Package 'rmelting'

Title: R Interface to MELTING 5
Description: R interface to the MELTING 5 program (https://www.ebi.ac.uk/biomodels/tools/melting/) to compute melting temperatures of nucleic acid duplexes along with other thermodynamic parameters.
Authors: J. Aravind [aut, cre] (ORCID: <https://orcid.org/0000-0002-4791-442X>), G. K. Krishna [aut], Bob Rudis [ctb] (melting5jars), Nicolas Le Novère [ctb] (MELTING 5 Java Library), Marine Dumousseau [ctb] (MELTING 5 Java Library), William John Gowers [ctb] (MELTING 5 Java Library)
Maintainer: J. Aravind <[email protected]>
License: GPL-2 | GPL-3
Version: 1.28.0
Built: 2026-05-30 11:00:42 UTC
Source: https://github.com/bioc/rmelting

Help Index


Compute melting temperature of a nucleic acid duplex

Description

Compute the enthalpy and entropy of helix-coil transition, and then the melting temperature of a nucleic acid duplex with the MELTING 5 software (Le Novère, 2001; Dumousseau et al., 2012).

Usage

melting(sequence, comp.sequence = NULL,
        nucleic.acid.conc,
        hybridisation.type = c("dnadna", "rnarna", "dnarna",
                               "rnadna", "mrnarna", "rnamrna"),
        Na.conc, Mg.conc, Tris.conc, K.conc,
        dNTP.conc, DMSO.conc, formamide.conc,
        size.threshold = 60, force.self = FALSE, correction.factor,
        method.approx = c("ahs01", "che93", "che93corr",
                          "schdot", "owe69", "san98",
                          "wetdna91", "wetrna91", "wetdnarna91"),
        method.nn = c("all97", "bre86", "san04", "san96", "sug96",
                      "tan04", "fre86", "xia98", "sug95", "tur06"),
        method.GU = c("tur99", "ser12"),
        method.singleMM = c("allsanpey", "tur06", "zno07", "zno08", "wat11"),
        method.tandemMM = c("allsanpey", "tur99"),
        method.single.dangle = c("bom00", "sugdna02", "sugrna02", "ser08"),
        method.double.dangle = c("sugdna02", "sugrna02", "ser05", "ser06"),
        method.long.dangle = c("sugdna02", "sugrna02"),
        method.internal.loop = c("san04", "tur06", "zno07"),
        method.single.bulge.loop = c("tan04", "san04", "ser07" ,"tur06"),
        method.long.bulge.loop = c("san04", "tur06"),
        method.CNG = c("bro05"),
        method.inosine = c("san05", "zno07"),
        method.hydroxyadenine = c("sug01"),
        method.azobenzenes = c("asa05"),
        method.locked = c("owc11", "mct04"),
        method.consecutive.locked = c("owc11"),
        method.consecutive.locked.singleMM = c("owc11"),
        correction.ion = c("ahs01", "kam71", "marschdot",
                           "owc1904", "owc2004", "owc2104",
                           "owc2204", "san96", "san04", "schlif",
                           "tanna06", "tanna07", "wet91",
                           "owcmg08", "tanmg06", "tanmg07",
                           "owcmix08", "tanmix07"),
        method.Naeq = c("ahs01", "mit96", "pey00"),
        correction.DMSO = c("ahs01", "cul76", "esc80", "mus81"),
        correction.formamide = c("bla96", "lincorr"))

Arguments

sequence

Sequence (5' to 3') of one strand of the nucleic acid duplex as a character string (Note: Uridine and thymidine are not considered as identical).

comp.sequence

Complementary sequence (3' to 5') of the nucleic acid duplex as a character string.

nucleic.acid.conc

Concentration of the nucleic acid strand (M or mol L-1) in excess as a numeric value.

hybridisation.type

The hybridisation type. Either "dnadna", "rnarna", "dnarna", "rnadna", "mrnarna" or "rnamrna" (see Hybridisation type options).

Na.conc

Concentration of Na ions (M) as a positive numeric value (see Ion and agent concentrations).

Mg.conc

Concentration of Mg ions (M) as a positive numeric value (see Ion and agent concentrations).

Tris.conc

Concentration of Tris ions (M) as a positive numeric value (see Ion and agent concentrations).

K.conc

Concentration of K ions (M) as a positive numeric value (see Ion and agent concentrations).

dNTP.conc

Concentration of dNTP (M) as a positive numeric value (see Ion and agent concentrations).

DMSO.conc

Concentration of DMSO (%) as a positive numeric value (see Ion and agent concentrations).

formamide.conc

Concentration of formamide (M or % depending on correction method) as a positive numeric value (see Ion and agent concentrations).

size.threshold

Sequence length threshold to decide approximative or nearest-neighbour approach for computation. Default is 60.

force.self

logical. Enforces that sequence is self complementary and complementary sequence is not required (seed Self complementary sequences). Default is FALSE.

correction.factor

Correction factor to be used to modulate the effect of the nucleic acid concentration (nucleic.acid.conc) in the computation of melting temperature (see Correction factor for nucleic acid concentration).

method.approx

Specify the approximative formula to be used for melting temperature calculation for sequences of length greater than size.threshold. Either "ahs01", "che93", "che93corr", "schdot", "owe69", "san98", "wetdna91", "wetrna91" or "wetdnarna91" (see Approximative formulas).

method.nn

Specify the nearest neighbor model to be used for melting temperature calculation for perfectly matching sequences of length lesser than size.threshold. Either "all97", "bre86", "san04", "san96", "sug96", "tan04", "fre86", "xia98", "sug95" or "tur06" (see Perfectly matching sequences).

method.GU

Specify the nearest neighbor model to compute the contribution of GU base pairs to the thermodynamic of helix-coil transition. Either "tur99" or "ser12" (see GU wobble base pairs effect).

method.singleMM

Specify the nearest neighbor model to compute the contribution of single mismatch to the thermodynamic of helix-coil transition. Either "allsanpey", "tur06", "zno07" "zno08" or "wat11" (see Single mismatch effect).

method.tandemMM

Specify the nearest neighbor model to compute the contribution of tandem mismatches to the thermodynamic of helix-coil transition. Either "allsanpey" or "tur99" (see Tandem mismatches effect).

method.single.dangle

Specify the nearest neighbor model to compute the contribution of single dangling end to the thermodynamic of helix-coil transition. Either "bom00", "sugdna02", "sugrna02" or "ser08" (see Single dangling end effect).

method.double.dangle

Specify the nearest neighbor model to compute the contribution of double dangling end to the thermodynamic of helix-coil transition. Either "sugdna02", "sugrna02", "ser05" or "ser06" (see Double dangling end effect).

method.long.dangle

Specify the nearest neighbor model to compute the contribution of long dangling end to the thermodynamic of helix-coil transition. Either "sugdna02" or "sugrna02" (see Long dangling end effect).

method.internal.loop

Specify the nearest neighbor model to compute the contribution of internal loop to the thermodynamic of helix-coil transition. Either "san04", "tur06" or "zno07" (see Internal loop effect).

method.single.bulge.loop

Specify the nearest neighbor model to compute the contribution of single bulge loop to the thermodynamic of helix-coil transition. Either "san04", "tan04", "ser07" or "tur06" (see Single bulge loop effect).

method.long.bulge.loop

Specify the nearest neighbor model to compute the contribution of long bulge loop to the thermodynamic of helix-coil transition. Either "san04" or "tur06" (see Long bulge loop effect).

method.CNG

Specify the nearest neighbor model to compute the contribution of CNG repeats to the thermodynamic of helix-coil transition. Available method is "bro05" (see CNG repeats effect).

method.inosine

Specify the specific nearest neighbor model to compute the contribution of inosine bases (I) to the thermodynamic of helix-coil transition. Either "san05" or "zno07" (see Inosine bases effect).

method.hydroxyadenine

Specify the nearest neighbor model to compute the contribution of hydroxyadenine bases (A*) to the thermodynamic of helix-coil transition. Available method is "sug01" (see Hydroxyadenine bases effect).

method.azobenzenes

Specify the nearest neighbor model to compute the contribution of azobenzenes (X_T for trans azobenzenes and X_C for cis azobenzenes) to the thermodynamic of helix-coil transition. Available method is "asa05" (see Azobenzenes effect).

method.locked

Specify the nearest neighbor model to compute the contribution of single locked nucleic acids (AL, GL, TL and CL) to the thermodynamic of helix-coil transition. Either "owc11" or "mct04" (see Single locked nucleic acids effect).

method.consecutive.locked

Specify the nearest neighbor model to compute the contribution of consecutive locked nucleic acids (AL, GL, TL and CL) to the thermodynamic of helix-coil transition. Available method is "owc11" (see Consecutive locked nucleic acids effect).

method.consecutive.locked.singleMM

Specify the nearest neighbor model to compute the contribution of consecutive locked nucleic acids (AL, GL, TL and CL) with a single mismatch to the thermodynamic of helix-coil transition. Available method is "owc11" (see Consecutive locked nucleic acids with single mismatch effect).

correction.ion

Specify the correction method for ions. Either one of the following:

  • Na corrections"ahs01", "kam71", "owc1904", "owc2004", "owc2104", "owc2204", "san96", "san04", "schlif", "tanna06", "wetdna91", "tanna07", "wetrna91" or "wetdnarna91" (see Sodium corrections)

  • Mg corrections"owcmg08", "tanmg06" or "tanmg07" (see Magnesium corrections)

  • Mixed Na Mg corrections"owcmix08", "tanmix07" or "tanmix07" (see Mixed Sodium and Magnesium corrections)

.

method.Naeq

Specify the ion correction which gives a sodium equivalent concentration if other cations are present. Either "ahs01", "mit96" or "pey00" (see Sodium equivalent concentration methods).

correction.DMSO

Specify the correction method for DMSO. Specify the correction method for DMSO. Either "ahs01", "mus81", "cul76" or "esc80" (see DMSO corrections).

correction.formamide

Specify the correction method for formamide. Specify the correction method for formamide Either "bla96" or "lincorr" (see Formamide corrections).

Value

A list with the following components:

Environment

A list with details about the melting temperature computation environment.

Options

A list with details about the options (default or user specified) used for melting temperature computation.

Results

A list with the results of the melting temperature computation including the enthalpy and entropy in case of nearest neighbour methods.

Message

Error and/or Warning messages, if any.

Mandatory arguments

The following are the arguments which are mandatory for computation.

sequence

5' to 3' sequence of one strand of the nucleic acid duplex as a character string. Recognises A, C, G, T, U, I, X_C, X_T, A*, AL, TL, GL and CL. U and T are not considered identical (see Recognized nucleotides).

comp.sequence

Mandatory if there are mismatches, inosine(s) or hydroxyadenine(s) between the two strands. If not specified, it is computed as the complement of sequence. Self-complementarity in sequence is detected even though there may be (are) dangling end(s) and comp.sequence is computed (see Self complementary sequences).

nucleic.acid.conc

See Correction factor for nucleic acid concentration.

Na.conc, Mg.conc, Tris.conc, K.conc

At least one cation (Na, Mg, Tris, K) concentration is mandatory, the other agents(dNTP, DMSO, formamide) are optional (see Ion and agent concentrations).

hybridisation.type

See Hybridisation type options.

Recognized nucleotides

Code Type
A Adenine
C Cytosine
G Guanine
T Thymine
U Uracil
I Inosine
X_C Trans azobenzenes
X_T Cis azobenzenes
A* Hydroxyadenine
AL Locked nucleic acid
TL "
GL "
CL "

U and T are not considered identical.

Hybridisation type options

The details of the possible options for hybridisation type specified in the argument hybridisation.type are as follows:

Option Sequence Complementary sequence
dnadna DNA DNA
rnarna RNA RNA
dnarna DNA RNA
rnadna RNA DNA
mrnarna 2-o-methyl RNA RNA
rnamrna RNA 2-o-methyl RNA

This parameter determines the nature of the sequences in the arguments sequence and comp.sequence.

Ion and agent concentrations

Ion concentrations are specified by the arguments Na.conc, Mg.conc, Tris.conc and K.conc, while agent concentrations are specified by the arguments dNTP.conc, DMSO.conc and formamide.conc.

These values are used for different correction functions which approximately adjusts for effects of these ions (Na, Mg, Tris, K) and/or agents (dNTP, DMSO, formamide) on on thermodynamic stability of nucleic acid duplexes. Their concentration limits depends on the correction method used. All the concentrations must be in M, except for the DMSO (%) and formamide (% or M depending on the correction method). Note that [Tris+] is about half of the total tris buffer concentration.

Self complementary sequences

Self complementarity for perfect matching sequences or sequences with dangling ends is detected automatically. However it can be enforced by the argument force.self = TRUE.

Correction factor for nucleic acid concentration

For self complementary sequences (Auto detected or specified by force.self) it is 1. Otherwise it is 4 if the both strands are present in equivalent amount and 1 if one strand is in excess.

Approximative estimation formulas

Formula Type Limits/Remarks Reference
ahs01 DNA No mismatch von Ahsen et al., 2001
che93 DNA No mismatch; Na=0, Mg=0.0015, Marmur and Doty, 1962
Tris=0.01, K=0.05
che93corr DNA No mismatch; Na=0, Mg=0.0015, Marmur and Doty, 1962
Tris=0.01, K=0.05
schdot DNA No mismatch Wetmur, 1991; Marmur and
Doty, 1962; Chester and
Marshak, 1993; Schildkraut
and Lifson, 1965; Wahl et
al., 1987; Britten et al.,
1974; Hall et al., 1980
owe69 DNA No mismatch Owen et al., 1969;
Frank-Kamenetskii, 1971;
Blake, 1996; Blake and
Delcourt, 1998
san98 DNA No mismatch SantaLucia, 1998; von Ahsen
et al., 2001
wetdna91* DNA Wetmur, 1991
wetrna91* RNA Wetmur, 1991
wetdnarna91* DNA/RNA Wetmur, 1991

* Default formula for computation.

Note that calculation is increasingly incorrect when the length of the duplex decreases. Further, it does not take into account nucleic acid concentration.

Nearest neighbor models

Perfectly matching sequences

Model Type Limits/Remarks Reference
all97* DNA Allawi and SantaLucia, 1997
tur06* 2'-O-MeRNA/ A sodium correction Kierzek et al., 2006
RNA (san04) is
automatically applied to
convert the entropy (Na =
0.1M) into the entropy (Na =
1M).
bre86 DNA Breslauer et al., 1986
san04 DNA SantaLucia and Hicks, 2004
san96 DNA SantaLucia et al., 1996
sug96 DNA Sugimoto et al., 1996
tan04 DNA Tanaka et al., 2004
fre86 RNA Freier et al., 1986
xia98* RNA Xia et al., 1998
sug95* DNA/ SantaLucia et al., 1996
RNA

* Default model for computation.

GU wobble base pairs effect

Model Type Limits/Remarks Reference
tur99 RNA Mathews et al., 1999
ser12* RNA Chen et al., 2012

* Default model for computation.

GU base pairs are not taken into account by the approximative mode.

Single mismatch effect

Model Type Limits.Remarks Reference
allsanpey* DNA Allawi and SantaLucia, 1997;
Allawi and SantaLucia, 1998;
Allawi and SantaLucia, 1998;
Allawi and SantaLucia, 1998;
Peyret et al., 1999
wat11* DNA/RNA Watkins et al., 2011
tur06 RNA Lu et al., 2006
zno07* RNA Davis and Znosko, 2007
zno08 RNA At least one adjacent GU base Davis and Znosko, 2008
pair.

* Default model for computation.

Single mismatches are not taken into account by the approximative mode.

Tandem mismatches effect

Model Type Limits.Remarks Reference
allsanpey* DNA Only GT mismatches and TA/TG Allawi and SantaLucia, 1997;
mismatches. Allawi and SantaLucia, 1998;
Allawi and SantaLucia, 1998;
Allawi and SantaLucia, 1998;
Peyret et al., 1999
tur99* RNA No adjacent GU or UG base Mathews et al., 1999; Lu et
pairs. al., 2006

* Default model for computation.

Tandem mismatches are not taken into account by the approximative mode. Note that not all the mismatched Crick's pairs have been investigated.

Single dangling end effect

Model Type Limits.Remarks Reference
bom00* DNA Bommarito et al., 2000
sugdna02 DNA Only terminal poly A self Ohmichi et al., 2002
complementary sequences.
sugrna02 RNA Only terminal poly A self Ohmichi et al., 2002
complementary sequences.
ser08* RNA Only 3' UA, GU and UG O'Toole et al., 2006; Miller
terminal base pairs only 5' et al., 2008
UG and GU terminal base
pairs.

* Default model for computation.

Single dangling ends are not taken into account by the approximative mode.

Double dangling end effect

Model Type Limits/Remarks Reference
sugdna02* DNA Only terminal poly A self Ohmichi et al., 2002
complementary sequences.
sugrna02 RNA Only terminal poly A self Ohmichi et al., 2002
complementary sequences.
ser05 RNA Depends on the available O'Toole et al., 2005
thermodynamic parameters for
single dangling end.
ser06* RNA O'Toole et al., 2006

* Default model for computation.

Double dangling ends are not taken into account by the approximative mode.

Long dangling end effect

Model Type Limits/Remarks Reference
sugdna02* DNA Only terminal poly A self Ohmichi et al., 2002
complementary sequences.
sugrna02* RNA Only terminal poly A self Ohmichi et al., 2002
complementary sequences.

* Default model for computation.

Long dangling ends are not taken into account by the approximative mode.

Internal loop effect

Model Type Limits.Remarks Reference
san04* DNA Missing asymmetry penalty. SantaLucia and Hicks, 2004
Not tested with experimental
results.
tur06 RNA Not tested with experimental Lu et al., 2006
results.
zno07* RNA Only for 1x2 loop. Badhwar et al., 2007

* Default model for computation.

Internal loops are not taken into account by the approximative mode.

Single bulge loop effect

Model Type Limits/Remarks Reference
tan04* DNA Tan and Chen, 2007
san04 DNA Missing closing AT penalty. SantaLucia and Hicks, 2004
ser07 RNA Less reliable results. Some Blose et al., 2007
missing parameters.
tur06* RNA Lu et al., 2006

* Default model for computation.

Single bulge loops are not taken into account by the approximative mode.

Long bulge loop effect

Model Type Limits.Remarks Reference
san04* DNA Missing closing AT penalty. SantaLucia and Hicks, 2004
tur06* RNA Not tested with experimental Mathews et al., 1999; Lu et
results. al., 2006

* Default model for computation.

Long bulge loops are not taken into account by the approximative mode.

CNG repeats effect

Model Type Limits/Remarks Reference
bro05* RNA Self complementary sequences. Broda et al., 2005
2 to 7 CNG repeats.

* Default model for computation.

CNG repeats are not taken into account by the approximative mode. The contribution of CNG repeats to the thermodynamic of helix-coil transition can be computed only for 2 to 7 CNG repeats. N represents a single mismatch of type N/N.

Inosine bases effect

Model Type Limits/Remarks Reference
san05* DNA Missing parameters for tandem Watkins and SantaLucia, 2005
base pairs containing inosine
bases.
zno07* RNA Only IU base pairs. Wright et al., 2007

* Default model for computation.

Inosine bases (I) are not taken into account by the approximative mode.

Hydroxyadenine bases effect

Model Type Limits/Remarks Reference
sug01* DNA Only 5' GA*C 3'and 5' TA*A 3' Kawakami et al., 2001
contexts.

* Default model for computation.

Hydroxyadenine bases (A*) are not taken into account by the approximative mode.

Azobenzenes effect effect

Model Type Limits/Remarks Reference
asa05* DNA Less reliable results when Asanuma et al., 2005
the number of cis azobenzene
increases.

* Default model for computation.

Azobenzenes (X_T for trans azobenzenes and X_C for cis azobenzenes) are not taken into account by the approximative mode.

Single locked nucleic acids effect

Model Type Limits.Remarks Reference
mct04 DNA McTigue, Peterson, and Kahn,
2004
owc11* DNA Owczarzy, You, Groth, and
Tataurov, 2011

* Default model for computation.

Locked nucleic acids (AL, GL, TL and CL) are not taken into account by the approximative mode.

Consecutive locked nucleic acids effect

Model Type Limits.Remarks Reference
owc11* DNA Owczarzy et al., 2011

* Default model for computation.

Locked nucleic acids (AL, GL, TL and CL) are not taken into account by the approximative mode.

Consecutive locked nucleic acids with single mismatch effect

Model Type Limits.Remarks Reference
owc11* DNA Owczarzy et al., 2011

* Default model for computation.

Locked nucleic acids (AL, GL, TL and CL) are not taken into account by the approximative mode.

Ion corrections

Sodium corrections

Correction Type Limits.Remarks Reference
ahs01 DNA Na>0. von Ahsen et al., 2001
schlif DNA Na>=0.07; Na<=0.12. Schildkraut and Lifson, 1965
tanna06 DNA Na>=0.001; Na<=1. Tan and Chen, 2006
tanna07* RNA Na>=0.003; Na<=1. Tan and Chen, 2007
or
2'-O-MeRNA/RNA
wet91 RNA, Na>0. Wetmur, 1991
DNA
and
RNA/DNA
kam71 DNA Na>0; Na>=0.069; Na<=1.02. Frank-Kamenetskii, 1971
marschdot DNA Na>=0.069; Na<=1.02. Marmur and Doty, 1962; Blake
and Delcourt, 1998
owc1904 DNA Na>0. (equation 19) Owczarzy et al., 2004
owc2004 DNA Na>0. (equation 20) Owczarzy et al., 2004
owc2104 DNA Na>0. (equation 21) Owczarzy et al., 2004
owc2204* DNA Na>0. (equation 22) Owczarzy et al., 2004
san96 DNA Na>=0.1. SantaLucia et al., 1996
san04 DNA Na>=0.05; Na<=1.1; SantaLucia and Hicks, 2004;
Oligonucleotides inferior to SantaLucia, 1998
16 bases.

* Default correction method for computation.

Magnesium corrections

Correction Type Limits/Remarks Reference
owcmg08* DNA Mg>=0.0005; Mg<=0.6. Owczarzy et al., 2008
tanmg06 DNA Mg>=0.0001; Mg<=1; Oligomer Tan and Chen, 2006
length superior to 6 base
pairs.
tanmg07* RNA Mg>=0.1; Mg<=0.3. Tan and Chen, 2007

* Default correction method for computation.

Mixed Sodium and Magnesium corrections

Correction Type Limits.Remarks Reference
owcmix08* DNA Mg>=0.0005; Mg<=0.6; Owczarzy et al., 2008
Na+K+Tris/2>0.
tanmix07 DNA, Mg>=0.1; Mg<=0.3; Tan and Chen, 2007
RNA Na+K+Tris/2>=0.1;
or Na+K+Tris/2<=0.3.
2'-O-MeRNA/RNA

* Default correction method for computation.

The ion correction by Owczarzy et al. (2008) is used by default according to the [Mg2+]0.5 ⁄ [Mon+] ratio, where [Mon+] = [Na+] &plus; [Tris+] &plus; [K+] .

If,

[Mon+] = 0

Default sodium correction is used.

Ratio < 0.22,

Default sodium correction is used.

0.22 <= Ratio < 6

Default mixed Na and Mg correction is used.

Ratio >= 6

Default magnesium correction is used.

Note that [Tris+] is about half of the total tris buffer concentration.

Sodium equivalent concentration methods

Correction Type Limits/Remarks Reference
ahs01* DNA von Ahsen et al., 2001
mit96 DNA Mitsuhashi, 1996
pey00 DNA Peyret, 2000

* Default correction method for computation.

For the other types of hybridization, the DNA default correction is used. If there are other cations when an approximative approach is used, a sodium equivalence is automatically computed. In case of nearest neighbor approach, the sodium equivalence will be used only if a sodium correction is specified by the argument correction.ion.

Denaturing agent corrections

DMSO corrections

Correction Type Limits/Remarks Reference
ahs01* DNA Not tested with experimental von Ahsen et al., 2001
results.
cul76 DNA Not tested with experimental Cullen and Bick, 1976
results.
esc80 DNA Not tested with experimental Escara and Hutton, 1980
results.
mus81 DNA Not tested with experimental Musielski et al., 1981
results.

* Default correction method for computation.

For the other types of hybridization, the DNA default correction is used. If there is DMSO when an approximative approach is used, a DMSO correction is automatically computed. In case of nearest neighbor approach and approximative approach, the DMSO correction will be used only if a sodium correction is specified by the argument correction.ion.

Formamide corrections

Correction Type Limits/Remarks Reference
bla96* DNA With formamide concentration Blake, 1996
in mol/L.
lincorr DNA With a formamide volume. McConaughy et al., 1969;
Record, 1967; Casey and
Davidson, 1977; Hutton, 1977

* Default correction method for computation.

For the other types of hybridization, the DNA default correction is used. If there is formamide when an approximative approach is used, a formamide correction is automatically computed. In case of nearest neighbor approach and approximative approach, the formamide correction will be used only if a sodium correction is specified by the argument correction.ion.

References

Marmur J, Doty P (1962). “Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature.” Journal of Molecular Biology, 5(1), 109–118.

Schildkraut C, Lifson S (1965). “Dependence of the melting temperature of DNA on salt concentration.” Biopolymers, 3(2), 195–208.

Record MT (1967). “Electrostatic effects on polynucleotide transitions. I. Behavior at neutral pH.” Biopolymers, 5(10), 975–992.

McConaughy BL, Laird C, McCarthy BJ (1969). “Nucleic acid reassociation in formamide.” Biochemistry, 8(8), 3289–3295.

Owen RJ, Hill LR, Lapage SP (1969). “Determination of DNA base compositions from melting profiles in dilute buffers.” Biopolymers, 7(4), 503–516.

Frank-Kamenetskii MD (1971). “Simplification of the empirical relationship between melting temperature of DNA, its GC content and concentration of sodium ions in solution.” Biopolymers, 10(12), 2623–2624.

Britten RJ, Graham DE, Neufeld BR (1974). “Analysis of repeating DNA sequences by reassociation.” Methods in Enzymology, 29, 363–418.

Cullen BR, Bick MD (1976). “Thermal denaturation of DNA from bromodeoxyuridine substituted cells.” Nucleic Acids Research, 3(1), 49–62.

Hutton JR (1977). “Renaturation kinetics and thermal stability of DNA in aqueous solutions of formamide and urea.” Nucleic Acids Research, 4(10), 3537–3555.

Casey J, Davidson N (1977). “Rates of formation and thermal stabilities of RNA:DNA and DNA:DNA duplexes at high concentrations of formamide.” Nucleic Acids Research, 4(5), 1539–1552.

Hall TJ, Grula JW, Davidson EH, Britten RJ (1980). “Evolution of sea urchin non-repetitive DNA.” Journal of Molecular Evolution, 16(2), 95–110.

Escara JF, Hutton JR (1980). “Thermal stability and renaturation of DNA in dimethyl sulfoxide solutions: Acceleration of the renaturation rate.” Biopolymers, 19(7), 1315–1327.

Musielski H, Mann W, Laue R, Michel S (1981). “Influence of dimethylsulfoxide on transcription by bacteriophage T3-induced RNA polymerase.” Zeitschrift fur allgemeine Mikrobiologie, 21(6), 447–456.

Freier SM, Kierzek R, Jaeger JA, Sugimoto N, Caruthers MH, Neilson T, Turner DH (1986). “Improved free-energy parameters for predictions of RNA duplex stability.” Proceedings of the National Academy of Sciences, 83(24), 9373.

Breslauer KJ, Frank R, Blocker H, Marky LA (1986). “Predicting DNA duplex stability from the base sequence.” Proceedings of the National Academy of Sciences, 83(11), 3746.

Wahl GM, Barger SL, Kimmel AR (1987). “Molecular hybridization of immobilized nucleic acids: Theoretical concepts and practical considerations.” Methods in Enzymology, 152, 399–407.

Wetmur JG (1991). “DNA probes: Applications of the principles of nucleic acid hybridization.” Critical Reviews in Biochemistry and Molecular Biology, 26(3-4), 227–259.

Chester N, Marshak DR (1993). “Dimethyl sulfoxide-mediated primer Tm reduction: A method for analyzing the role of renaturation temperature in the polymerase chain reaction.” Analytical Biochemistry, 209(2), 284–290.

Sugimoto N, Katoh M, Nakano S, Ohmichi T, Sasaki M (1994). “RNA/DNA hybrid duplexes with identical nearest-neighbor base-pairs have identical stability.” FEBS Letters, 354(1), 74–78.

Sugimoto N, Nakano S, Katoh M, Matsumura A, Nakamuta H, Ohmichi T, Yoneyama M, Sasaki M (1995). “Thermodynamic parameters to predict stability of RNA/DNA hybrid duplexes.” Biochemistry, 34(35), 11211–11216.

SantaLucia J, Allawi HT, Seneviratne PA (1996). “Improved nearest-neighbor parameters for predicting DNA duplex stability.” Biochemistry, 35(11), 3555–3562.

Sugimoto N, Nakano S, Yoneyama M, Honda K (1996). “Improved thermodynamic parameters and helix initiation factor to predict stability of DNA duplexes.” Nucleic Acids Research, 24(22), 4501–4505.

Blake RD, Delcourt SG (1996). “Thermodynamic effects of formamide on DNA stability.” Nucleic Acids Research, 24(11), 2095–2103.

Blake RD (1996). “Denaturation of DNA.” In Meyers RA (ed.), Encyclopedia of molecular biology and molecular medicine, volume 2, 1–19. VCH Verlagsgesellschaft, Weinheim, Germany.

Mitsuhashi M (1996). “Technical report: Part 1. Basic requirements for designing optimal oligonucleotide probe sequences.” Journal of Clinical Laboratory Analysis, 10(5), 277–284.

Allawi HT, SantaLucia J (1997). “Thermodynamics and NMR of internal G·T mismatches in dna.” Biochemistry, 36(34), 10581–10594.

SantaLucia J (1998). “A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics.” Proceedings of the National Academy of Sciences, 95(4), 1460.

Xia T, SantaLucia J, Burkard ME, Kierzek R, Schroeder SJ, Jiao X, Cox C, Turner DH (1998). “Thermodynamic parameters for an expanded nearest-neighbor model for formation of RNA duplexes with Watson-Crick base pairs.” Biochemistry, 37(42), 14719–14735.

Allawi HT, SantaLucia J (1998). “Thermodynamics of internal C·T mismatches in DNA.” Nucleic Acids Research, 26(11), 2694–2701.

Blake RD, Delcourt SG (1998). “Thermal stability of DNA.” Nucleic Acids Research, 26(14), 3323–3332.

Allawi HT, SantaLucia J (1998). “Nearest neighbor thermodynamic parameters for internal G·A mismatches in DNA.” Biochemistry, 37(8), 2170–2179.

Allawi HT, SantaLucia J (1998). “Nearest-neighbor thermodynamics of internal A·C mismatches in dna: sequence dependence and pH effects.” Biochemistry, 37(26), 9435–9444.

Mathews DH, Sabina J, Zuker M, Turner DH (1999). “Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure.” Journal of Molecular Biology, 288(5), 911–940.

Peyret N, Seneviratne PA, Allawi HT, SantaLucia J (1999). “Nearest-Neighbor Thermodynamics and NMR of DNA Sequences with Internal A·A, C·C, G·G, and T·T Mismatches.” Biochemistry, 38(12), 3468–3477.

Peyret N (2000). Prediction of nucleic acid hybridization: Parameters and algorithms. Ph.D. Thesis, Wayne State University, Detroit, MI.

Bommarito S, Peyret N, SantaLucia J (2000). “Thermodynamic parameters for DNA sequences with dangling ends.” Nucleic Acids Research, 28(9), 1929–1934.

Kawakami J, Kamiya H, Yasuda K, Fujiki H, Kasai H, Sugimoto N (2001). “Thermodynamic stability of base pairs between 2-hydroxyadenine and incoming nucleotides as a determinant of nucleotide incorporation specificity during replication.” Nucleic Acids Research, 29(16), 3289–3296.

von Ahsen N, Wittwer CT, Schutz E (2001). “Oligonucleotide melting temperatures under PCR conditions: Nearest-neighbor corrections for Mg2+, deoxynucleotide triphosphate, and dimethyl sulfoxide concentrations with comparison to alternative empirical formulas.” Clinical Chemistry, 47(11), 1956–1961.

Le Novere N (2001). “MELTING, computing the melting temperature of nucleic acid duplex.” Bioinformatics, 17(12), 1226–1227.

Ohmichi T, Nakano S, Miyoshi D, Sugimoto N (2002). “Long RNA dangling end has large energetic contribution to duplex stability.” Journal of the American Chemical Society, 124(35), 10367–10372.

SantaLucia J, Hicks D (2004). “The thermodynamics of DNA structural motifs.” Annual Review of Biophysics and Biomolecular Structure, 33(1), 415–440.

Tanaka F, Kameda A, Yamamoto M, Ohuchi A (2004). “Thermodynamic parameters based on a nearest-neighbor model for DNA sequences with a single-bulge loop.” Biochemistry, 43(22), 7143–7150.

McTigue PM, Peterson RJ, Kahn JD (2004). “Sequence-dependent thermodynamic parameters for locked nucleic acid (LNA)-DNA duplex formation.” Biochemistry, 43(18), 5388–5405.

Owczarzy R, You Y, Groth CL, Tataurov AV (2011). “Stability and mismatch discrimination of locked nucleic acid-DNA duplexes.” Biochemistry, 50(43), 9352–9367.

Owczarzy R, You Y, Moreira BG, Manthey JA, Huang L, Behlke MA, Walder JA (2004). “Effects of sodium ions on DNA duplex oligomers: Improved predictions of melting temperatures.” Biochemistry, 43(12), 3537–3554.

Broda M, Kierzek E, Gdaniec Z, Kulinski T, Kierzek R (2005). “Thermodynamic stability of RNA structures formed by CNG trinucleotide repeats. Implication for prediction of RNA structure.” Biochemistry, 44(32), 10873–10882.

Watkins NE, SantaLucia J (2005). “Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes.” Nucleic Acids Research, 33(19), 6258–6267.

Asanuma H, Matsunaga D, Komiyama M (2005). “Clear-cut photo-regulation of the formation and dissociation of the DNA duplex by modified oligonucleotide involving multiple azobenzenes.” Nucleic Acids Symposium Series, 35–36. http://www.ncbi.nlm.nih.gov/pubmed/17150620.

O'Toole AS, Miller S, Serra MJ (2005). “Stability of 3' double nucleotide overhangs that model the 3' ends of siRNA.” RNA, 11(4), 512–516. http://www.ncbi.nlm.nih.gov/pubmed/15769878.

Lu ZJ, Turner DH, Mathews DH (2006). “A set of nearest neighbor parameters for predicting the enthalpy change of RNA secondary structure formation.” Nucleic Acids Research, 34(17), 4912–4924.

Kierzek E, Mathews DH, Ciesielska A, Turner DH, Kierzek R (2006). “Nearest neighbor parameters for Watson-Crick complementary heteroduplexes formed between 2'-O-methyl RNA and RNA oligonucleotides.” Nucleic Acids Research, 34(13), 3609–3614.

Tan Z, Chen S (2006). “Nucleic acid helix stability: Effects of salt concentration, cation valence and size, and chain length.” Biophysical Journal, 90(4), 1175–1190.

O'Toole AS, Miller S, Haines N, Zink MC, Serra MJ (2006). “Comprehensive thermodynamic analysis of 3' double-nucleotide overhangs neighboring Watson-Crick terminal base pairs.” Nucleic Acids Research, 34(11), 3338–3344.

Tan Z, Chen S (2007). “RNA helix stability in mixed Na(+)/Mg(2+) solution.” Biophysical Journal, 92(10), 3615–3632.

Wright DJ, Rice JL, Yanker DM, Znosko BM (2007). “Nearest neighbor parameters for inosine·uridine pairs in RNA duplexes.” Biochemistry, 46(15), 4625–4634.

Davis AR, Znosko BM (2007). “Thermodynamic characterization of single mismatches found in naturally occurring RNA.” Biochemistry, 46(46), 13425–13436.

Blose JM, Manni ML, Klapec KA, Stranger-Jones Y, Zyra AC, Sim V, Griffith CA, Long JD, Serra MJ (2007). “Non-nearest-neighbor dependence of stability for RNA bulge loops based on the complete set of group i single nucleotide bulge loops.” Biochemistry, 46(51), 15123–15135.

Badhwar J, Karri S, Cass CK, Wunderlich EL, Znosko BM (2007). “Thermodynamic characterization of RNA duplexes containing naturally occurring 1 * 2 nucleotide internal loops.” Biochemistry, 46(50), 14715–14724.

Davis AR, Znosko BM (2008). “Thermodynamic characterization of naturally occurring RNA single mismatches with G-U nearest neighbors.” Biochemistry, 47(38), 10178–10187.

Miller S, Jones LE, Giovannitti K, Piper D, Serra MJ (2008). “Thermodynamic analysis of 5' and 3' single- and 3' double-nucleotide overhangs neighboring wobble terminal base pairs.” Nucleic Acids Research, 36(17), 5652–5659.

Owczarzy R, Moreira BG, You Y, Behlke MA, Walder JA (2008). “Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations.” Biochemistry, 47(19), 5336–5353.

Watkins NE, Kennelly WJ, Tsay MJ, Tuin A, Swenson L, Lee H, Morosyuk S, Hicks DA, SantaLucia J (2011). “Thermodynamic contributions of single internal rA·dA, rC·dC, rG·dG and rU·dT mismatches in RNA/DNA duplexes.” Nucleic Acids Research, 39(5), 1894–1902.

Chen JL, Dishler AL, Kennedy SD, Yildirim I, Liu B, Turner DH, Serra MJ (2012). “Testing the nearest neighbor model for canonical rna base pairs: Revision of GU parameters.” Biochemistry, 51(16), 3508–3522.

Dumousseau M, Rodriguez N, Juty N, Le Novere N (2012). “MELTING, a flexible platform to predict the melting temperatures of nucleic acids.” BMC Bioinformatics, 13, 101.

See Also

For more details about algorithm, formulae and methods, see the documentation for MELTING 5.

Examples

# Basic usage
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1)

# For more detailed examples refer the vignette.
## Not run: 

browseVignettes(package = 'rmelting')

## End(Not run)

Compute melting temperature of multiple nucleic acid duplexes in batch

Description

Compute the enthalpy and entropy of helix-coil transition, and then the melting temperature of multiple nucleic acid duplexes in batch.

Usage

meltingBatch(
  sequence,
  comp.sequence = NULL,
  environment.out = TRUE,
  options.out = TRUE,
  message.out = TRUE,
  ...
)

Arguments

sequence

A character vector of 5' to 3' sequences of one strand of the nucleic acid duplex (Note: Uridine and thymidine are not considered as identical).

comp.sequence

A character vector of 3' to 5' complementary sequences of the nucleic acid duplex. Complementary sequences are computed by default, but need to be specified in case of mismatches, inosine(s) or hydroxyadenine(s) between the two strands.

environment.out

logical. If TRUE, gives the melting temperature computation environment details in the output. Default is TRUE.

options.out

logical. If TRUE, gives the details about the options (default or user specified) used for melting temperature computation in the output. Default is TRUE.

message.out

logical. If TRUE, gives the error and/or warning messages, if any in the output. Default is TRUE.

...

Arguments for melting temperature computation (See melting).

Value

A data frame of the melting temperature computation results along with the details of environment, options and messages if specified by the arguments environment.out, options.out and message.out respectively.

See Also

melting

Examples

sequence <- c("CAAAAAG", "CAAAAAAG", "TTTTATAATAAA", "CCATCGCTACC",
              "CAAACAAAG", "CCATTGCTACC", "CAAAAAAAG", "GTGAAC", "AAAAAAAA",
              "CAACTTGATATTATTA", "CAAATAAAG", "GCGAGC", "GGGACC",
              "CAAAGAAAG", "CTGACAAGTGTC", "GCGAAAAGCG")

meltingBatch(sequence, nucleic.acid.conc = 0.0004,
             hybridisation.type = "dnadna", Na.conc = 1)

seq <- c("GCAUACG", "CAGUAGGUC", "CGCUCGC", "GAGUGGAG", "GACAGGCUG",
         "CAGUACGUC", "GACAUCCUG", "GACCACCUG", "CAGAAUGUC", "GCGUCGC",
         "CGUCCGG", "GACUCUCUG", "CAGCUGGUC", "GACUAGCUG", "CUCUGCUC",
         "GCGUCCG", "GUCCGCG", "CGAUCAC", "GACUACCUG", "GACGAUCUG")

comp.seq <- c("CGUUUGC", "GUCGGCCAG", "GCGUGCG", "CUCUUCUC", "CUGUGCGAC",
              "GUCGGGCAG", "CUGUUGGAC", "CUGGGGGAC", "GUCUGGCAG", "CGCUGCG",
              "GCUGGCC", "CUGAUAGAC", "GUCGUUCAG", "CUGAGCGAC", "GAGUUGAG",
              "CGCUGGC", "CUGGCGC", "GCUUGUG", "CUGAGGGAC", "CUGCCAGAC")

meltingBatch(sequence = seq, comp.seq = comp.seq, nucleic.acid.conc = 0.0004,
             hybridisation.type = "rnarna", Na.conc = 1,
             method.singleMM = "tur06")

Prints melting temperature from a melting object

Description

print.melting prints to console the melting temperature value from an object of class melting.

Usage

## S3 method for class 'melting'
print(x, ...)

Arguments

x

An object of class melting.

...

Unused

Value

The melting temperature value (degree Celsius) in the console.

See Also

melting