| Title: | Search and visualize intramolecular triplex-forming sequences in DNA |
|---|---|
| Description: | This package provides functions for identification and visualization of potential intramolecular triplex patterns in DNA sequence. The main functionality is to detect the positions of subsequences capable of folding into an intramolecular triplex (H-DNA) in a much larger sequence. The potential H-DNA (triplexes) should be made of as many cannonical nucleotide triplets as possible. The package includes visualization showing the exact base-pairing in 1D, 2D or 3D. |
| Authors: | Jiri Hon, Matej Lexa, Tomas Martinek and Kamil Rajdl with contributions from Daniel Kopecek |
| Maintainer: | Jiri Hon <[email protected]> |
| License: | BSD_2_clause + file LICENSE |
| Version: | 1.52.0 |
| Built: | 2026-05-30 10:57:09 UTC |
| Source: | https://github.com/bioc/triplex |
This package provides functions for the identification and visualization of potential intramolecular triplex (H-DNA) patterns in DNA sequences.
This package is essentially an R interface to the underlying C
implementation of a dynamic-programming search startegy of the same name
(Lexa et al., 2011). The main functionality of the original program was to detect
the positions of subsequences in a much larger sequence capable of folding
into an intramolecular triplex (H-DNA) made of as many cannonical nucleotide
triplets as possible (see triplex.search). In creating its
incarnation in R, we extended this
basic functionality, to include the calculation of exact base-pairing in the
triple helices, which allowed us to extend the functionality of the package
towards visualization showing the exact base-pairing in 1D, 2D or 3D (see
triplex.diagram and triplex.3D).
Matej Lexa, Tomas Martinek, Kamil Rajdl, Jiri Hon
Maintainer: Jiri Hon <[email protected]>
Lexa, M., Martinek, T., Burgetova, I., Kopecek, D., Brazdova, M.: A dynamic programming algorithm for identification of triplex-forming sequences, In: Bioinformatics, Vol. 27, No. 18, 2011, Oxford, GB, p. 2510-2517, ISSN 1367-4803
DNAString,
triplex.search,
triplex.diagram,
triplex.3D
seq <- DNAString("GGAAAGCAATGCCAGGCAGGG") t <- triplex.search(seq, min_score=10, p_value=1) triplex.diagram(t[1]) ## Not run: triplex.3D(t[1]) ## End(Not run) triplex.score.table() triplex.group.table()seq <- DNAString("GGAAAGCAATGCCAGGCAGGG") t <- triplex.search(seq, min_score=10, p_value=1) triplex.diagram(t[1]) ## Not run: triplex.3D(t[1]) ## End(Not run) triplex.score.table() triplex.group.table()
Gets the insertion vector of an object.
ins(x, ...)ins(x, ...)
x |
An object to get the insertion values of. |
... |
Additional arguments. |
t <- triplex.search(DNAString("TATTTATTTTTTCATCTTCTTTTTTTATTTTT"), max_len=11) ins(t);t <- triplex.search(DNAString("TATTTATTTTTTCATCTTCTTTTTTTATTTTT"), max_len=11) ins(t);
Gets the loop ends of an object.
lend(x, ...)lend(x, ...)
x |
An object to get the loop end values of. |
... |
Additional arguments. |
t <- triplex.search(DNAString("TATTTATTTTTTCATCTTCTTTTTTTATTTTT")) lend(t);t <- triplex.search(DNAString("TATTTATTTTTTCATCTTCTTTTTTTATTTTT")) lend(t);
Gets the loop starts of an object.
lstart(x, ...)lstart(x, ...)
x |
An object to get the loop start values of. |
... |
Additional arguments. |
t <- triplex.search(DNAString("TATTTATTTTTTCATCTTCTTTTTTTATTTTT")) lstart(t);t <- triplex.search(DNAString("TATTTATTTTTTCATCTTCTTTTTTTATTTTT")) lstart(t);
Gets the loop widths of an object.
lwidth(x, ...)lwidth(x, ...)
x |
An object to get the loop width values of. |
... |
Additional arguments. |
t <- triplex.search(DNAString("TATTTATTTTTTCATCTTCTTTTTTTATTTTT")) lwidth(t);t <- triplex.search(DNAString("TATTTATTTTTTCATCTTCTTTTTTTATTTTT")) lwidth(t);
Gets the P-values of an object.
pvalue(x, ...)pvalue(x, ...)
x |
An object to get the P-values of. |
... |
Additional arguments. |
t <- triplex.search(DNAString("TATTTATTTTTTCATCTTCTTTTTTTATTTTT")) pvalue(t);t <- triplex.search(DNAString("TATTTATTTTTTCATCTTCTTTTTTTATTTTT")) pvalue(t);
This function visualizes a TriplexViews object as a 3D model.
Its structure can be drawn with automatic optimalizations.
To use this function, please install suggested rgl package from CRAN.
triplex.3D(triplex, opt = TRUE, A.col = "red", T.col = "brown", G.col = "green", C.col = "blue", bbone.col = "violet", bgr.col = "white", bbone.n = 20)triplex.3D(triplex, opt = TRUE, A.col = "red", T.col = "brown", G.col = "green", C.col = "blue", bbone.col = "violet", bgr.col = "white", bbone.n = 20)
triplex |
|
opt |
TRUE or FALSE: TRUE - structure of triplex will be optimalized, FALSE - structure will be drawn without optimalization. |
A.col |
Color of Adine base. |
T.col |
Color of Thymin base. |
G.col |
Color of Guanine base. |
C.col |
Color of Cytosine base. |
bgr.col |
Color of background. |
bbone.col |
Color of backbone. |
bbone.n |
Number of sides of backbone bonds. |
The input TriplexViews object is required to provide additional
algorithm options (see triplex.search). These are used for
proper computation of triplex alignment.
An example of a graphical output corresponding to a triplex type 3 with DNA sequence "GGAAAGCAATGCCAGGCAGGG" is shown in the following figure
Instance of DNAStringSet object with computed alignment.
Kamil Rajdl, Jiri Hon
triplex.diagram,
triplex.search,
triplex.alignment
seq <- DNAString("GGAAAGCAATGCCAGGCAGGG") t <- triplex.search(seq, min_score=10, p_value=1) ## Not run: triplex.3D(t[1]) ## End(Not run)seq <- DNAString("GGAAAGCAATGCCAGGCAGGG") t <- triplex.search(seq, min_score=10, p_value=1) ## Not run: triplex.3D(t[1]) ## End(Not run)
This function computes best triplex alignment.
triplex.alignment(triplex)triplex.alignment(triplex)
triplex |
|
Similarly to other DNA multiple sequence alignments the output of the
triplex.alignment method is stored as DNAStringSet
object. This object consists of four sequences: plus and minus
sequences representing 5' to 3' and 3' to 5' DNA strand of detected triplex;
one of the anti-plus, anti-minus, para-plus or
para-minus sequence representing the third triplex strand aligned to
plus or minus strand in antiparallel or parallel
fashion; and finally loop sequence representing unpaired loop.
Please note that all eight triplex types shown in following figure can be represented using four types of alignments, because each alignment can correspond to triplex detected either on forward or reverse DNA strand.
The input TriplexViews object is required to provide additional
algorithm options (see triplex.search). These are used for
proper computation of triplex alignment.
Instance of DNAStringSet object.
Jiri Hon
triplex.diagram,
triplex.3D,
triplex.search
seq <- DNAString("GGAAAGCAATGCCAGGCAGGG") t <- triplex.search(seq, min_score=10, p_value=1) triplex.alignment(t[1])seq <- DNAString("GGAAAGCAATGCCAGGCAGGG") t <- triplex.search(seq, min_score=10, p_value=1) triplex.alignment(t[1])
This function visualizes a TriplexViews object as a 2D diagram.
Nucleotides are drawn as characters in circles and bonds as lines between
them (Watson-Crick or Hogsteen).
triplex.diagram(triplex, circles = TRUE, mbonds.lty = 1, mbonds.lwd = 2.5, wcbonds.lty = 1, wcbonds.lwd = 1, hbonds.lty = 2, hbonds.lwd = 1, labels.cex = 1, circles.cex = 1, margin = 0.1, bonds.length = 0.07)triplex.diagram(triplex, circles = TRUE, mbonds.lty = 1, mbonds.lwd = 2.5, wcbonds.lty = 1, wcbonds.lwd = 1, hbonds.lty = 2, hbonds.lwd = 1, labels.cex = 1, circles.cex = 1, margin = 0.1, bonds.length = 0.07)
triplex |
|
circles |
TRUE or FALSE: TRUE - nucleotides are drawn as characters in circles, FALSE - nucleotides are drawn just as characters. |
mbonds.lty |
Type of main (skelet) bonds lines. |
mbonds.lwd |
Width of main (skelet) bonds lines. |
wcbonds.lty |
Type of Watson-Crick bonds lines. |
wcbonds.lwd |
Width of Watson-Crick bonds lines. |
hbonds.lty |
Type of Hoogsteen bonds lines. |
hbonds.lwd |
Width of Hoogsteen bonds lines. |
labels.cex |
Multiplier of size of labels of nucleotides. |
circles.cex |
Multiplier of size of nucleotides. |
margin |
Left and right margin of the picture. |
bonds.length |
Length of lines representing Watson-Crick and Hoogsteen bonds. |
The input TriplexViews object is required to provide additional
algorithm options (see triplex.search). These are used for
proper computation of triplex alignment.
An example of a graphical output corresponding to a triplex of type 3 with DNA sequence "GGAAAGCAATGCCAGGCAGGG" is shown in the following figure
Instance of DNAStringSet object with computed alignment.
Kamil Rajdl, Jiri Hon
triplex.3D,
triplex.search,
triplex.alignment
seq <- DNAString("GGAAAGCAATGCCAGGCAGGG") t <- triplex.search(seq, min_score=10, p_value=1) triplex.diagram(t[1])seq <- DNAString("GGAAAGCAATGCCAGGCAGGG") t <- triplex.search(seq, min_score=10, p_value=1) triplex.diagram(t[1])
The triplex.group.table function returns default isogroup tables
for parallel and antiparallel triplex types.
triplex.group.table()triplex.group.table()
This function is used by triplex.search function to get
default isogroup tables. These tables correspond exactly with Table 1 published
in (Lexa, 2011) and they represent the isomorphic groups of triplets.
As a common triplet structure is H.WC:WC, to customize isogroup tables
just use H as a row index, WC as a column index, then set desired group number and
pass such modified tables through group_table option of triplex.search
interface.
List of two matrixes, one for parallel triplex types and the other one for antiparallel.
If you modify the isogroup tables,
you should consider changing also default P-value constants (lambda,
mu and rn), because these are valid just for the default isogroup tables.
Tomas Martinek, Jiri Hon
Lexa, M., Martinek, T., Burgetova, I., Kopecek, D., Brazdova, M.: A dynamic programming algorithm for identification of triplex-forming sequences, In: Bioinformatics, Vol. 27, No. 18, 2011, Oxford, GB, p. 2510-2517, ISSN 1367-4803
triplex.score.table
triplex.search,
TriplexViews,
triplex.diagram,
triplex.3D,
triplex.alignment
triplex.group.table()triplex.group.table()
The triplex.score.table function returns default scoring tables
for parallel and antiparallel triplex types.
triplex.score.table()triplex.score.table()
This function is used by triplex.search function to get
default scoring tables. These tables correspond exactly with Table 1 published
in (Lexa, 2011) and they represent the strength of Hoogsteen bonds between
thirdstrand nucleotide (row index) and a nucleotide from duplex (column index).
As a common triplet structure is H.WC:WC, to customize scoring tables
just use H as a row index, WC as a column index, then set desired score value and
pass such modified tables through score_table option of triplex.search
interface.
Please keep in mind that for a mismatch (no bond at all) special value -9 is used.
If you want to change mismatch penalization, please use mis_pen option of
triplex.search function.
List of two matrixes, one for parallel triplex types and the other one for antiparallel.
If you modify the scoring tables,
you should consider changing also default P-value constants (lambda,
mu and rn), because these are valid just for the default scoring tables.
Tomas Martinek, Jiri Hon
Lexa, M., Martinek, T., Burgetova, I., Kopecek, D., Brazdova, M.: A dynamic programming algorithm for identification of triplex-forming sequences, In: Bioinformatics, Vol. 27, No. 18, 2011, Oxford, GB, p. 2510-2517, ISSN 1367-4803
triplex.group.table
triplex.search,
TriplexViews,
triplex.diagram,
triplex.3D,
triplex.alignment
triplex.score.table()triplex.score.table()
The triplex.search function identifies potential intramolecular
triplex-forming sequences in DNA.
triplex.search( dna, type = 0:7, min_score = 15, p_value = 0.05, min_len = 6, max_len = 25, min_loop = 3, max_loop = 10, seq_type = 'eukaryotic', score_table = 'default', group_table = 'default', lambda_par = 'default', lambda_apar = 'default', mu_par = 'default', mu_apar = 'default', rn_par = 'default', rn_apar = 'default', dtwist_pen = 'default', ins_pen = 'default', iso_pen = 'default', iso_bonus = 'default', mis_pen = 'default')triplex.search( dna, type = 0:7, min_score = 15, p_value = 0.05, min_len = 6, max_len = 25, min_loop = 3, max_loop = 10, seq_type = 'eukaryotic', score_table = 'default', group_table = 'default', lambda_par = 'default', lambda_apar = 'default', mu_par = 'default', mu_apar = 'default', rn_par = 'default', rn_apar = 'default', dtwist_pen = 'default', ins_pen = 'default', iso_pen = 'default', iso_bonus = 'default', mis_pen = 'default')
dna |
A |
type |
Vector of triplex types (0..7) to be searched for. |
min_score |
Minimal score treshold. |
p_value |
Acceptable P-value. |
min_len |
Minimal triplex length. |
max_len |
Maximal triplex length. |
min_loop |
Minimal triplex loop length. Can not be lower than one. |
max_loop |
Maximal triplex loop length. |
seq_type |
Type of input sequence. Possible options: prokaryotic, eukaryotic. |
score_table |
Scoring table for parallel and antiparallel triplex types. Default
is the same as |
group_table |
Isomorphic group table for parallel and antiparallel triplex types. Default
is the same as |
lambda_par |
Lambda for parallel triplex types 0,1,2,3. Default for prokaryotic sequence is 0.8892, for eukaryotic 0.8433. |
lambda_apar |
Lambda for antiparallel triplex types 4,5,6,7. Default for prokaryotic sequence is 0.8092, for eukaryotic 0.6910. |
mu_par |
Mu for parallel triplex types 0,1,2,3. Default for prokaryotic sequence is 7.4805, for eukaryotic 0.8433. |
mu_apar |
Mu for antiparallel triplex types 4,5,6,7. Default for prokaryotic sequence is 7.6569, for eukaryotic 7.9611. |
rn_par |
Hit ratio (reported hits to sequence length) for parallel triplex types 0,1,2,3. Default for prokaryotic sequence is 0.0406, for eukaryotic 0.0304. |
rn_apar |
Hit ratio (reported hits to sequence length) for antiparallel triplex types 4,5,6,7. Default for prokaryotic sequence is 0.0273, for eukaryotic 0.0405. |
dtwist_pen |
Dtwist penalization, default is 7. |
ins_pen |
Insertion penalization, default is 9. |
iso_pen |
Isomorphic group change penalization, default is 5. |
iso_bonus |
Isomorphic group stay bonus, default is 0. |
mis_pen |
Mismatch penalization, default is 7. |
The triplex.search function identifies potential intramolecular
triplex-forming sequences in DNA sequence represented as
a DNAString object.
Based on triplex position (forward or reverse strand) and its third strand
orientation, up to 8 types of triplexes are distinguished by the function (see
the following figure). By default, the function detects all 8 types, however
this behavior can be changed by setting the type parameter to any value
or a subset of values in the range 0 to 7.
Detected triplexes are returned as instances of the
TriplexViews class,
which represents the basic container for storing a set of views on the same
input sequence similarly to the XStringViews object (in fact
TriplexViews only extends the XStringViews class
with a number of displayed columns). Each triplex view is defined by start
and end locations, width, score, P-value, number of insertions, type, strand, loop
start and loop end. Please note, that the strand orientation depends on
triplex type only. The triplex.search function assumes that the input
DNA sequence represents the forward strand.
Basic requirements for the shape or length of detected triplexes can be
defined using four parameters: min_len, max_len,
min_loop and max_loop. While min_len and max_len
specify the length of the triplex stem composed of individual triplets,
min_loop and max_loop parameters define the range of lengths
for the unpaired loop at the top of the triplex. A graphical representation of
these parameters is shown in the following figure. Please note, these
parameters also impact the overall computation time. For longer triplexes,
larger space has to be explored and thus more computation time is consumed.
The quality of each triplex is represented by its score value. A higher score
value represents a higher-quality triplex. This quality is decreased by several
types of imperfections at the level of triplets, such as character mismatch,
insertion, deletion, isomorphic group change etc. Penalization constants for
these imperfections can be setup using the following parameters: mis_pen,
ins_pen, iso_pen, iso_bonus and
dtwist_pen. Detailed information about the scoring function and
penalization parameters can be found in (Lexa et al., 2011). It is highly
recommended to see (Lexa et al., 2011) prior to changing any penalization
parameters.
The triplex.search function can output a large list containing tens of
thousands of potential triplexes. The size of these results can be reduced
using two filtration mechanisms: (1) by specifying the minimal acceptable
score value using the min_score parameter or (2) by specifying the
maximum acceptable P-value of results using the p_value parameter. The
P-value represents the probability of occurrence of detected triplexes in
random sequence. By default, only triplexes with P-value equal or less than
0.05 are reported. Calculation of P-value depends on two extreme value
distribution parameters lambda and mi. By default, these
parameters are set up for searching in human genome sequences. It is highly
recommended to see (Lexa et al., 2011) prior to changing either of the
lambda and mi parameters.
Instance of TriplexViews object based on
XStringViews class.
If you modify the penalization options (dtwist_pen, ins_pen,
iso_pen, iso_bonus, mis_pen), scoring tables (score_table)
or isogroup tables (group_table),
you should consider changing also default P-value constants (lambda,
mu and rn) to get relevant P-values.
Matej Lexa, Tomas Martinek, Jiri Hon
Lexa, M., Martinek, T., Burgetova, I., Kopecek, D., Brazdova, M.: A dynamic programming algorithm for identification of triplex-forming sequences, In: Bioinformatics, Vol. 27, No. 18, 2011, Oxford, GB, p. 2510-2517, ISSN 1367-4803
TriplexViews,
triplex.score.table
triplex.group.table
triplex.diagram,
triplex.3D,
triplex.alignment
# GAA triplet repeats involved in Friedreichs's ataxia seq <- DNAString("GAAGAAGAAGAAGAAGAAGAAGAAGAAGAA") # Search specific triplex types (see details section) triplex.search(seq, type=c(2,3), min_score=10, p_value=1) # Search all triplex types t <- triplex.search(seq, min_score=10, p_value=1) # Sort triplexes by score t[order(score(t), decreasing=TRUE)]# GAA triplet repeats involved in Friedreichs's ataxia seq <- DNAString("GAAGAAGAAGAAGAAGAAGAAGAAGAAGAA") # Search specific triplex types (see details section) triplex.search(seq, type=c(2,3), min_score=10, p_value=1) # Search all triplex types t <- triplex.search(seq, min_score=10, p_value=1) # Sort triplexes by score t[order(score(t), decreasing=TRUE)]
The TriplexViews class is a container for storing a set of triplexes
identified in the same DNA sequence (an DNAString object).
Each triplex is defined by its start/end locations, score, P-value,
insertion number, type, loop start, loop end and strand identification.
TriplexViews object contains also a parameter vector plus score and group tables
that stores custom algorithm options that were used for triplex search.
This is necessary for proper triplex visualization by triplex.diagram
and triplex.3D functions.
A TriplexViews object is in fact a particular case of an
XStringViews
object (the TriplexViews class contains the
XStringViews class) so it
can be manipulated in a similar manner. See
?XStringViews for
detailed information.
If you are interested in algorithm options that are stored in
the TriplexViews object, see parameters of triplex.search
function. These options are required by visualization functions for
proper computation of triplex alignment.
There is no public constructor for TriplexViews object as it stores search algorithm options. TriplexViews object would not be useful without algorithm options attached. For more information see description or details.
All the accessor-like methods defined for XStringViews objects work on TriplexViews objects. In addition, the following accessors are defined for TriplexViews objects:
score(x):
A vector of non-negative integers containing the scores of triplexes.
pvalue(x):
A vector of non-negative doubles containing the P-values of triplexes.
ins(x):
A vector of non-negative integers containing the number of insertions/deletions
in triplexes.
type(x):
A vector of non-negative integers containing the triplex type.
lstart(x):
A vector of non-negative integers containing the triplex loop starts.
lwidth(x):
A vector of non-negative integers containing the triplex loop widths.
lend(x):
A vector of non-negative integers containing the triplex loop ends.
strand(x):
A vector of '+' or '-' signs to identify on which strand the triplex was found.
toString(x):
Converts TriplexViews object into vector of strings.
The only standard way to create a TriplexViews object
is to use triplex.search function.
Jiri Hon
triplex.search,
triplex.diagram,
triplex.3D,
XStringViews,
triplex.alignment
seq <- DNAString("GAAGAAGAAGAAGAAGAAGAAGAAGAAGAA") t <- triplex.search(seq, min_score=10, p_value=1) start(t) end(t) score(t) pvalue(t) ins(t) type(t) # Search triplex with maximal score t[score(t) == max(score(t))] # Sort triplexes by score t[order(score(t), decreasing=TRUE)]seq <- DNAString("GAAGAAGAAGAAGAAGAAGAAGAAGAAGAA") t <- triplex.search(seq, min_score=10, p_value=1) start(t) end(t) score(t) pvalue(t) ins(t) type(t) # Search triplex with maximal score t[score(t) == max(score(t))] # Sort triplexes by score t[order(score(t), decreasing=TRUE)]