect - sugrna02 (RNA/RNA)
melting(sequence = "-GGCGCUG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.single.dangle = "sugrna02")## [1] 65.7647
The nearest neighbour model for computation in case of sequences with
a double or secondary dangling ends can be specified by the argument
method.double.dangle. The available methods are given in
Table 9.
Table 9: Details of methods for sequences with double dangling ends
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
sugdna02* |
DNA | Only terminal poly A self complementary sequences. | Ohmichi et al. (2002) |
sugrna02 |
RNA | Only terminal poly A self complementary sequences. | Ohmichi et al. (2002) |
ser05 |
RNA | Depends on the available thermodynamic parameters for single dangling end. | O’Toole et al. (2005) |
ser06* |
RNA | O’Toole et al. (2006) |
Examples
DNA:--ATGCATAA
||||||
DNA:AATACGTA--
RNA:--AUGCAUAA
||||||
RNA:AAUACGUA--
# Double dangling end effect - default (DNA/DNA)
melting(sequence = "--ATGCATAA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 44.88615
# Double dangling end effect - sugdna02 (DNA/DNA)
melting(sequence = "--ATGCATAA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.double.dangle = "sugdna02")## [1] 44.88615
# Double dangling end effect - default (RNA/RNA)
melting(sequence = "--AUGCAUAA",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 42.79724
# Double dangling end effect - ser06 (RNA/RNA)
melting(sequence = "--AUGCAUAA",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.double.dangle = "ser06")## [1] 42.79724
# Double dangling end effect - sugrna02 (RNA/RNA)
melting(sequence = "--AUGCAUAA",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.double.dangle = "sugrna02")## [1] 41.82788
# Double dangling end effect - ser05 (RNA/RNA)
melting(sequence = "--AUGCAUAA",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.double.dangle = "ser05")## [1] 42.78815
The nearest neighbour model for computation in case of sequences with
a double or secondary dangling ends can be specified by the argument
method.long.dangle. The available methods are given in
Table 10.
Table 10: Details of methods for sequences with long dangling ends
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
sugdna02* |
DNA | Only terminal poly A self complementary sequences. | Ohmichi et al. (2002) |
sugrna02* |
RNA | Only terminal poly A self complementary sequences. | Ohmichi et al. (2002) |
Examples
DNA:----GCATATGCAAAA
||||||||
DNA:AAAACGTATACG----
RNA:AAAAGCAUAUGC----
||||||||
RNA:----CGUAUACGAAAA
# Long dangling end effect - default (DNA/DNA)
melting(sequence = "----GCATATGCAAAA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 55.69854
# Long dangling end effect - sugdna02 (DNA/DNA)
melting(sequence = "----GCATATGCAAAA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.long.dangle = "sugdna02")## [1] 55.69854
# Long dangling end effect - default (RNA/RNA)
melting(sequence = "AAAAGCAUAUGC----",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 57.21314
# Long dangling end effect - sugrna02 (RNA/RNA)
melting(sequence = "AAAAGCAUAUGC----",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.long.dangle = "sugrna02")## [1] 57.21314
The nearest neighbour model for computation in case of sequences with
an internal loop (more than two adjacent mismatches) can be specified by
the argument method.internal.loop. The available methods
are given in Table 11.
Table 11: Details of methods for sequences with internal loops
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
san04* |
DNA | Missing asymmetry penalty. Not tested with experimental results. | SantaLucia and Hicks (2004) |
tur06 |
RNA | Not tested with experimental results. | Lu et al. (2006) |
zno07* |
RNA | Only for 1x2 loop. | Badhwar et al. (2007) |
Examples
DNA:GCGATTGGCACTTTGGTGAAC
||||| ||||||||||||
DNA:CGCTACATATGAAACCACTTG
RNA:GACAC-GCUG
|||| ||||
RNA:CUGUAUCGAC
# Internal loop effect - default (DNA/DNA)
melting(sequence = "GCGATTGGCACTTTGGTGAAC", comp.sequence = "CGCTACATATGAAACCACTTG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 84.09052
# Internal loop effect - san04 (DNA/DNA)
melting(sequence = "GCGATTGGCACTTTGGTGAAC", comp.sequence = "CGCTACATATGAAACCACTTG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.internal.loop = "san04")## [1] 84.09052
# Internal loop effect - default (RNA/RNA)
melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 45.98713
# Internal loop effect - zno07 (RNA/RNA)
melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.internal.loop = "zno07")## [1] 40.49012
# Internal loop effect - tur06 (RNA/RNA)
melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.internal.loop = "tur06")## [1] 45.98713
The nearest neighbour model for computation in case of sequences with
a single bulge loop can be specified by the argument
method.single.bulge.loop. The available methods are given
in Table 12.
Table 12: Details of methods for sequences with single bulge loop
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
tan04* |
DNA | Tan and Chen (2007) | |
san04 |
DNA | Missing closing AT penalty. | SantaLucia and Hicks (2004) |
ser07 |
RNA | Less reliable results. Some missing parameters. | Blose et al. (2007) |
tur06* |
RNA | Lu et al. (2006) |
Examples
DNA:TCGATTAGCGACACAGG
|||||||| ||||||||
DNA:AGCTAATC-CTGTGTCC
RNA:GACUCUGUC
|||| ||||
RNA:CUGA-ACAG
# Single bulge loop effect - default (DNA/DNA)
melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 71.12754
# Single bulge loop effect - tan04 (DNA/DNA)
melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.single.bulge.loop = "tan04")## [1] 71.12754
# Single bulge loop effect - san04 (DNA/DNA)
melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.single.bulge.loop = "san04")## [1] 62.0496
# Single bulge loop effect - default (RNA/RNA)
melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 39.47787
# Single bulge loop effect - tur06 (RNA/RNA)
melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.single.bulge.loop = "tur06")## [1] 39.47787
# Single bulge loop effect - ser07 (RNA/RNA)
melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.single.bulge.loop = "ser07")## [1] 31.42849
The nearest neighbour model for computation in case of sequences with
long bulge loop can be specified by the argument
method.long.bulge.loop. The available methods are given in
Table 13.
Table 13: Details of methods for sequences with long bulge loop
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
san04* |
DNA | Missing closing AT penalty. | SantaLucia and Hicks (2004) |
tur06* |
RNA | Not tested with experimental results. | Mathews et al. (1999), Lu et al. (2006) |
Examples
DNA:ATATGACGCCACAGCG
||||| ||||||||
DNA:TATAC---GGTGTCGC
RNA:AUAUGACGCCACAGCG
||||| ||||||||
RNA:UAUAC---GGUGUCGC
# Long bulge loop effect - default (DNA/DNA)
melting(sequence = "ATATGACGCCACAGCG", comp.sequence = "TATAC---GGTGTCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 51.7104
# Long bulge loop effect - san04 (DNA/DNA)
melting(sequence = "ATATGACGCCACAGCG", comp.sequence = "TATAC---GGTGTCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.long.bulge.loop = "san04")## [1] 51.7104
# Long bulge loop effect - default (RNA/RNA)
melting(sequence = "AUAUGACGCCACAGCG", comp.sequence = "UAUAC---GGUGUCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 66.0497
# Long bulge loop effect - tur06 (RNA/RNA)
melting(sequence = "AUAUGACGCCACAGCG", comp.sequence = "UAUAC---GGUGUCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.long.bulge.loop = "tur06")## [1] 66.0497
The nearest neighbour model for computation in case of sequences with
CNG repeats can be specified by the argument method.CNG.
The available methods are given in Table 14.
Table 14: Details of methods for sequences with CNG repeats
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
bro05* |
RNA | Self complementary sequences. 2 to 7 CNG repeats. | Broda et al. (2005) |
Examples
RNA:GCGGCGGCGGC
|||||||||||
RNA:CGCCGCCGCCG
# CNG repeats effect - default (RNA/RNA)
melting(sequence = "GCGGCGGCGGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 94.25719
# CNG repeats effect - bro05 (RNA/RNA)
melting(sequence = "GCGGCGGCGGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.CNG = "bro05")## [1] 94.25719
The nearest neighbour model for computation in case of sequences with
inosine bases (I) can be specified by the argument
method.inosine. The available methods are given in
Table 15.
Table 15: Details of methods for sequences with inosine bases
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
san05* |
DNA | Missing parameters for tandem base pairs containing inosine bases. | Watkins and SantaLucia (2005) |
zno07* |
RNA | Only IU base pairs. | Wright et al. (2007) |
Examples
DNA:CCGICTGTIGCG
||| |||| |||
DNA:GGCCGACACCGC
RNA:GCAICGC
||| |||
RNA:CGUUGCG
# Inosine bases effect - default (DNA/DNA)
melting(sequence = "CCGICTGTIGCG", comp.sequence = "GGCCGACACCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 65.36853
# Inosine bases effect - san05 (DNA/DNA)
melting(sequence = "CCGICTGTIGCG", comp.sequence = "GGCCGACACCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.inosine = "san05")## [1] 65.36853
# Inosine bases effect - default (RNA/RNA)
melting(sequence = "GCAICGC", comp.sequence = "CGUUGCG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 46.75042
# Inosine bases effect - zno07 (RNA/RNA)
melting(sequence = "GCAICGC", comp.sequence = "CGUUGCG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.inosine = "zno07")## [1] 46.75042
The nearest neighbour model for computation in case of sequences with
hydroxyadenine bases can be specified by the argument
method.hydroxyadenine. The available methods are given in
Table 16.
Table 16: Details of methods for sequences with hydroxyadenine bases
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
sug01* |
DNA | Only 5’ GA*C 3’and 5’ TA*A 3’ contexts. | Kawakami et al. (2001) |
Examples
*
DNA:AGAAATGACACGGTG
|||||||||||||||
DNA:TCTTTACCGTGCCAC
# Hydroxyadenine bases effect - default (DNA/DNA)
melting(sequence = "AGAAATGA*CACGGTG", comp.sequence = "TCTTTACCGTGCCAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 68.46041
# Hydroxyadenine bases effect - sug01 (DNA/DNA)
melting(sequence = "AGAAATGA*CACGGTG", comp.sequence = "TCTTTACCGTGCCAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.hydroxyadenine = "sug01")## [1] 68.46041
The nearest neighbour model for computation in case of sequences with
azobenzenes (X_T for trans azobenzenes and X_C for cis azobenzenes) can
be specified by the argument method.azobenzenes. The
available methods are given in Table 17.
Table 17: Details of methods for sequences with azobenzenes
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
asa05* |
DNA | Less reliable results when the number of cis azobenzene increases. | Asanuma et al. (2005) |
Examples
C C C C C
DNA:CTXTTAAXGAAGXGAGAXTATAXCC
|| |||| |||| |||| |||| ||
DNA:GA AATT CTTC CTCT ATAT GG
# Azobenzenes effect - default (DNA/DNA)
melting(sequence = "CTX_CTTAAX_CGAAGX_CGAGAX_CTATAX_CCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 47.85385
# Azobenzenes effect - asa05 (DNA/DNA)
melting(sequence = "CTX_CTTAAX_CGAAGX_CGAGAX_CTATAX_CCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.azobenzenes = "asa05")## [1] 47.85385
The nearest neighbour model for computation in case of sequences with
single locked nucleic acids can be specified by the argument
method.locked. The available methods are given in
Table 18.
Table 18: Details of methods for sequences with single locked nucleic acids
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
mct04 |
DNA | McTigue et al. (2004) | |
owc11* |
DNA | Owczarzy et al. (2011) |
Examples
L
DNA:CCATTGCTACC
|||||||||||
DNA:GGTAACGATGG
# Single locked nucleic acids effect - default (DNA/DNA)
melting(sequence = "CCATTLGCTACC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 63.48299
# Single locked nucleic acids effect - mct04 (DNA/DNA)
melting(sequence = "CCATTLGCTACC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.locked = "mct04")## [1] 63.61426
# Single locked nucleic acids effect - owc11 (DNA/DNA)
melting(sequence = "CCATTLGCTACC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.locked = "owc11")## [1] 63.48299
The nearest neighbour model for computation in case of sequences with
consecutive locked nucleic acids can be specified by the argument
method.consecutive.locked. The available methods are given
in Table 19.
Table 19: Details of methods for sequences with single locked nucleic acids
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
owc11* |
DNA | Owczarzy et al. (2011) |
Examples
LL
DNA:GACC
||||
DNA:CTGG
# Consecutive locked nucleic acids effect - default (DNA/DNA)
melting(sequence = "GALCLC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 12.94323
# Consecutive locked nucleic acids effect - owc11 (DNA/DNA)
melting(sequence = "GALCLC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.consecutive.locked = "owc11")## [1] 12.94323
The nearest neighbour model for computation in case of sequences with
consecutive locked nucleic acids with single mismatch can be specified
by the argument method.consecutive.locked.singleMM. The
available methods are given in Table 20.
Table 20: Details of methods for sequences with single locked nucleic acids
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
owc11* |
DNA | Owczarzy et al. (2011) |
Examples
LLL
DNA:GACGC
|| ||
DNA:CTTCG
# Consecutive locked nucleic acids effect - default (DNA/DNA)
melting(sequence = "GALCLGLC", comp.sequence = "CTTCG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 0.2520424
# Consecutive locked nucleic acids effect - owc11 (DNA/DNA)
melting(sequence = "GALCLGLC", comp.sequence = "CTTCG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.consecutive.locked.singleMM = "owc11")## [1] 0.2520424
Once the melting temperature is computed, a correction is applied to it according to the concentration of nucleic acids, cations and/or denaturing agents.
For self complementary sequences (auto detected or specified by
force.self) it is 1. Otherwise it is 4 if the both strands
are present in equivalent amount and 1 if one strand is in excess.
Melting temperature is computed initially for \([\textrm{Na}^{+}]\) = 1 M, after which a correction for the presence of cations (\([\textrm{Na}^{+}]\), \([\textrm{K}^{+}]\), \([\textrm{Tris}^{+}]\) and \([\textrm{Mg}^{+}]\)) is applied either directly on the computed melting temperature or on the computed entropy.
Th correction methods for cation concentration can be specified by
the argument correction.ion.
The available correction methods for sodium concentration are given in Table 21.
Table 21: Details of the corrections for sodium concentration
| Correction | Type | Limits/Remarks | Reference |
|---|---|---|---|
ahs01 |
DNA | Na>0. | Ahsen et al. (2001) |
kam71 |
DNA | Na>0; Na>=0.069; Na<=1.02. | Frank-Kamenetskii (1971) |
marschdot |
DNA | Na>=0.069; Na<=1.02. | Marmur and Doty (1962), Blake and Delcourt (1998) |
owc1904 |
DNA | Na>0. (equation 19) | Owczarzy et al. (2004) |
owc2004 |
DNA | Na>0. (equation 20) | Owczarzy et al. (2004) |
owc2104 |
DNA | Na>0. (equation 21) | Owczarzy et al. (2004) |
owc2204* |
DNA | Na>0. (equation 22) | Owczarzy et al. (2004) |
san96 |
DNA | Na>=0.1. | SantaLucia et al. (1996) |
san04 |
DNA | Na>=0.05; Na<=1.1; Oligonucleotides inferior to 16 bases. | SantaLucia and Hicks (2004), SantaLucia (1998) |
schlif |
DNA | Na>=0.07; Na<=0.12. | Schildkraut and Lifson (1965) |
tanna06 |
DNA | Na>=0.001; Na<=1. | Tan and Chen (2006) |
tanna07* |
RNA or 2’-O-MeRNA/RNA | Na>=0.003; Na<=1. | Tan and Chen (2007) |
wet91 |
RNA, DNA and RNA/DNA | Na>0. | Wetmur (1991) |
# Na correction - default (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069)## [1] 56.70492
# Na correction - owc2204 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "owc2204")## [1] 56.70492
# Na correction - ahs01 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "ahs01")## [1] 54.1569
# Na correction - kam71 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "kam71")## [1] 51.72963
# Na correction - marschdot (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "marschdot")## [1] 49.18075
# Na correction - owc1904 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "owc1904")## [1] 56.18571
# Na correction - owc2004 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "owc2004")## [1] 56.67553
# Na correction - owc2104 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "owc2104")## [1] 56.63967
# Na correction - san96 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "san96")## [1] 53.01651
# Na correction - san04 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "san04")## [1] 54.15157
# Na correction - schlif (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "schlif")## [1] 48.25579
# Na correction - tanna06 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "tanna06")## [1] 55.26711
# Na correction - wet91 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "wet91")## [1] 51.74573
# Na correction - default (RNA/RNA)
melting(sequence = "CCAGCCAGUCUCUCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069)## [1] 75.1552
# Na correction - tanna07 (RNA/RNA)
melting(sequence = "CCAGCCAGUCUCUCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069, correction.ion = "tanna07")## [1] 75.1552
# Na correction - wet91 (RNA/RNA)
melting(sequence = "CCAGCCAGUCUCUCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069, correction.ion = "wet91")## [1] 69.55572
# Na correction - default (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Na.conc = 0.069)## [1] 81.57763
# Na correction - tanna07 (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Na.conc = 0.069, correction.ion = "tanna07")## [1] 81.57763
# Na correction - default (DNA/RNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnarna",
Na.conc = 0.069)## [1] 62.08869
# Na correction - wet91 (DNA/RNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnarna",
Na.conc = 0.069, correction.ion = "wet91")## [1] 62.08869
The available correction methods for magnesium concentration are given in Table 22.
Table 22: Details of the corrections for magnesium concentration
| Correction | Type | Limits/Remarks | Reference |
|---|---|---|---|
owcmg08* |
DNA | Mg>=0.0005; Mg<=0.6. | Owczarzy et al. (2008) |
tanmg06 |
DNA | Mg>=0.0001; Mg<=1; Oligomer length superior to 6 base pairs. | Tan and Chen (2006) |
tanmg07* |
RNA or 2’-O-MeRNA/RNA | Mg>=0.1; Mg<=0.3. | Tan and Chen (2007) |
# Mg correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Mg.conc = 0.0015)## [1] 65.52043
# Mg correction - owcmg08 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Mg.conc = 0.0015, correction.ion = "owcmg08")## [1] 65.52043
# Mg correction - tanmg06 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Mg.conc = 0.0015, correction.ion = "tanmg06")## [1] 64.88082
# Mg correction - default (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Mg.conc = 0.0015)## [1] 82.0796
# Mg correction - tanmg07 (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Mg.conc = 0.0015, correction.ion = "tanmg07")## [1] 82.0796
# Mg correction - default (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Mg.conc = 0.0015)## [1] 90.06842
# Mg correction - tanmg07 (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Mg.conc = 0.0015, correction.ion = "tanmg07")## [1] 90.06842
The available correction methods for mixed sodium magnesium concentration are given in Table 23.
Table 23: Details of the corrections for mixed sodium and magnesium concentration
| Correction | Type | Limits/Remarks | Reference |
|---|---|---|---|
owcmix08* |
DNA | Mg>=0.0005; Mg<=0.6; Na+K+Tris/2>0. | Owczarzy et al. (2008) |
tanmix07 |
DNA, RNA or 2’-O-MeRNA/RNA | Mg>=0.1; Mg<=0.3; Na+K+Tris/2>=0.1; Na+K+Tris/2<=0.3. | Tan and Chen (2007) |
# Mixed Na & Mg correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015)## [1] 65.83371
# Mixed Na & Mg correction - owcmix08 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "owcmix08")## [1] 65.83371
# Mixed Na & Mg correction - tanmix07 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07")## [1] 63.21723
# Mixed Na & Mg correction - default (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069, Mg.conc = 0.0015)## [1] 79.40119
# Mixed Na & Mg correction - tanmix07 (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07")## [1] 79.40119
# Mixed Na & Mg correction - default (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Na.conc = 0.069, Mg.conc = 0.0015)## [1] 96.46186
# Mixed Na & Mg correction - tanmix07 (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07")## [1] 96.46186
The ion correction by Owczarzy et al. (2008) is used by default according to the \(\frac{[\textrm{Mg}^{2+}]^{0.5}}{[\textrm{Mon}^{+}]}\) ratio, where \([\textrm{Mon}^{+}] = \textrm{Na}^{+}]+[\textrm{Tris}^{+}]+[\textrm{K}^{+}]\).
If,
Note that \([\textrm{Tris}^{+}]\) is about half of the total tris buffer concentration.
The available correction methods for mixed sodium magnesium concentration are given in Table 24.
Table 24: Details of the methods for computation of sodium equivalent concentration in the presence of other ions
| Correction | Type | Limits/Remarks | Reference |
|---|---|---|---|
ahs01* |
DNA | Ahsen et al. (2001) | |
mit96 |
DNA | Mitsuhashi (1996) | |
pey00 |
DNA | Peyret (2000) |
# Na equivalent concentration method - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015)## [1] 65.83371
# Na equivalent concentration method - ahs01 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "ahs01")## [1] 65.83371
# Na equivalent concentration method - mit96 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "mit96")## [1] 65.83371
# Na equivalent concentration method - pey00 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "pey00")## [1] 65.83371
These include melting temperature corrections for concentration of formamide and DMSO.
The available correction methods for DMSO concentration are given in Table 25.
Table 25: Details of the corrections for DMSO concentration
| Correction | Type | Limits/Remarks | Reference |
|---|---|---|---|
ahs01* |
DNA | Not tested with experimental results. | Ahsen et al. (2001) |
cul76 |
DNA | Not tested with experimental results. | Cullen and Bick (1976) |
esc80 |
DNA | Not tested with experimental results. | Escara and Hutton (1980) |
mus81 |
DNA | Not tested with experimental results. | Musielski et al. (1981) |
# DMSO correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10)## [1] 65.40154
# DMSO correction - ahs01 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10, correction.DMSO = "ahs01")## [1] 65.40154
# DMSO correction - cul76 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10, correction.DMSO = "cul76")## [1] 67.90154
# DMSO correction - esc80 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10, correction.DMSO = "esc80")## [1] 66.15154
# DMSO correction - mus80 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10, correction.DMSO = "mus81")## [1] 66.90154
The available correction methods for formamide concentration are given in Table 26.
Table 26: Details of the corrections for formamide concentration
| Correction | Type | Limits/Remarks | Reference |
|---|---|---|---|
bla96* |
DNA | With formamide concentration in mol/L. | Blake (1996) |
lincorr |
DNA | With a % of formamide volume. | McConaughy et al. (1969), Record (1967), Casey and Davidson (1977), Hutton (1977) |
# Formamide correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, formamide.conc = 0.06)## [1] 72.74867
# Formamide correction - bla96 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, formamide.conc = 0.06, correction.formamide = "bla96")## [1] 72.74867
# Formamide correction - lincorr (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, formamide.conc = 10, correction.formamide = "lincorr")## [1] 66.40154
The options in MELTING 5 command line equivalent to the arguments in
rmelting are given in Table 27.
Table 27: Arguments in rmelting and
their equivalent options in MELTING 5 command line.
rmelting |
MELTING 5 (command line) |
|---|---|
sequence |
-S |
comp.sequence |
-C |
nucleic.acid.conc |
-P |
hybridisation.type |
-H |
Na.conc |
-E |
Mg.conc |
-E |
Tris.conc |
-E |
K.conc |
-E |
dNTP.conc |
-E |
DMSO.conc |
-E |
formamide.conc |
-E |
size.threshold |
-T |
self |
-self |
correction.factor |
-F |
method.approx |
-am |
method.nn |
-nn |
method.GU |
-GU |
method.singleMM |
-sinMM |
method.tandemMM |
-tanMM |
method.single.dangle |
-sinDE |
method.double.dangle |
-secDE |
method.long.dangle |
-lonDE |
method.internal.loop |
-intLP |
method.single.bulge.loop |
-sinBU |
method.long.bulge.loop |
-lonBU |
method.CNG |
-CNG |
method.inosine |
-ino |
method.hydroxyadenine |
-ha |
method.azobenzenes |
-azo |
method.locked |
-lck |
method.consecutive.locked |
-tanLck |
method.consecutive.locked.singleMM |
-sinMMLck |
correction.ion |
-ion |
method.Naeq |
-naeq |
Melting temperature for multiple nucleic acid duplexes can be
computed using the meltingBatch function.
sequence <- c("CAAAAAG", "CAAAAAAG", "TTTTATAATAAA", "CCATCGCTACC",
"CAAACAAAG", "CCATTGCTACC", "CAAAAAAAG", "GTGAAC", "AAAAAAAA",
"CAACTTGATATTATTA", "CAAATAAAG", "GCGAGC", "GGGACC",
"CAAAGAAAG", "CTGACAAGTGTC", "GCGAAAAGCG")
meltingBatch(sequence, nucleic.acid.conc = 0.0004,
hybridisation.type = "dnadna", Na.conc = 1)## Environment.Sequence Environment.Complementary sequence
## [1,] "CAAAAAG" "GTTTTTC"
## [2,] "CAAAAAAG" "GTTTTTTC"
## [3,] "TTTTATAATAAA" "AAAATATTATTT"
## [4,] "CCATCGCTACC" "GGTAGCGATGG"
## [5,] "CAAACAAAG" "GTTTGTTTC"
## [6,] "CCATTGCTACC" "GGTAACGATGG"
## [7,] "CAAAAAAAG" "GTTTTTTTC"
## [8,] "GTGAAC" "CACTTG"
## [9,] "AAAAAAAA" "TTTTTTTT"
## [10,] "CAACTTGATATTATTA" "GTTGAACTATAATAAT"
## [11,] "CAAATAAAG" "GTTTATTTC"
## [12,] "GCGAGC" "CGCTCG"
## [13,] "GGGACC" "CCCTGG"
## [14,] "CAAAGAAAG" "GTTTCTTTC"
## [15,] "CTGACAAGTGTC" "GACTGTTCACAG"
## [16,] "GCGAAAAGCG" "CGCTTTTCGC"
## Environment.Nucleic acid concentration (M) Environment.Hybridization type
## [1,] "4e-04" "dnadna"
## [2,] "4e-04" "dnadna"
## [3,] "4e-04" "dnadna"
## [4,] "4e-04" "dnadna"
## [5,] "4e-04" "dnadna"
## [6,] "4e-04" "dnadna"
## [7,] "4e-04" "dnadna"
## [8,] "4e-04" "dnadna"
## [9,] "4e-04" "dnadna"
## [10,] "4e-04" "dnadna"
## [11,] "4e-04" "dnadna"
## [12,] "4e-04" "dnadna"
## [13,] "4e-04" "dnadna"
## [14,] "4e-04" "dnadna"
## [15,] "4e-04" "dnadna"
## [16,] "4e-04" "dnadna"
## Environment.Na concentration (M) Environment.Mg concentration (M)
## [1,] "1" "0"
## [2,] "1" "0"
## [3,] "1" "0"
## [4,] "1" "0"
## [5,] "1" "0"
## [6,] "1" "0"
## [7,] "1" "0"
## [8,] "1" "0"
## [9,] "1" "0"
## [10,] "1" "0"
## [11,] "1" "0"
## [12,] "1" "0"
## [13,] "1" "0"
## [14,] "1" "0"
## [15,] "1" "0"
## [16,] "1" "0"
## Environment.Tris concentration (M) Environment.K concentration (M)
## [1,] "0" "0"
## [2,] "0" "0"
## [3,] "0" "0"
## [4,] "0" "0"
## [5,] "0" "0"
## [6,] "0" "0"
## [7,] "0" "0"
## [8,] "0" "0"
## [9,] "0" "0"
## [10,] "0" "0"
## [11,] "0" "0"
## [12,] "0" "0"
## [13,] "0" "0"
## [14,] "0" "0"
## [15,] "0" "0"
## [16,] "0" "0"
## Environment.dNTP concentration (M) Environment.DMSO concentration (%)
## [1,] "0" "0"
## [2,] "0" "0"
## [3,] "0" "0"
## [4,] "0" "0"
## [5,] "0" "0"
## [6,] "0" "0"
## [7,] "0" "0"
## [8,] "0" "0"
## [9,] "0" "0"
## [10,] "0" "0"
## [11,] "0" "0"
## [12,] "0" "0"
## [13,] "0" "0"
## [14,] "0" "0"
## [15,] "0" "0"
## [16,] "0" "0"
## Environment.Formamide concentration (M or %)
## [1,] "0"
## [2,] "0"
## [3,] "0"
## [4,] "0"
## [5,] "0"
## [6,] "0"
## [7,] "0"
## [8,] "0"
## [9,] "0"
## [10,] "0"
## [11,] "0"
## [12,] "0"
## [13,] "0"
## [14,] "0"
## [15,] "0"
## [16,] "0"
## Environment.Self complementarity Environment.Correction factor
## [1,] "FALSE" "4"
## [2,] "FALSE" "4"
## [3,] "FALSE" "4"
## [4,] "FALSE" "4"
## [5,] "FALSE" "4"
## [6,] "FALSE" "4"
## [7,] "FALSE" "4"
## [8,] "FALSE" "4"
## [9,] "FALSE" "4"
## [10,] "FALSE" "4"
## [11,] "FALSE" "4"
## [12,] "FALSE" "4"
## [13,] "FALSE" "4"
## [14,] "FALSE" "4"
## [15,] "FALSE" "4"
## [16,] "FALSE" "4"
## Options.Approximative formula Options.Nearest neighbour model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.GU model Options.Single mismatch model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Tandem mismatch model Options.Single dangling end model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Double dangling end model Options.Long dangling end model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Internal loop model Options.Single bulge loop model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Long bulge loop model Options.CNG repeats model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Inosine bases model Options.Hydroxyadenine bases model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Azobenzenes model Options.Locked nucleic acids model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Ion correction method Options.Na equivalence correction method
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.DMSO correction method Options.Formamide correction method
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Mode Results.Enthalpy (cal) Results.Entropy (cal)
## [1,] NA "-47700" "-138.1"
## [2,] NA "-55600" "-160.3"
## [3,] NA "-78800" "-229.7"
## [4,] NA "-83500" "-227"
## [5,] NA "-64600" "-183.2"
## [6,] NA "-81100" "-222.5"
## [7,] NA "-63500" "-182.5"
## [8,] NA "-41200" "-117.5"
## [9,] NA "-50700" "-147.2"
## [10,] NA "-113800" "-323.6"
## [11,] NA "-62100" "-179.8"
## [12,] NA "-46000" "-124.8"
## [13,] NA "-40400" "-109.9"
## [14,] NA "-63700" "-181.3"
## [15,] NA "-90400" "-249.5"
## [16,] NA "-80300" "-218.6"
## Results.Enthalpy (J) Results.Entropy (J) Results.Melting temperature (C)
## [1,] "-199386" "-577.258" "31.7814953255144"
## [2,] "-232408" "-670.054" "38.1103863719918"
## [3,] "-329384" "-960.146" "44.5553259145469"
## [4,] "-349030" "-948.86" "67.2098590318261"
## [5,] "-270028" "-765.776" "47.400072116762"
## [6,] "-338998" "-930.05" "63.6040550863501"
## [7,] "-265430" "-762.85" "43.0400604037136"
## [8,] "-172216" "-491.15" "30.1735038367475"
## [9,] "-211926" "-615.296" "33.1415226764116"
## [10,] "-475684" "-1352.648" "59.6680431282422"
## [11,] "-259578" "-751.564" "40.2828264688437"
## [12,] "-192280" "-521.664" "48.2393469411973"
## [13,] "-168872" "-459.382" "41.9123740666287"
## [14,] "-266266" "-757.834" "45.9425910944819"
## [15,] "-377872" "-1042.91" "64.379329012421"
## [16,] "-335654" "-913.748" "65.7707030297917"
## Message
## [1,] NA
## [2,] NA
## [3,] NA
## [4,] NA
## [5,] NA
## [6,] NA
## [7,] NA
## [8,] NA
## [9,] NA
## [10,] NA
## [11,] NA
## [12,] NA
## [13,] NA
## [14,] NA
## [15,] NA
## [16,] NA
Complementary sequences are computed by default, but need to be specified in case of mismatches, inosine(s) or hydroxyadenine(s) between the two strands.
seq <- c("GCAUACG", "CAGUAGGUC", "CGCUCGC", "GAGUGGAG", "GACAGGCUG",
"CAGUACGUC", "GACAUCCUG", "GACCACCUG", "CAGAAUGUC", "GCGUCGC",
"CGUCCGG", "GACUCUCUG", "CAGCUGGUC", "GACUAGCUG", "CUCUGCUC",
"GCGUCCG", "GUCCGCG", "CGAUCAC", "GACUACCUG", "GACGAUCUG")
comp.seq <- c("CGUUUGC", "GUCGGCCAG", "GCGUGCG", "CUCUUCUC", "CUGUGCGAC",
"GUCGGGCAG", "CUGUUGGAC", "CUGGGGGAC", "GUCUGGCAG", "CGCUGCG",
"GCUGGCC", "CUGAUAGAC", "GUCGUUCAG", "CUGAGCGAC", "GAGUUGAG",
"CGCUGGC", "CUGGCGC", "GCUUGUG", "CUGAGGGAC", "CUGCCAGAC")
meltingBatch(sequence = seq, comp.seq = comp.seq, nucleic.acid.conc = 0.0004,
hybridisation.type = "rnarna", Na.conc = 1,
method.singleMM = "tur06")## Environment.Sequence Environment.Complementary sequence
## [1,] "GCAUACG" "CGUUUGC"
## [2,] "CAGUAGGUC" "GUCGGCCAG"
## [3,] "CGCUCGC" "GCGUGCG"
## [4,] "GAGUGGAG" "CUCUUCUC"
## [5,] "GACAGGCUG" "CUGUGCGAC"
## [6,] "CAGUACGUC" "GUCGGGCAG"
## [7,] "GACAUCCUG" "CUGUUGGAC"
## [8,] "GACCACCUG" "CUGGGGGAC"
## [9,] "CAGAAUGUC" "GUCUGGCAG"
## [10,] "GCGUCGC" "CGCUGCG"
## [11,] "CGUCCGG" "GCUGGCC"
## [12,] "GACUCUCUG" "CUGAUAGAC"
## [13,] "CAGCUGGUC" "GUCGUUCAG"
## [14,] "GACUAGCUG" "CUGAGCGAC"
## [15,] "CUCUGCUC" "GAGUUGAG"
## [16,] "GCGUCCG" "CGCUGGC"
## [17,] "GUCCGCG" "CUGGCGC"
## [18,] "CGAUCAC" "GCUUGUG"
## [19,] "GACUACCUG" "CUGAGGGAC"
## [20,] "GACGAUCUG" "CUGCCAGAC"
## Environment.Nucleic acid concentration (M) Environment.Hybridization type
## [1,] "4e-04" "rnarna"
## [2,] "4e-04" "rnarna"
## [3,] "4e-04" "rnarna"
## [4,] "4e-04" "rnarna"
## [5,] "4e-04" "rnarna"
## [6,] "4e-04" "rnarna"
## [7,] "4e-04" "rnarna"
## [8,] "4e-04" "rnarna"
## [9,] "4e-04" "rnarna"
## [10,] "4e-04" "rnarna"
## [11,] "4e-04" "rnarna"
## [12,] "4e-04" "rnarna"
## [13,] "4e-04" "rnarna"
## [14,] "4e-04" "rnarna"
## [15,] "4e-04" "rnarna"
## [16,] "4e-04" "rnarna"
## [17,] "4e-04" "rnarna"
## [18,] "4e-04" "rnarna"
## [19,] "4e-04" "rnarna"
## [20,] "4e-04" "rnarna"
## Environment.Na concentration (M) Environment.Mg concentration (M)
## [1,] "1" "0"
## [2,] "1" "0"
## [3,] "1" "0"
## [4,] "1" "0"
## [5,] "1" "0"
## [6,] "1" "0"
## [7,] "1" "0"
## [8,] "1" "0"
## [9,] "1" "0"
## [10,] "1" "0"
## [11,] "1" "0"
## [12,] "1" "0"
## [13,] "1" "0"
## [14,] "1" "0"
## [15,] "1" "0"
## [16,] "1" "0"
## [17,] "1" "0"
## [18,] "1" "0"
## [19,] "1" "0"
## [20,] "1" "0"
## Environment.Tris concentration (M) Environment.K concentration (M)
## [1,] "0" "0"
## [2,] "0" "0"
## [3,] "0" "0"
## [4,] "0" "0"
## [5,] "0" "0"
## [6,] "0" "0"
## [7,] "0" "0"
## [8,] "0" "0"
## [9,] "0" "0"
## [10,] "0" "0"
## [11,] "0" "0"
## [12,] "0" "0"
## [13,] "0" "0"
## [14,] "0" "0"
## [15,] "0" "0"
## [16,] "0" "0"
## [17,] "0" "0"
## [18,] "0" "0"
## [19,] "0" "0"
## [20,] "0" "0"
## Environment.dNTP concentration (M) Environment.DMSO concentration (%)
## [1,] "0" "0"
## [2,] "0" "0"
## [3,] "0" "0"
## [4,] "0" "0"
## [5,] "0" "0"
## [6,] "0" "0"
## [7,] "0" "0"
## [8,] "0" "0"
## [9,] "0" "0"
## [10,] "0" "0"
## [11,] "0" "0"
## [12,] "0" "0"
## [13,] "0" "0"
## [14,] "0" "0"
## [15,] "0" "0"
## [16,] "0" "0"
## [17,] "0" "0"
## [18,] "0" "0"
## [19,] "0" "0"
## [20,] "0" "0"
## Environment.Formamide concentration (M or %)
## [1,] "0"
## [2,] "0"
## [3,] "0"
## [4,] "0"
## [5,] "0"
## [6,] "0"
## [7,] "0"
## [8,] "0"
## [9,] "0"
## [10,] "0"
## [11,] "0"
## [12,] "0"
## [13,] "0"
## [14,] "0"
## [15,] "0"
## [16,] "0"
## [17,] "0"
## [18,] "0"
## [19,] "0"
## [20,] "0"
## Environment.Self complementarity Environment.Correction factor
## [1,] "FALSE" "4"
## [2,] "FALSE" "4"
## [3,] "FALSE" "4"
## [4,] "FALSE" "4"
## [5,] "FALSE" "4"
## [6,] "FALSE" "4"
## [7,] "FALSE" "4"
## [8,] "FALSE" "4"
## [9,] "FALSE" "4"
## [10,] "FALSE" "4"
## [11,] "FALSE" "4"
## [12,] "FALSE" "4"
## [13,] "FALSE" "4"
## [14,] "FALSE" "4"
## [15,] "FALSE" "4"
## [16,] "FALSE" "4"
## [17,] "FALSE" "4"
## [18,] "FALSE" "4"
## [19,] "FALSE" "4"
## [20,] "FALSE" "4"
## Options.Approximative formula Options.Nearest neighbour model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.GU model Options.Single mismatch model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Tandem mismatch model Options.Single dangling end model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Double dangling end model Options.Long dangling end model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Internal loop model Options.Single bulge loop model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Long bulge loop model Options.CNG repeats model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Inosine bases model Options.Hydroxyadenine bases model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Azobenzenes model Options.Locked nucleic acids model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Ion correction method Options.Na equivalence correction method
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.DMSO correction method Options.Formamide correction method
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Mode Results.Enthalpy (cal) Results.Entropy (cal)
## [1,] NA "-47650" "-138.8"
## [2,] NA "-71130" "-200.5"
## [3,] NA "-57930" "-164.1"
## [4,] NA "-60570" "-176.6"
## [5,] NA "-79870" "-219.9"
## [6,] NA "-68380" "-194.5"
## [7,] NA "-73880" "-208.3"
## [8,] NA "-78430" "-218.3"
## [9,] NA "-59650" "-171.5"
## [10,] NA "-61330" "-173.8"
## [11,] NA "-58350" "-165.4"
## [12,] NA "-64570" "-184.7"
## [13,] NA "-70970" "-200.6"
## [14,] NA "-72010" "-203"
## [15,] NA "-58820" "-171"
## [16,] NA "-59840" "-169.6"
## [17,] NA "-59840" "-169.6"
## [18,] NA "-50210" "-148.3"
## [19,] NA "-70520" "-198.8"
## [20,] NA "-69730" "-198.2"
## Results.Enthalpy (J) Results.Entropy (J) Results.Melting temperature (C)
## [1,] "-199177" "-580.184" "30.1048299398322"
## [2,] "-297323.4" "-838.09" "51.8989532242754"
## [3,] "-242147.4" "-685.938" "44.3989325444856"
## [4,] "-253182.6" "-738.188" "37.5791954133529"
## [5,] "-333856.6" "-919.182" "62.1162425798375"
## [6,] "-285828.4" "-813.01" "48.141439592185"
## [7,] "-308818.4" "-870.694" "52.845957204839"
## [8,] "-327837.4" "-912.494" "58.2977096620104"
## [9,] "-249337" "-716.87" "41.08087522322"
## [10,] "-256359.4" "-726.484" "46.0633145887674"
## [11,] "-243903" "-691.372" "44.4380466975271"
## [12,] "-269902.6" "-772.046" "44.8840464672343"
## [13,] "-296654.6" "-838.508" "51.0196486690585"
## [14,] "-301001.8" "-848.54" "52.203376709706"
## [15,] "-245867.6" "-714.78" "37.5268181873443"
## [16,] "-250131.2" "-708.928" "45.2688421309843"
## [17,] "-250131.2" "-708.928" "45.2688421309843"
## [18,] "-209877.8" "-619.894" "28.1788644808993"
## [19,] "-294773.6" "-830.984" "51.6345164549562"
## [20,] "-291471.4" "-828.476" "48.8860141674642"
## Message
## [1,] NA
## [2,] NA
## [3,] NA
## [4,] NA
## [5,] NA
## [6,] NA
## [7,] NA
## [8,] NA
## [9,] NA
## [10,] NA
## [11,] NA
## [12,] NA
## [13,] NA
## [14,] NA
## [15,] NA
## [16,] NA
## [17,] NA
## [18,] NA
## [19,] NA
## [20,] NA
Further details about algorithm, formulae and methods are available in the MELTING 5 documentation.
rmelting## To cite the R package 'rmelting' in publications use:
##
## Aravind, J. and Krishna, G. K. (2026). rmelting: R Interface to
## MELTING 5. R package version 1.28.0,
## https://aravind-j.github.io/rmelting/.
##
## A BibTeX entry for LaTeX users is
##
## @Manual{,
## title = {rmelting: R Interface to MELTING 5},
## author = {J. Aravind and G. K. Krishna},
## year = {2026},
## note = {R package version 1.28.0 https://aravind-j.github.io/rmelting/},
## }
##
## This free and open-source software implements academic research by the
## authors and co-workers. If you use it, please support the project by
## citing the package.
## R version 4.6.0 (2026-04-24)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 24.04.4 LTS
##
## Matrix products: default
## BLAS: /usr/lib/x86_64-linux-gnu/openblas-pthread/libblas.so.3
## LAPACK: /usr/lib/x86_64-linux-gnu/openblas-pthread/libopenblasp-r0.3.26.so; LAPACK version 3.12.0
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=en_US.UTF-8
## [9] LC_ADDRESS=en_US.UTF-8 LC_TELEPHONE=en_US.UTF-8
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=en_US.UTF-8
##
## time zone: Etc/UTC
## tzcode source: system (glibc)
##
## attached base packages:
## [1] stats graphics grDevices utils datasets methods base
##
## other attached packages:
## [1] rmelting_1.28.0 readxl_1.5.0
##
## loaded via a namespace (and not attached):
## [1] vctrs_0.7.3 cli_3.6.6 knitr_1.51 rlang_1.2.0
## [5] xfun_0.57 jsonlite_2.0.0 rJava_1.0-18 glue_1.8.1
## [9] buildtools_1.0.0 htmltools_0.5.9 maketools_1.3.2 sys_3.4.3
## [13] sass_0.4.10 rmarkdown_2.31 pander_0.6.6 cellranger_1.1.0
## [17] evaluate_1.0.5 jquerylib_0.1.4 tibble_3.3.1 fastmap_1.2.0
## [21] yaml_2.3.12 lifecycle_1.0.5 compiler_4.6.0 Rcpp_1.1.1-1.1
## [25] pkgconfig_2.0.3 digest_0.6.39 R6_2.6.1 pillar_1.11.1
## [29] Rdpack_2.6.6 rbibutils_2.4.1 magrittr_2.0.5 bslib_0.11.0
## [33] tools_4.6.0 cachem_1.1.0